Abstract
N-acylhomoserine lactone (AHL)-based quorum sensing (QS) is important for the regulation of proteobacterial virulence determinants. Thus, the inhibition of AHL synthases offers non-antibiotics-based therapeutic potentials against QS-mediated bacterial infections. In this work, functional AHL synthases of Pseudomonas aeruginosa LasI and RhlI were heterologously expressed in an AHL-negative Escherichia coli followed by assessments on their AHLs production using AHL biosensors and high resolution liquid chromatography–mass spectrometry (LCMS). These AHL-producing E. coli served as tools for screening AHL synthase inhibitors. Based on a campaign of screening synthetic molecules and natural products using our approach, three strongest inhibitors namely are salicylic acid, tannic acid and trans-cinnamaldehyde have been identified. LCMS analysis further confirmed tannic acid and trans-cinnemaldehyde efficiently inhibited AHL production by RhlI. We further demonstrated the application of trans-cinnemaldehyde inhibiting Rhl QS system regulated pyocyanin production in P. aeruginosa up to 42.06%. Molecular docking analysis suggested that trans-cinnemaldehyde binds to the LasI and EsaI with known structures mainly interacting with their substrate binding sites. Our data suggested a new class of QS-inhibiting agents from natural products targeting AHL synthase and provided a potential approach for facilitating the discovery of anti-QS signal synthesis as basis of novel anti-infective approach.
Similar content being viewed by others
Introduction
A number of bacterial phenotypes such as virulence, secondary metabolite production and biofilm maturation are controlled by cell-to-cell communication, a process commonly known as quorum sensing (QS). N-acylhomoserine lactones (AHLs) are employed as QS signal molecules in many Gram-negative bacteria. AHL-mediated QS systems requires two components viz. a signal generator (LuxI homologue) which catalyses the formation of AHLs and a response regulator (LuxR homologue) which can bind with the AHLs forming AHL-receptor complex to regulate the transcription of target QS-mediated genes1,2. AHL synthase catalyses the formation of an amide bond between the homoserine lactone ring from S-adenosylmethionine (SAM) and the acyl chain from the acyl acyl-carrier-protein (acyl-ACP). After catalysed, the product of AHL and by-products of holo-ACP and 5′-methylthioadenosine (MTA) are generated and released3.
In Pseudomonas aeruginosa, two AHL-mediated LasR/I and RhlI/R and one AQ-mediated (2-alkyl-4-(1H)-quinolone) QS systems which work hierarchically have been extensively studied4,5. LasI is responsible for producing the N-3-oxododecanyol-L-homoserine lactone (3-oxo-C12 HSL), which in turns activates the regulator LasR to modulate the expressions of the downstream genes including the Rhl system and the genes encoding a virulence factor, elastase. RhlI is essential to synthesize N-butanoyl-L-homoserine lactone (C4-HSL). The C4-HSL/RhlR complex is crucial to regulate a series of downstream genes, including rhlI and phz operon for pyocyanin synthesis. These two Lux families of QS regulatory systems are interlinked with the AQ-mediated Pseudomonas QS (PQS) system whereby 2-heptyl-3-hydroxy-4-quinolone (PQS) is used as a QS signal. The Las, Rhl and PQS systems are correlated in a hierarchical circuitry and exert a global impact on a range of genes in P. aeruginosa, covering virulence production, antibiotic resistance and programmed cell death6,7,8. Several animal studies have suggested the important roles of QS in P. aeruginosa pathogenesis by showing that the QS mutants cause less tissue damage and mortality rate when compared to wild-type5.
Bacterial QS has been considered as the therapeutic target to attenuate bacterial virulence and thus control infection by degrading QS signals or interrupting the perception of signal molecules on LuxR homologous protein1,8. Three types of enzymes including AHL-lactonase, AHL-acylase and AHL-oxidoreductase have been documented to cause AHL molecules degradation in distinctive pathways from one another has been documented9,10,11. In addition, there are also several small molecules that are capable of inhibiting QS. These molecules are either structurally mimics to the cognate QS signals or enzyme inhibitors interfering with the corresponding signal binding to the receptor or decreasing the receptor concentration, therefore disrupting the QS mechanism12. For instance, halogenated furanones produced by the red marine alga Delisea pulchra has been shown to bind and increase the turnover rate of LuxR homologue and hence disrupting the AHL-mediated swarming and surface colonization of pathogenic bacterium Serratia liquefaciens13,14. For the inhibition of PQS pathway, it has been reported that anthranilate, one precursor for PQS, was modified into methyl anthranilate that would act as inhibitor for PQS production resulting in reduced pathogenicity of P. aeruginosa including reduction in the expression of elastase15. Although QS is an ideal target to attenuate bacterial virulence, several studied including mathematic models and experimental evidence suggest bacteria rapidly evolve and spread the resistance against QS inhibitors (see review16). For example, P. aeruginosa PA14 is capable of resisting to a well-characterised QS inhibitor, brominated furanone C-30 by enhancing efflux of this compound17. Therefore, it is necessary to identify new targets for inhibiting bacterial QS.
Here we constructed two well-controlled AHL producing E. coli from LasI and RhlI expression plasmids, respectively. A total of 114 plant extracts and 10 pure synthetic compounds were screened for their specific inhibition on AHL synthesis. One particular compounds, trans-cinnamaldehyde, have been demonstrated their potential for inhibiting AHLs production and QS-regulated pyocyanin in P. aeruginosa PAO1. Molecular docking analysis with known structure LasI and EsaI suggested the inhibiting mechanism of trans-cinnamaldehyde might be the occupation of crucial substrate binding pocket for AHL production.
Results
Constructing AHL-producing E. coli
AHLs play important roles for bacterial communication and virulence in human pathogens. Inhibiting AHLs production is considered a useful strategy to attenuate pathogens virulent determinants. To screen for AHL synthase inhibitors, two L-arabinose-dependent expression plasmids namely pBAD-lasI and pBAD-rhlI, harbouring P. aeruginosa PAO1 lasI and rhlI genes were constructed and transformed into AHL-negative E. coli MG1655, respectively (Supplementary Fig. S1 online). The expression of lasI and rhlI genes was driven by L-arabinose-inducible promoter in the pBAD expression plasmid. The constructed plasmids in E. coli MG1655, MG1655 [pBAD24], MG1655 [pBAD-lasI] and MG1655 [pBAD-rhlI] were tested for their ability to produce AHLs by induction separately using (in w/v) 0%, 0.1% and 1% L-arabinose for 4 hours during the exponential phase (OD600 = 0.6–0.8). AHLs from the respective induced cultures were extracted and spotted on thin layer chromatography (TLC) plate. Positive controls involving the extract from exponential phase of P. aeruginosa PAO1, 50 pmol of synthetic C4-HSL and 3-oxo-C12-HSL were included while solvent acted as negative control were all spotted on the same TLC plate. Subsequently, the resulting TLC plate was overlaid with biosensors E. coli JM109 [pSB1075] and E. coli JM109 [pSB536] for detection of long and short chain AHLs, respectively (Supplementary Fig. S2A and Fig. S2B online). No bioluminescence was observed from the extracts without L-arabinose induction hence indicating the production of long chain AHL by E. coli MG1655 [pBAD-lasI] and short chain AHL by E. coli MG1655 [pBAD-rhlI] are tightly controlled by L-arabinose. In addition to this, high resolution LCMS analysis confirmed 3-oxo-C12-HSLand C4-HSL productions by E. coli MG1655 [pBAD-lasI] and E. coli MG1655 [pBAD-rhlI], respectively, which are well controlled by L-arabinose (Supplementary Fig. S2C online). These two AHL-producing E. coli were then employed for anti-QS compounds screening.
Rapid Screening for AHL Synthases inhibitors
Plants were shown to contain abundant sources of anti-bacterial or anti-QS compounds18. Our original aim was to screen for anti-QS natural products specific targeting bacterial AHL signal synthesis using constructed AHL-producing E. coli. However, after screening 114 natural products extracts from tropical plants and herbs but to no avail. Thus, we turned to screen synthetic, pure compounds from commercial sources and 10 pure compounds of plant origin were selected based on literatures with reference to their reported anti-QS activity or anti-bacterial biofilm formation. Among these 10 compounds, furanones is a well-studied analogue to AHLs, which affects the QS system in C. violaceum19. Additional studies also showed that P. aeruginosa biofilms pre-treated with furanones are more susceptible to antibiotic tobramycin20. Two 2[5H]-furanones of Lactobacillus helveticus were proposed to be the QS signal in this microorganism21. This has led to the selection of 5-ethyl-3-hydroxy-4-methyl-2[5H]-furanone, a commercially available derivative of furanones, an alternative to 2[5H]-furanones in the preliminary screening. Andrographolide and curcumin were also reported to significantly repress the QS-regulated virulence, including pyocyanin and elastase in P. aeruginosa22,23. Ellagic acid and fisetin were found to drastically attenuate the biofilm formation of Streptococcus dysgalactiae24. Salicylic acid has been shown to repress AHL production in P. aeruginosa as well as reduction of bacterial invasion and cytotoxicity to HCE cells25. Tannic acid is a type of tannin, which was originally discovered from tropical tree Terminalia catappa which is traditionally used as antimicrobial activity and is recently discovered for the novel anti-inflammatory effect26. Lastly, trans-cinnamaldehyde is an ingredient in cinnamon oil. Previous studies have suggested cinnamaldehyde and its analogs are inhibitor of AI-2 (autoinducer 2)-based QS and virulence in Vibrio spp.27.
To initiate our screening, firstly the pure compounds with (3 mg/ml, final concentration) were incubated with 1% w/v L-arabinose induced E. coli MG1655 [pBAD-rhlI] for 4 hours and AHLs were extracted from the spent supernatants. AHLs extracts were then detected by C. violaceum CV026 which produces purple violacein in the presence of short-chain AHLs (Fig. 1A). The extracts from E. coli MG1655 [pBAD-rhlI] treated with salicylic acid, tannic acid and trans-cinnamaldehydehave been suggested no short-chain AHLs production due to no violacein production from CV026 biosensor. Based on this preliminary screening among those compounds, salicylic acid, tannic acid and trans-cinnamaldehyde were selected for further analysis as potential AHL synthase inhibitors.
LCMS analysis for detecting AHLs reduction
To verify the results involving biosensors screening, AHL extracts obtained from L-arabinose-induced E. coli MG1655 [pBAD-rhlI] culture treated with three potential AHL synthase inhibitors (with concentrations of 0.3 mg/ml and 3 mg/ml) were analysed by LCMS (Fig. 2 and Supplementary Table S1 online). C4-HSL extracted from spent supernatants of negative controls was readily detected (Fig. 2). C4-HSL was also detected from the extract treated with 2.17 mM (equivalent to 0.3 mg/ml) salicylic acid (m/z 172.3; 0.556 min). However, no C4-HSL was detected from the extract treated with 0.06 mM (equivalent to 0.3 mg/ml) tannic acid and 2.27 mM (equivalent to 0.3 mg/ml) trans-cinnamaldehyde in our experimental condition. In the screening using C. violaceum CV026, no detectable AHL was observed in extract treated with salicylic acid but C4-HSL was still detected by the sensitive LCMS which suggested that the salicylic acid may be able to reduce but not to completely inhibit AHL production. Similar result was also reported with AHL production being suppressed by 30 mM salicylic acid using TLC overlaying with C. violaceum CV026 biosensor25. In addition to this, previous studies have shown that salicylic acid attenuates the virulence production and biofilm formation in P. aeruginosa and inhibits its growth and swarming25,28. Our data confirmed salicylic acid with high concentration is able to repress AHL production, which resulted in the attenuation of bacterial virulence.
To further investigate whether AHL synthase inhibition of the three potential inhibitors is universal, AHLs extracted from L-arabinose induced E. coli MG1655 [pBAD-lasI] cultures were also detected by LCMS (Fig. 3 and Supplementary Table S2 online). Synthetic 3-oxo-C12-HSL was detected (m/z 298.3; 5.785 min) which served as standard. Detection of 3-oxo-C12-HSL from negative controls was also indicated (Fig. 3). Not surprisingly, 2.17 mM salicylic acid cannot inhibit AHL production from LasI where 3-oxo-C12-HSL was readily detected (m/z 298.3; 5.720 min). However, 3-oxo-C12-HSL was also detected in the extracts treated with 0.06 mM tannic acid at 5.883 min (m/z 298.3) and with 2.27 mM trans-cinnamaldehyde at 5.883 min (m/z298.3). These data suggested that tannic acid and trans-cinnamaldehyde are QS inhibitors that specifically target short-chain AHL synthase (RhlI) but not long-chain AHL synthase (LasI).
Phenotypic effects of AHL synthase inhibitors
In order to confirm tannic acid and trans-cinnamaldehyde are not targeting the transcription of promoter BAD and translation process, the third plasmid, pBAD-lux, was constructed with luminescent light producing genes under PBAD control and transformed into E. coli MG1655. The resulting transformed bacteria were then incubated in LB containing 0.1% (w/v) L-arabinose with tannic acid (0.06 mM) and trans-cinnamaldehyde (2.27 mM) followed by the measurement of optical density and light output for 24 hours (Supplementary Fig. S3 online). As a result, bacterial bioluminescence was induced in presence of 0.1% w/v L-arabinose, which suggested that the lux operon in E. coli was fully functional (Supplementary Fig. S3A online). The bioluminescence of trans-cinnamaldehyde treated samples showed no difference as compared to negative controls (Supplementary Fig. S3A online). Therefore the trans-cinnamaldehyde is neither a transcriptional nor translational inhibitor. After treated with tannic acid, bacterial bioluminescence was reduced compared to controls with the output being much higher than non-induction control. The tannic acid may have effects on L-arabinose inducing transcription, protein translation or bioluminescence production with unknown mechanism. The treatment of (10% v/v) DMSO, tannic acid and trans-cinnamaldehyde did not affect the growth of E. coli (Supplementary Fig. S3B online). Collectively, these data confirmed the inhibition of AHL production by trans-cinnamaldehyde is not due to the growth, the transcription of pBAD promoter and protein translation. Furthermore, the growth curve of P. aeruginosa was measured showing no anti-bacterial effects exerted by tannic acid and trans-cinnamaldehyde (Supplementary Fig. S3C online). Therefore trans-cinnamaldehyde was selected for further characterisation of AHL synthase inhibition.
QS regulation of swarming enable optimal distribution of bacterial cells when the population is getting too large to occupy a small niche or when the nutrients in the surrounding environment is no longer to meet their needs29. In P. aeruginosa, rhlAB operon encoding rhamnolipid, a type of biosurfactant promoting swarming motility, is positively regulated by rhlI/R C4-HSL QS system1,30. In this study, P. aeruginosa PAO1 culture was spotted on the swarming agars without any solvent and inhibitor and swarming agars containing 10% v/v DMSO as solvent control and 0.3 mg/ml trans-cinnamaldehyde (equivalent to 2.27 mM). However bacterial swarming has no reduction caused by the inhibitor (Fig. 4A). This suggested the regulations of swarming are unable to be inhibited by simply reducing QS signal molecule production by trans-cinnamaldehyde.
Pyocyanin is a green phenazine pigment produced by P. aeruginosa, functioning as a redox active toxin and antibiotic and promoting extracellular DNA (eDNA) release for biofilm formation31. Pyocyanin biosynthesis in P. aeruginosa is mediated by two operons, phz1 and phz2, which are regulated by Rhl QS system via PQS system hierarchically4. Therefore pyocyanin is a good indicator for investigating the effect of RhlI inhibitor. P. aeruginosa PAO1 cultures was treated with different concentration of trans-cinnamaldehyde for 24 hours and then the pyocyanin was extracted and determined. Pyocyanin from no treatment and 10% v/v DMSO treated cultures were also measured as negative control (Fig. 4B). The data were acquired from 4 biological replicates and normalised. No treatment of PAO1 culture was defined as 100% pyocyanin production and DMSO treated was 93.02%, which is not significant. When treated with 0.1, 0.2 and 0.3 mg/ml of trans-cinnamaldehyde, the production of pyocyanin was significantly reduced as the production are 65.54%, 63.03% and 57.94%, respectively (P < 0.05). These data suggested the trans-cinnamaldehyde reduced the QS-regulated pyocyanin production up to 42.06%.
Molecular docking analysis of trans-cinnamaldehyde
Although protein sequence in most well studied AHL synthase is divergent, they share four regions of conserved sequence and there are 8 residues are identical within these regions4,31,32,33. To understand the mechanism of trans-cinnamaldehyde mediated inhibition of AHL synthase, we performed the molecular docking analysis and predicted the potential trans-cinnamaldehyde binding site in AHL synthase. LasI is the counterpart of AHL synthase in P. aeruginosa. LasI, which produces 3-oxo-C12-HSL, shares 31% identity (47% homology) of protein sequence with RhlI and its protein crystal structure has been determined (PDB: 1RO5)33. Trans-cinnamaldehyde was docked into LasI successfully (Fig. 5A). Based on this docking pose, we speculated that the trans-cinnamaldehyde is “locked” deeply into the binding site and forms hydrophobic and Pi-Pi interactions with surrounding residues (Phe27, Trp33and Phe105) and one hydrogen bond with Arg30. The crystal structure study of LasI has suggested that N-terminal residue Phe27, Arg30 and Trp33 are crucial for forming an SAM binding pocket and Phe105 is a well conserved residue for acyl-chain binding tunnel33. Although trans-cinnamaldehyde mainly binds to the SAM binding pocket of LasI, reduced amount of 3-oxo-C12-HSL was still detected by LCMS which suggested the blocking SAM binding site may not be the only mechanism for trans-cinnamaldehyde inhibition. To further understand the binding property of trans-cinnamaldehyde to AHL synthase, we performed the second docking analysis using the other structure-known EsaI (PDB: 1KZF) which produces short chain 3-oxo-C6-HSL in phytopathogenic bacteria Pantoea stewartii. EsaI also containing four conserved regions and 8 crucial residues shares 23% identity (44% homology) with RhlI34. The successful molecular docking suggested the trans-cinnamaldehyde forms two hydrogen bonds with the backbones of Arg100 and Phe101 and forms hydrophobic and Pi-Pi interactions with surrounding residues (Phe101, Phe123 and Trp155) (Fig. 5B). Arg100 and Phe101 have been suggested to form hydrogen bonds with acyl-chain substrate in the hydrophobic core of EsaI. EsaI Phe123 and Trp155 may have no direct contact with N-hexanoyl chain but provide the shape and size through hydrophobic packing with other residues34. Thus the docking pose suggested that trans-cinnamaldehyde may bind to acyl-chain binding site in EsaI.
Discussion
The insolubility and activity lost of the purified P. aeruginosa LasI and RhlI expressed in E. coli background made these two proteins difficult to study. Therefore low copy number IPTG (isopropyl β-D-1-thiogalactopyranoside) induction expression plasmids were constructed. However, those plasmids showed loose-control of protein expression which are unsuitable for AHL biosynthesis study35,36. In contrast, the plasmids constructed in this study showed well-controlled AHLs production and accurate AHLs profile37. Therefore E. coli MG1655 carrying pBAD-lasI and pBAD-rhlI are ideal for the studies of AHL synthases and screening for AHL synthases inhibitors. Three hit compounds from initial screenings, salicylic acid, tannic acid and trans-cinnamaldehyde were selected. High resolution LCMS analysis suggested salicylic acid was unable to abolish AHL synthesis and bacterial luminescence measurement suggested tannic acid has potential effects on Lux protein expression or function. Therefore trans-cinnamaldehyde is the only hit compound showing AHL synthase inhibition with no bactericidal and bacteriostatic effects. Previous studies have shown that cinnamaldehyde interferes with the 3-oxo-C6-HSL based QS system in Vibrio spp.by decreasing the DNA-binding ability of LuxR regulator proteins27,38. To the best our knowledge, this is the first report showing that cinnamaldehyde interferes with AHLs production.
AHL synthase catalyses the formation of an amide bond between the homoserine lactone ring from SAM and the acyl chain from acyl-ACP. A synthetic C8-HSL analogue, J8-C8, has shown its inhibition of TofI, a C8-HSL synthase in Burkholderia glumae strain BGR1. X-ray crystal structure analysis showed that J8-C8 binds to TofI and occupies the binding site for the acyl-ACP providing acyl chain to TofI39. Interestingly, our hit compound trans-cinnamaldehyde, have no chemical structure similarity to AHLs or AHL analogues, which suggests a novel mechanism of AHL synthase inhibition.
Based on our docking analysis, trans-cinnamaldehyde interacts with LasI Phe27 and Trp33 and forms hydrogen bond with Arg30. These residues are completely conserved in LuxI family including EsaI and RhlI and form the putative pocket for SAM32. However we were unable to dock trans-cinnamaldehyde to potential SAM binding pocket of EsaI due to lack of highly mobile residues 16 to 2834. Here we proposed that the binding of trans-cinnamaldehyde to the SAM binding pocket is unable to inhibit AHL synthase activity.
AHLs vary in their acyl-chain. The selection mechanism of Acyl-ACP with different acyl-chain length has been suggested by the structure studies but the detail of acyl-chain preference in different AHL synthases is still unclear. In LasI a hydrophobic tunnel with no restriction on the length of the acyl-chain has form and Phe105 in beta-4 region is one of the conserved residues33. EsaI has a size restrictive hydrophobic pocket for acyl-chain binding and Arg100 and Phe101 (the conserved residue as LasI Phe105) in beta-4 region may form hydrogen bonds with acyl-chain substrate during the acylation reaction34. It has been suggested that the different sizes and open/closed acyl-chain binding pockets provide the explanations for Acyl-ACP selection. In our docking analysis, trans-cinnamaldehyde forms hydrophobic and Pi-Pi interactions with conserved LasI Phe105 in the open hydrophobic tunnel. In EsaI docking analysis, two hydrogen bonds forming between trans-cinnamaldehyde and two crucial residues (Arg100 and Phe101) may block completely the interaction between catalytic site and acyl-chain substrate. This may explain the trans-cinnamaldehyde is able to inhibit short-chain AHL synthase but not long-chain AHL synthase completely due to the difference of acyl-chain binding site structures. Interestingly, instead of conserved nonpolar phenylalanine in LasI and EsaI, polar tyrosine was located in the beta-4 region of RhlI. Therefore the mechanism of trans-cinnamaldehyde on RhlI is still unclear and more biological and structural analysis is needed.
In summary, plant extracts and 10 pure compounds were screened by tightly regulated LasI and RhlI expression plasmids resulting in one hit compounds showing active inhibition of AHLs production and attenuated P. aeruginosa PAO1 pyocyanin production without interference on the bacterial growth. Molecular docking studies proposed the potential mechanism of inhibition on AHL synthases. Our study may have facilitated the design of a new class of QS-inhibiting therapeutic agentby structure-based approaches and more structure details of the interaction between inhibitor and enzymes are required.
Methods
Bacterial strains, media and culture conditions
Escherichia coli DH5α was used as the cloning host and E. coli MG1655 was used for proteins expression and AHLs production. E. coli JM109 [pSB536] and E coli JM109 [pSB1075] are lux-based AHL biosensors40,41. P. aeruginosa PAO1 was cultured as AHL production positive control. All bacterial strains were routinely grown on LB (Luria-Bertani, Oxoid Ltd. UK) agar plates and in LB broth with 200 rpm shaking with appropriate antibiotics at 37°C for E. coli and P. aeruginosaPAO1 and 28°C for C. violaceum CV026 biosensor42. Antibiotics were used at the following concentrations: ampicillin, 100 mg/ml; tetracycline, 10 mg/ml (Sigma Aldrich, UK). Growth curve and luminescence was quantified in 96-well microtitre plates by using Tecan luminometer (Infinite M200Pro).
Plasmids construction
Phusion High-Fidelity DNA Polymerase was used for PCR amplification of the lasI and rhlI genes from P. aeruginosa PAO1 genomic DNA following the manufacturer's instructions (NEB, US). For lasI gene, the forward and reverse primers used were lasIFor (5′-CCTCTAGAATGATCGTACAAATTGG-3′) with XbaI engineered restriction site (underline) and lasIRev (5′-TCAAGCTTTCATGAAACCGCCAGTC-3′) with HindIII engineered restriction site, respectively. For rhlI, the forward and reverse primers used were rhlIFor (5′- CCTCTAGAATGATCGAATTGCTCTC -3′) with XbaI engineered restriction site (underline) and rhlIRev (5′-TCAAGCTTTCACACCGCCATCGACA-3′) with HindIII engineered restriction site respectively. The PCR products were digested with XbaI and HindIII and ligated with the same enzymes digested pBAD24 which consisted of a PBAD promoter and a Shine-Dalgarno box43. The ligation mixtures were electroporated into E. coli DH5α. The resulting plasmids, pBAD-lasI (Supplementary Fig. S1A online) and pBAD-rhlI (Supplementary Fig. S1B online) were sequenced using pBADFor (5′-CTGTTTCTCCATACCCGTT-3′) followed by transformation into E. coli MG1655. pBAD-lux was constructed by ligating pBAD24 digested with KpnI and BamHI with luxCDABE operon from pSB401 digested by the same enzymes41 and then transformed into E. coli MG1655.
AHLs extraction and detection
E. coli MG1655 strains harbouring expression plasmids for the AHL synthases LasI and RhlI were grown in 10 ml cultures in LB broth for overnight. Each culture was then diluted 1:50 into 10 ml of fresh LB broth and incubated until the cell density reached an optical density at 600 nm (OD600) of 0.6 to 0.8 followed by adding L-arabinose (Sigma Aldrich, UK) with final concentration 0%, 0.1% or 1% (w/v) for 5-hour induction. P. aeruginosa PAO1 culture was grown in 10 ml LB broth for overnight without L-arabinose induction and its AHLs production was extracted to serve as positive control. At desired time point, cell-free culture supernatant was extracted using acidified ethyl acetate (0.01% v/v glacial acetic acid in ethyl acetate). Extracts were evaporated to dryness and stored in −20°C for further analysis by lux-based biosensors, C. violaceum CV026 or LCMS as previously described41,44. Synthetic AHLs (Sigma Aldrich, UK) were used as LCMS standards.
QS Inhibiting Compounds
All synthetic compounds were obtained from Sigma Aldrich (UK) and dissolved in DMSO, sterilized by filtering through syringe filter (pore size of 0.2 µm) and stored at −20°C in sealed sterile tubes. DMSO (10% v/v) was added to controls in all assays to eliminate solvent effect.
Swarming Assay
The swarming plates for P. aeruginosa PAO1were prepared using 0.5% w/v Bacto agar, 0.5% w/v peptone, 0.2% w/v yeast extract and 1.0% w/v glucose, per 100 ml distilled water and the assay was performed as previously described45. The inhibitors with appropriate concentrations were seeded with 5 ml of the agar, mixed well and poured immediately on a 10 ml of pre-poured agar plate as an overlay. Two microliters of the P. aeruginosa PAO1overnight culture was inoculated at the center of the agar surface and the plates were incubated for 16 hours at 37°C.
Pyocyanin Assay
Pyocyanin quantification assay was performed as previous described with slight modification46. Overnight culture of P. aeruginosa PAO1 was diluted with LB medium to an OD600 of 0.1 and the diluted culture was supplemented with 15 μl of 0.1, 0.2 and 0.3 mg/ml (final concentration) of trans-cinnamaldehyde and incubated at 37°C for 24 hours. DMSO (10% v/v) served as negative control. The 5 ml cell culture was extracted with 3 ml of chloroform and was then mixed with 1 mL of 0.2 M hydrochloric acid. The organic layer was collected by centrifugation and was then measured at 520 nm using Tecan luminometer (Infinite M200, Männerdorf, Switzerland). The experiments were performed in quadruplicate.
Bioluminescence Assays
Bioluminescence and optical density were determined simultaneously in 96-well microtiter plates using a Tecan luminometer (InfiniteM200Pro) as previously described45. Briefly, overnight culture of E. coli MG1655::pBAD24-lux was diluted 1:100 in sterile fresh LB medium with 0.1% w/v L-arabinose, aliquoted (200 μL) and then loaded into each well containing the test QS inhibitors at desired concentrations. Bioluminescence and optical density were automatically simultaneously determined every 30 min for 24 hours. Bioluminescence is given as relative light units (RLU) per unit of optical density at 495 nm, which accounted for the influence of increased growth on the total bioluminescence. Experiments were done in triplicates and repeated three times.
Molecular docking
GOLD (v 5.1; Genetic Optimization for Ligand Docking) was used to dock trans-cinnamaldehyde into LasI (PDB: 1RO5)47 and EsaI (PDB:1KZF)34.The crystal structure of LasI and EsaI was treated by Amber 12 with amber ff12SBforce field48 and all hydrogen atoms were added. GOLD was used to dock each ligand 10 times, starting each time from a different random population of ligand orientations and using the default automatic genetic algorithm parameter settings. LasI contains two binding sites: SAM (composed by Phe27, Arg30 and Trp33) and acyl-chain binding site (composed by Arg30, Trp69, Leu102, Phe105, Met125, Leu140, Thr144, Val148, Met151, Met152, Ala155, Leu157, Ile178 and Leu188) reported previously33,39. These two sites are adjacent to each other and were combined together as the active site for molecular docking. For molecular docking on EsaI the cavity composed by Ser98, Phe101, Phe123, Ile138, Val142, Met146, Leu150, Ser153, Trp155 and Leu176 was indicated as the binding site. In both docking studies, all torsion angles in each compound were allowed to rotate freely.
References
Cámara, M., Williams, P. & Hardman, A. Controlling infection by tuning in and turning down the volume of bacterial small-talk. Lancet Infect Dis 2, 667–676 (2002).
Fuqua, C. & Greenberg, E. P. Listening in on bacteria: acyl-homoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3, 685–695 (2002).
Parsek, M. R., Val, D. L., Hanzelka, B. L., Cronan, J. E. & Greenberg, E. P. Acyl homoserine-lactone quorum-sensing signal generation. Proc. Natl. Acad. Sci. USA 96, 4360–4365 (1999).
Williams, P. & Cámara, M. Quorum sensing and environmental adaptation in Pseudomonas aeruginosa: a tale of regulatory networks and multifunctional signal molecules. Curr. Opin. Microbiol. 12, 182–191 (2009).
Antunes, L. C. M., Ferreira, R. B. R., Buckner, M. M. C. & Finlay, B. B. Quorum sensing in bacterial virulence. Microbiology 156, 2271–2282 (2010).
Shirtliff, M. E., Mader, J. T. & Camper, A. K. Molecular interactions in biofilms. Chem. Biol. 9, 859–871 (2002).
Wagner, V. E., Bushnell, D., Passador, L., Brooks, A. I. & Iglewski, B. H. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J. Bacteriol. 185, 2080–2095 (2003).
González, J. E. & Keshavan, N. D. Messing with bacterial quorum sensing. Microbiol. Mol. Bio. Rev. 70, 859–875 (2006).
Dong, Y. H., Gusti, A. R., Zhang, Q., Xu, J. L. & Zhang, L. H. Identification of Quorum-quenching N-acyl homoserine lactonases from Bacillus species. Appl. Environ. Microbiol. 68, 1754–1759 (2002).
Lin, Y.-H. et al. Acyl-homoserine lactone acylase from Ralstonia strain XJ12B represents a novel and potent class of quorum-quenching enzymes. Mol. Microbiol. 47, 849–860 (2003).
Uroz, S. et al. N-Acylhomoserine lactone quorum-sensing molecules are modified and degraded by Rhodococcus erythropolis W2 by both amidolytic and novel oxidoreductase activities. Microbiology 151, 3313–3322 (2005).
Dong, Y. H., Wang, L. H. & Zhang, L. H. Quorum-quenching microbial infections: mechanisms and implications. Phil. Trans. R. Soc. B. 362, 1201–1211 (2007).
Manefield, M. et al. Evidence that halogenated furanones from Delisea pulchra inhibit acylated homoserine lactone (AHL)-mediated gene expression by displacing the AHL signal from its receptor protein. Microbiology 145, 283–291 (1999).
Manefield, M. et al. Halogenated furanones inhibit quorum sensing through accelerated LuxR turnover. Microbiology 148, 1119–1127 (2002).
Calfee, M. W. Interference with Pseudomonas quinolone signal synthesis inhibits virulence factor expression by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 98, 11633–11637 (2001).
García-Contreras, R., Maeda, T. & Wood, T. K. Resistance to quorum-quenching compounds. Appl. Environ. Microbiol. 79, 6840–6846 (2013).
Maeda, T. et al. Quorum quenching quandary: resistance to antivirulence compounds. ISME J. 6, 493–501 (2012).
Koh, C.-L. et al. Plant-derived natural products as sources of anti-quorum sensing compounds. Sensors 13, 6217–6228 (2013).
Martinelli, D., Grossmann, G., Séquin, U., Brandl, H. & Bachofen, R. Effects of natural and chemically synthesized furanones on quorum sensing in Chromobacterium violaceum. BMC Microbiol. 4, 25 (2004).
Hentzer, M. et al. Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. EMBO J. 22, 3803–3815 (2003).
Ndagijimana, M. et al. Two 2[5H]-furanones as possible signaling molecules in Lactobacillus helveticus. Appl. Environ. Microbiol. 72, 6053–6061 (2006).
Wu, C. M. et al. Effect and mechanism of andrographolide on the recovery of Pseudomonas aeruginosa susceptibility to several antibiotics. J. Int. Med. Res. 36, 178–186 (2008).
Rudrappa, T. & Bais, H. P. Curcumin, a known phenolic from Curcuma longa, attenuates the virulence of Pseudomonas aeruginosa PAO1 in whole plant and animal pathogenicity models. J. Agric. Food Chem. 56, 1955–1962 (2008).
Dürig, A., Kouskoumvekaki, I., Vejborg, R. M. & Klemm, P. Chemoinformatics-assisted development of new anti-biofilm compounds. Appl. Microbiol. Biotechnol. 87, 309–317 (2010).
Bandara, M. B. K., Zhu, H., Sankaridurg, P. R. & Willcox, M. D. P. Salicylic acid reduces the production of several potential virulence factors of Pseudomonas aeruginosa associated with microbial keratitis. Invest. Ophthalmol. Vis. Sci. 47, 4453–4460 (2006).
Taganna, J. C., Quanico, J. P., Perono, R. M. G., Amor, E. C. & Rivera, W. L. Tannin-rich fraction from Terminalia catappa inhibits quorum sensing (QS) in Chromobacterium violaceum and the QS-controlled biofilm maturation and LasA staphylolytic activity in Pseudomonas aeruginosa. J. Ethnopharmacol. 134, 865–871 (2011).
Brackman, G. et al. Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response regulator LuxR. BMC Microbiol 8, 149 (2008).
Prithiviraj, B. et al. Down regulation of virulence factors of Pseudomonas aeruginosa by salicylic acid attenuates its virulence on Arabidopsis thaliana and Caenorhabditis elegans. Infect. Immun. 73, 5319–5328 (2005).
Daniels, R., Vanderleyden, J. & Michiels, J. Quorum sensing and swarming migration in bacteria. FEMS Microbiol. Rev. 28, 261–289 (2004).
Déziel, E., Lépine, F., Milot, S. & Villemur, R. rhlA is required for the production of a novel biosurfactant promoting swarming motility in Pseudomonas aeruginosa: 3-(3-hydroxyalkanoyloxy) alkanoic acids (HAAs), the precursors of rhamnolipids. Microbiology 149, 2005–2013 (2003).
Das, T. & Manefield, M. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS ONE 7, e46718 (2012).
Parsek, M. R. & Schaefer, A. L. Analysis of random and site-directed mutations in rhlI, a Pseudomonasaeruginosa gene encoding an acylhomoserine lactone synthase. Mol. Microbiol. 26, 301–310 (1997).
Gould, T. A., Schweizer, H. P. & Churchill, M. E. A. Structure of the Pseudomonas aeruginosa acyl-homoserinelactone synthase LasI. Mol. Microbiol. 53, 1135–1146 (2004).
Watson, W. T., Minogue, T. D., Val, D. L., Bodman, v. o. n., S, B. & Churchill, M. E. A. Structural basis and specificity of acyl-homoserine lactone signal production in bacterial quorum sensing. Mol. Cell 9, 685–694 (2002).
Gould, T. A., Herman, J., Krank, J., Murphy, R. C. & Churchill, M. E. A. Specificity of acyl-homoserine lactone synthases examined by mass spectrometry. J. Bacteriol. 188, 773–783 (2006).
Hoang, T. T., Ma, Y., Stern, R. J., McNeil, M. R. & Schweizer, H. P. Construction and use of low-copy number T7 expression vectors for purification of problem proteins: purification of Mycobacterium tuberculosis RmlD and Pseudomonas aeruginosa LasI and RhlI proteins and functional analysis of purified RhlI. Gene 237, 361–371 (1999).
Ortori, C. A. et al. Simultaneous quantitative profiling of N-acyl-L-homoserine lactone and 2-alkyl-4(1H)-quinolone families of quorum-sensing signaling molecules using LC-MS/MS. Anal. Bioanal. Chem. 399, 839–850 (2011).
Niu, C., Afre, S. & Gilbert, E. S. Subinhibitory concentrations of cinnamaldehyde interfere with quorum sensing. Lett. Appl. Microbiol. 43, 489–494 (2006).
Chung, J. et al. Small-molecule inhibitor binding to an N-acyl-homoserine lactone synthase. Proc. Natl. Acad. Sci. USA 108, 12089–12094 (2011).
Swift, S. et al. Quorum sensing in Aeromonas hydrophila and Aeromonas salmonicida: identification of the LuxRI homologs AhyRI and AsaRI and their cognate N-acylhomoserine lactone signal molecules. J. Bacteriol. 179, 5271–5281 (1997).
Winson, M. K. et al. Construction and analysis of luxCDABE-based plasmid sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS Microbiol. Lett. 163, 185–192 (1998).
McClean, K. H. et al. Quorum sensing and Chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143, 3703–3711 (1997).
Guzman, L. M., Belin, D., Carson, M. J. & Beckwith, J. Tight regulation, modulation and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130 (1995).
Chang, C.-Y. et al. Unusual long-chain N-acyl homoserine lactone production by and presence of quorum quenching activity in bacterial isolates from diseased Tilapia fish. PLoS ONE 7, e44034 (2012).
Krishnan, T., Yin, W. F. & Chan, K. G. Inhibition of quorum sensing-controlled virulence factor production in Pseudomonasaeruginosa PAO1 by Ayurveda spice clove (Syzygium aromaticum) bud extract. Sensors 12, 4016–4030 (2012).
Chong, Y. M. et al. Malabaricone C from Myristica cinnamomea exhibits anti-quorum sensing activity. J. Nat. Prod. 74, 2261–2264 (2011).
Jones, G., Willett, P., Glen, R. C. & Leach, A. R. Development and validation of a genetic algorithm for flexible docking. J. Mol. Biol. 267, 727–748 (1997).
Case, D. A. et al. Amber 12. San Francisco, CA, University of California (2012).
Acknowledgements
This work was supported by the University of Malaya High Impact Research (HIR) Grant (UM-MOHE HIR Grant UM.C/625/1/HIR/MOHE/CHAN/14/1, no. H-50001-A000027) given to K.G.C. and National Natural Science Foundation of China (no. 81260481) given to H.W. which are gratefully acknowledged.
Author information
Authors and Affiliations
Contributions
C.Y.C. and Y.C. performed the molecular work. T.K., W.F.Y., Y.M.C., L.Y.T. and T.M.C. screened for anti-QS molecules and performed LCMS analysis. H.W. performed the molecular docking analysis. C.Y.C., W.F.Y. and K.G.C. developed the study strategy. C.Y.C., T.K., H.W. and K.G.C. contributed to the writing of the manuscript.
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Electronic supplementary material
Supplementary Information
Dataset 1, Dataset 2, Dataset 3, Dataset 4
Rights and permissions
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder in order to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/4.0/
About this article
Cite this article
Chang, CY., Krishnan, T., Wang, H. et al. Non-antibiotic quorum sensing inhibitors acting against N-acyl homoserine lactone synthase as druggable target. Sci Rep 4, 7245 (2014). https://doi.org/10.1038/srep07245
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/srep07245
This article is cited by
-
Ketoprofen attenuates Las/Rhl quorum-sensing (QS) systems of Pseudomonas aeruginosa: molecular and docking studies
Molecular Biology Reports (2024)
-
In vitro and in silico assessment of anti-quorum sensing activity of Naproxen against Pseudomonas aeruginosa
World Journal of Microbiology and Biotechnology (2023)
-
Effect of samarium oxide nanoparticles on virulence factors and motility of multi-drug resistant Pseudomonas aeruginosa
World Journal of Microbiology and Biotechnology (2022)
-
N-acyl homoserine lactone molecules assisted quorum sensing: effects consequences and monitoring of bacteria talking in real life
Archives of Microbiology (2021)
-
Natural quorum sensing inhibitors effectively downregulate gene expression of Pseudomonas aeruginosa virulence factors
Applied Microbiology and Biotechnology (2019)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.