RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 8th Conference on the Conservation of Animal Genetic Resources SUSTAINABLE CONSERVATION OF LIVESTOCK BREEDS DIVERSITY FOR THE FUTURE: IMPACT OF GLOBALISATION OF ANIMAL BREEDING AND THE LOSS OF FARM ANIMAL GENETIC DIVERSITY - A CONFLICT? NAMIK KEMAL UNIVERSITY FACULTY OF AGRICULTURE DEPARTMENT OF ANIMAL SCIENCE 4‐8 OCTOBER 2011 Dünya Hayvan Genetik Kaynakları (RBI) 8. Küresel Hayvan Genetic Kaynakları Koruma Konferansı Tekirdağ, (4 ‐ 8 Ekim 2011) 8. DÜNYA HAYVAN GENETİK KAYNAKLARI KORUMA KONFERANSI GELECEĞİMİZ İÇİN ÇİFTLİK HAYVAN IRK ÇEŞİTLİLİĞİNİN SÜRDÜRÜLEBİLİR KORUNMASI: HAYVANCILIK ENDÜSTRİSİNDE KÜRESELLEŞMENİN ÇİFTLİK HAYVAN IRK ÇEŞİTLİLİĞİ KAYBINA ETKİSİ – BİR ÇELİŞKİ Mİ? NAMIK KEMAL ÜNİVERSİTESİ ZIRAAT FAKÜLTESİ ZOOTEKNİ BÖLÜMÜ 4‐8 Ekim 2011 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) III CONFERENCE STANDING COMMITTEE MEMBERS Honorary President of the 8th RBI Global Conference Prof. Dr. Osman ŞİMŞEK Scientific Committee of the 8th RBI Global Conference Chairman Prof. Dr. M. İhsan SOYSAL Co‐chairman: Assoc. Prof. Dr. Masum BURAK Oya AKIN Members: Prof. Dr. Andreas GEORGOUDIS Rector of Namık Kemal University Department of Animal Science, Faculty of Agriculture Namık Kemal University General Director of Agricultural Research Ministry of Agriculture and Rural Affairs National Coordinator of Animal Genetic Resources of Turkiye General Directorate of Agricultural Research Ministry of Agriculture and Rural Affairs Ex Chairman of Rare Breeds International Prof. Dr. Ricardo CARDELLINO Ex senior Officer of Farm Animal Genetic Resources Animal Production and Animal Health section FAO Prof. Dr. Salah GELAL Director of Rare Breeds International, Cairo University Prof. Dr. Yusuf VANLI Department of Animal Science, Faculty of Agriculture Namık Kemal University, Tekirdag Prof. Dr. Muhittin ÖZDER Department of Animal Science, Faculty of Agriculture Namık Kemal University, Tekirdag Prof. Dr. İnci TOGAN Department of Biology, Middle East Technical University, Ankara Prof. Dr. Gürsel DELLAL Department of Animal Science, Faculty of Agriculture Ankara University, Ankara Prof. Dr. Cengiz ELMACI Department of Animal Science, Faculty of Agriculture Uludağ University, Bursa Prof. Dr. Okan ERTUĞRUL Department of Genetic, Faculty of Veterinary Medicine Ankara University; Ankara Prof. Dr. Zafer ULUTAŞ Department of Animal Science, Faculty of Agriculture Gazi Osman Pasa University, Tokat Prof. Dr. Naci TUZEMEN Department of Animal Science, Faculty of Agriculture, Ataturk University, Erzurum Assoc. Prof. Dr. Cemal ÜN Department of Biology Faculty of Science Ege University, İzmir Assoc. Prof. Dr. Sezen ARAT The Institute of Genetic Engineering and Biotechnology , TUBITAK‐MAM; Gebze IV RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Executive Committee of the 8th RBI Global Conference Chairman Prof. Dr. M. İhsan SOYSAL Vice‐Rector of Namık Kemal University Co‐chairman Prof. Dr. Burhan ARSLAN Vice‐Rector of Namık Kemal University Members Mesut Kabaağaç Head of the Office of Health, Culture and Sports Namık Kemal University Assist. Prof. Dr. E. Kemal GÜRCAN Department of Animal Science, Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. Emel ÖZKAN Department of Animal Science, Faculty of Agriculture Namık Kemal University Instructor Duygu DOĞAN Head of the Office of International Relations Namık Kemal University RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Organizing Committee of the 8th RBI Global Conference Chairman Prof. Dr. M. İhsan SOYSAL Department of Animal Science Faculty of Agriculture Namık Kemal University Co‐chairman Prof. Dr. Muhittin ÖZDER Department of Animal Science Faculty of Agriculture Namık Kemal University Members Prof. Dr. Yusuf VANLI Department of Animal Science, Faculty of Agriculture Namık Kemal University, Tekirdag Assoc. Prof. Dr. H. Ersin ŞAMLI Department of Animal Science Faculty of Agriculture Namık Kemal University Assoc. Prof. Dr. Alper ÖNENÇ Department of Animal Science Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. Cemal POLAT Department of Animal Science Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. Y. Tuncay TUNA Department of Animal Science Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. Hasan AKYÜREK Department of Animal Science Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. Ertan KÖYCÜ Department of Animal Science Faculty of Agriculture Namık Kemal University Assist. Prof. Dr. E.Kemal GÜRCAN Department of Animal Science Faculty of Agriculture Namık Kemal University Assist..Prof. Dr. Emel ÖZKAN Department of Animal Science Faculty of Agriculture Namık Kemal University Res. Assist.Dr. Sibel Soycan ÖNENÇ Department of Animal Science Faculty of Agriculture Namık Kemal University Res. Assist.Dr. Aylin Ağma OKUR Department of Animal Science Faculty of Agriculture Namık Kemal University Dr. Bekir ANKARALI General Directorate of Agricultural Research Ministry of Agriculture and Rural Affairs Dr. Melik AYTAÇ General Directorate of Agricultural Research Ministry of Agriculture and Rural Affairs Res. Asist. Dr. Ahmet Refik ÖNAL Department of Animal Science Faculty of Agriculture Namık Kemal University Res.Assist.. Serdar GENÇ Department of Animal Science Faculty of Agriculture Namık Kemal University Lect. Emre TAHTABİÇEN Feed Technology and Animal Nutrition Vocational School of Tekirdağ Namık Kemal University Lect. Kayahan YILMAZ Animal Breeding an Husbandry Vocational School of Malkara Namık Kemal University Secretary of the Organising Committee: Assist. Prof.Dr.Emel ÖZKAN Contact Person for the Secretaria: Res.Assist. Serdar GENC Department of Animal Science Faculty of Agriculture Namık Kemal University Department of Animal Science Faculty of Agriculture Namık Kemal University V ÖNSÖZ Tarımı yapılan bitkilerin ve hayvanların sürdürülebilir içerikte genetik çeşitliliğini korumak, uluslararası ölçekte ele alınan ve bütün dünya ülkelerinin paydaş olduğu bir kavramdır. Genetik kaynaklar yüzyıllardır tarımını yapageldiğimiz bitkilerin ve hayvanların ebeveynleri olarak tanımlanabilir. Yeryüzünde tarımın başlangıcından beri ilk çiftçiler ve dolayısıyla araştırıcılar üretimi arttırmak için araç olarak en iyi ebeveynleri seçip bunları melezleyip en iyi dölleri seçerek bir ıslah programı uygulamışlardır. Eğer bu işlemde kullanılan ebeveyn stokları yok olursa bu durum bitki ve hayvanlarda potansiyel ebeveyn soyları sayısının azalması anlamına gelir. Aynı şekilde tarımı yapılan bitkilerin ve hayvanların çeşitliliğinin kaybı gelecekte tarımı yapılabilirliğine bir tehdit oluşturacaktır. Tarımda genetik kaynakları korumak bir çeşit sigorta gibi var olan ya da oluşabilecek yeni hastalık ve zararlılara, çevresel koşullardaki olası tarım için oluşacak değişimlere karşı mücadele edilebilecek kaynakları sağlamak demektir. Araştırıcılar belli karakterde tarımı yapılan bitkilerin ve hayvanların ve onların yabani türlerini tuzluluk toleransı, hastalıklara direnç, iklim değişimlerine adaptasyon gibi çeşitli maksatlarla kullanmaktadır. Genetik kaynakları muhafaza etmek aynı zamanda üreticilere pazar koşullarındaki değişimlere adapte olması için de gereklidir. Tarımı yapılan bitki ve hayvanların özgün kalıtsal içeriği biyoçeşitliliğin ve ekosistemin bir parçası olup onların doğal habitatları içerisinde ya da dışında korunmasını gerektirmektedir. Genetik kaynakları korumak, iklim değişikliği, hastalıklara direnç gibi çevresel değişimlere uyum kadar, gıda güvenliği, gıda ürün kalitesini sağlamak için de önemlidir. Tarımı yapılan bitki ve hayvan çeşitlerinin sayısı, diğer bir deyimle genetik çeşitliliği giderek ciddi bir biçimde azalmaktadır. Bu durum üreticilerin çeşitliliği diğer kaygıları göz önüne almaksızın tek çeşide yönelmelerine yol açan çeşitli faktörlerin sonucu ortaya çıkmıştır. Bitki ve hayvan orjinli gıdalar çok az sayıda türden elde edilmektedir. Endüstriyel gelişmenin de bir sonucu olarak mega, süper ve hiper gibi adlarla ifade edilen tedarik merkezlerinde pazarlanan tüm ürünlerin çeşitliliği pazar devamlılığı, tüketici algı tercihi sonucu torna tezgahı ürünü gibi tek tip ürüne ve biçime odaklanmıştır. Geleneksel çeşitlilikteki bitki varyeteleri ve hayvan ırklarının terk edilmesinin yol açtığı yüksek düzeyde seyreden genetik erozyon gıda güvenliğini tehdit eder boyutlara ulaşmıştır. Genetik kaynaklar kamu malı niteliğinde olup bunları korumak topluma hizmet anlamına gelmektedir. Genetik kaynaklar kendi doğal ekosistemleri ya da doğal habitatları yerinde (in situ) korunabildiği gibi doğal habitatlarının dışında da (ex situ) korunabilir. Bu ikinci çeşit koruma başka yerde yetiştirmenin yanısıra gen bankalarında dondurarak koruma gibi hususları da içine alır. 1992 yılında imzalanan Birleşmiş Milletler Biyolojik Çeşitlilik Anlaşması (Convention of Biological Diversity=CBD) yeryüzündeki türlerin habitatların ve ekosistemlerin çeşitliliğinin sürdürülebilir korunmasını ve kullanımını öngörmektedir. Dünya ülkeleri Dünya Gıda Tarım Örgütü (FAO)’nün Gıda ve Tarım için Genetik Kaynaklar Komisyonu Üyesi olup bu konuda çeşitli çalışmalar yürütmektedirler. Ayrıca, gıda ve tarım için bitki genetik kaynaklarına ilişkin uluslararası anlaşmaya ek olarak biyoçeşitlilikle ilgili çeşitli uluslararası anlaşmalar (CITES, Bonn ve Berne Anlaşmaları) bazı türlerin, bölgelerin ekosistemlerin korunmasını öngörmektedir. Ülkemizin de üyesi olduğu uluslararası süreçlerle yürüttüğü çalışmalar doğrultusunda genetik kaynakları koruma olgusu, genetik çeşitliliğin azalmasını önlemek, tarımı yapılan bitki ve hayvan çeşit ve ırklarını karakterize etmek, toplamak, korumak ve ürünlerini kullanmayı amaçlamaktadır. Üniversitemiz Ziraat Fakültesi Zootekni Bölümü konuyla ilgili çeşitli ulusal ve uluslararası toplantılara ev sahipliği yapmıştır. 10‐14 Mayıs 2004’de Tekirdağ’da 17 Güney Doğu Avrupa ülkesi katılımı ile FAO ve Zootekni bölümünce koruma çalışmalarında milli kapasite artırımı, koruma çalışmalarının yönetimi, hayvan genetik kaynaklarının sürdürülebilir kullanımı konusunda öncelikler konulu çalıştaylar düzenlemiştir. 16 Eylül 2006’da Antalya’da Avrupa, Orta Asya, Uzak Doğu ve Orta Doğudan 17 ülkeden 50 katılımcı ile 57. Avrupa Zootekni Kurumu Yıllık Toplantısı süresi boyunca uydu toplantı olarak Avrupa Bölgesel Odak Noktası toplantılarına da ev sahipliği yapmıştır. VIII RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Şimdi de bölümümüz ve hayvan genetik çeşitliliği alanında tek sivil toplum kuruluşu olan (NGO) Uluslararası Nadir Irklar Kurumu (Rarebreed International), Tarım Bakanlığı Tarımsal Araştırmalar Genel Müdürlüğü (TAGEM) ile birlikte Uluslararası 8. Dünya Hayvan Genetik Kaynakları Koruma Konferansı düzenlemektedir. Bu konferansta 38 ülkeden 34 sunulu bildiri 44 poster bildiri olmak üzere toplam 78 eser sunulmuştur. Bildirilerin 34’ü yurt dışından 44’ü ise içindendir. Konferansa Başbakanlık Türk İşbirliği ve Kalkınma İdaresi Başkanlığı’nın (TİKA) desteği ile dünyanın 20 ülkesinden 45 katılımcının katılımı temin edilmiştir. Konferans kapsamında ayrıca 1‐4 Ekim tarihleri arasında Dr. Rapheal Mrode yönetiminde "Hayvan Populasyonlarında Bireyler Arasındaki Genetik İlişkiler ve Damızlık Değer Tahmin Yöntemleri” konulu bir çalıştay düzenlenmiştir. Ülkemizden 50 katılımcının yer aldığı konferansın bu konuda önemli bir katkı sağlayacağı değerlendirilmektedir. Konferans süresince Avrupa Bölgesel Odak Noktası’nca yürütülen yüksek yok olma riskindeki ırklar için ne miktar destek gerekir “subsibbreed” (how much support need the breeds in high risk status) gibi çeşitli projelere ilişkin toplantılar da yapılacaktır. Buluşmada ayrıca Avrupa Bölgesel Odak Noktası = European Regional Focal Point ERFP’de koruma (dondurarak koruma, crioconservation ex situ conservation), belgeleme ve bilgilendirme (documentation and information) konulu çalışma gruplarına kendi aralarında toplantı yapma fırsatı sunulmuş olacaktır. Toplantıda ERFP fayda ve yarar paylaşımı (Access and benefit sharing) ile risk düzeyi ve göstergeleri (risk status and indicators) ile tarımsal çevre tedbirleri (agri environmental measures) konulu görev kuvvetleri (task forces) isimli proje paydaşlarının da görüş alış verişinde bulunabileceği bir ortam oluşacağı değerlendirilmektedir. 8. Dünya Hayvan Genetik Kaynakları Koruma Konferansı’nda geleceğimiz için çiftlik hayvan ırk çeşitliğinin sürdürülebilir korunması, hayvancılığın endüstrileşmesinin ve küreselleşmenin çiftlik hayvan ırk çeşitliliği kaybına etkisi konularında bildiriler sunulacaktır. Namık Kemal Üniversitesi; Tarım Bakanlığı Tarımsal Araştırmalar Genel Müdürlüğü (TAGEM) ve Dünya Hayvan Genetik Kaynakları kurumunca (Rare Breed International) düzenlenen "Dünya Çiftlik Hayvan Genetik Çeşitliliği Koruma Konferansı”nda; daha önceki RBI konferanslarında olduğu gibi Hayvan genetik kaynakları üretimi, hayvan genetik kaynaklarının korunması sürecine paydaş bilim insanlarının uygulamacıların, kamu birimleri, sivil toplum kuruluşlarının bir araya getirilmesi; ortak amaç olan küresel düzeyde çiftlik hayvan genetik kaynakları koruma konusunda konferans çıktısı olarak bildirgeler kitabı ile hayvan genetik kaynaklarının durumu, karekterizasyonu konusunda kaynak eser oluşturulması amaçlanmıştır. Bu konferansın, evcilleştirme merkezi ve üç kıta kavşağındaki eşsiz coğrafi konumu, dünya çiftlik hayvan genetik kaynakları gelişim sürecindeki gen akış yolları üzerindeki özel konumu ve zengin çiftlik hayvan genetik kaynaklarına sahip ülkemizde yapılması etkinlik bakımından özel önem taşımaktadır. Konferans küresel düzeyde çiftlik hayvan genetik kaynakları üreticilerini, araştırıcılarını, uygulayıcılarını, kamu birimlerini multidisipliner niteliği ile birçok dala mensup bilim insanlarını biraraya getirip dünya çiftlik hayvan genetik kaynakları konusunda bir küresel eylem planı nihai raporu oluşturma olgusuna katkı koymayı da amaçlamaktadır. FAO, Birleşmiş Milletler Gıda ve Tarım Örgütü (FAO) 1992 yılında dünya Biyoçeşitlilik Anlaşması ile başlayan bir süreçte Dünya Gıda ve Tarım İçin Çiftlik Hayvan Genetik Kaynaklarının Durumu (State of World Animal Genetic Resources for Food and Agriculture; SoW) isimli kıta, bölge ülke alt birimleri içeriğinde Mevcut durumu tespit edici bir belge hazırlama çalışmalarının yanısıra bu konuda küresel eylem planı oluşturma çalışmalarını yürütmektedir. Bu süreçlerin hepsinde bölgesel ve küresel bilgi ve deneyimlerin paylaşılması bakımından işbirliğinin önemi ve gereği vurgulanmaktadır. Özellikle yerli çiftlik hayvan genetik kaynaklarının sürdürülebilir korunmasının bunların üretimine katma değer katan çalışmalardan geçtiği bu sürece ilişkin uluslararası ticaretin yetiştirici haklarını koruyan bölgesel ve küresel ticareti sağlayan pazar koşullarını kolaylaştırıcı içerikte olmasının gerektiği bilinmektedir. Bu konferans ile konuyla ilgili bütün yönlerin ele alınmasını temin edecek bir ortamın sağlanması amaçlanmıştır. RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) IX Bu konferansta tema olarak “Geleceğimiz için çiftlik hayvan ırk çeşitliliğimizin sürdürülebilir korunması; hayvancılık endüstrisinde küreselleşmenin çiftlik hayvan genetik çeşitlilik kaybına etkisi bir çelişki mi?” seçilmiştir. Bu Konferanslar serisi, ilki 1989’da İngiltere’de başlayan ve her üç yılda bir hayvan genetik kaynakları bakımından zengin bir kıtayı yansıtacak içerikte seçilen bir ülke olmak üzere 1991’de Macaristan, 1994’de Kanada, 1997’de Nepal, 2000’de Brazil, 2005’de Güney Afrika ve 2008 yılında Vietnam’da düzenlenmiştir. Tekirdağ’da düzenlediğimiz 8. konferansın amacı, hayvan genetik kaynakları koruma çalışmalarını güçlendirmek, yerli hayvan genetik kaynaklarının bulundukları çoğu zaman marjinal alanlardaki üstün adaptasyon kabiliyetlerini dikkate almadan küresel ısınma gibi süreçlerde verim niteliğini sürdürme üstünlüğü ile varlığı daha da önem kazanacağı halde bilinçsiz bir arayışla yüksek verimli başka ırklarla melezlemek ya da dış alım yaparak başka ırklarla değiştirmekden kaynaklanan ırk yokoluş sürecini durdurmak, bunların tarımsal üretimde sürdürülebilir kullanımını tekrar sağlamak konusunda farkındalık yaratmaktır. Konferans düzenleyicileri olarak bu konferansta çiftlik hayvan genetik kaynakları koruma sürecinde hayvansal üretim, ürün değerlendirme, ırkların verim karakteristikleri, genetik morfolojik karakterizasyon, ırk korunma düzeylerinin izlenmesi, moleküler genetik karakterizasyon koruma stratejileri, yerli çiftlik hayvan ırklarının korunması üretimi ile ilgili her alanda çiflik hayvanı genetik kaynaklarının sürdürülebilir kullanımı çalışmalarını beraber incelemek, bilgi ve deneyimlerimiz, paylaşmak, konu paydaşları ile bir araya gelmek, yeni arkadaşlıklar dostluklar geliştirmek sürecinin önemli olduğunu değerlendirmekteyiz. Konferans, hayvan genetik kaynakları, hayvansal üretim konusunda dünya ülkerinden kamu birimleri, üniversiteler, araştırma kuruluşları, araştırıcılar, üreticiler, öğrenciler, ürün işleyiciler, üretim birlikleri, yetiştirme birlikleri gibi konu ile ilgili her paydaşın katılımını sağlayacak şekilde düzenlenmiştir. 8. Dünya Evcil Çiftlik Hayvan Genetik Kaynakları Konferansı, hayvansal üretimde endüstrileşmenin genetik çeşitliliğe etkisini, geleceğimiz için önemli bir gelişme aracı olarak çiftlik hayvan ırk çeşitliliğinin sürdürülebilir korunması süreci ile ilgili tüm hususların, bilgilerin, fikirlerin karşılıklı etkileşim, bilgi alışverişi ortamında inceleneceği bir ortam oluşturmayı amaçlamaktadır. Bu konferans bize gıda kaynağı olarak elzem, küresel ısınma sürecinde daha etkin üretim potansiyeli nedeniyle gelecekte daha da önem kazanacak yerli çiftlik hayvan ırklarımızın korunması konusundaki fikir, bilgi, çözüm önerilerinin ele alındığı bir içerik de düzenlenmiştir. Hayvansal Üretimin endüstrileşme süreci ile dünyanın neredeyse her yerinde aynı ırkın aynı kalıtsal içeriğin yerleştirilmesi eğiliminin olası genetik etkilerinin incelenip marjinal alanlarda dünyanın farklı ekolojik sistemlerine binlerce yılda adaptasyon süreci sonunda oluşmuş eşsiz genetik materyalin heba edilmesinin önüne geçme olgusuna dair tedbirlerin alınması konferansta ele alınacak konuları oluşturmuştur. Bir temenni ifadesi olarak, ünlü Türk ozanı Dede Korkut’un söylediği “Karlı kara dağların yıkılmasın, Gölgelice kaba ağaçların kesilmesin, Taşkın akan suların kurumasın, Kanatlarının ucu kırılmasın” sözleri hepimizin ortak hedefidir. Diğer yandan Amerikan Duwarmish Kızılderililerinin bilge Reisi Seattle’in 1853’te bugünün gerçeklerine ışık tutan mektubundaki ifadesiyle “Genetik kaynaklarımız ve onların ekosistemleri bilinçsiz kullanımla alınıp satılarak yağmalanacak bir meta değildir. Bu konudaki sürdürülebilir olmayan kullanımın yol açtığı ihtiras toprakları, ekosistemi çölleştirip her şeyi yiyip bitirebilir. Kurduğumuz kentlerin huzur ve barış içinde olması bu kentlerde çiçeğin taç yapraklarının açarken çıkardığı tatlı sesleri kelebeğin kanat çırpışlarını duyulur kılmalıyız. Bu işlemi son ırmak kurumadan son ağaç yok olmadan son balık ölmeden sağlamak zorundayız.” Sonuç olarak bu dünya hepimizin. Gelin el ele verelim, sorunların üstesinden gelelim. Ünlü Türk Şairi Yunus Emre’nin (1238‐1320) dediği gibi; Gelin tanış olalım, İşi kolay tutalım, Sevelim sevilelim, Dünya kimseye kalmaz. Prof. Dr. M. İhsan SOYSAL Organizasyon Komitesi adına INTRODUCTION To provide genetic diversity of farm animals and crops agricultured in sustainable context is a notion which is discussed in international scale and all countries have common sense about it. Genetic resources might be defined as the ancestors of crops and animals which we have agricultured for centuries. From the beginning of the agriculture on earth, first farmers and accordingly the researchers have applied a breeding system choosing the best progeny which was interbreeded after choosing the best parents as vessels to enhance production. If the parent supplies used in this procedure becomes extinct, this means that the number of potential parent breeds will descend. Similarly, the loss of diversity of the farm animal breeds and crops which are agricultured will result a threat to the practicability of agriculture. Conserving the genetic resources in agriculture is like an insurance that will fight against the existing or possible new sicknesses and pests, probable changes in the environmental conditions of agriculture. Researchers use crop, animal and their wild species which are agricultured in certain characteristics with different purposes such as salinity tolerance, resistance against sicknesses, and adaptation to the environmental changes. Conserving the genetic resources is also necessary for breeders to adapt to the changes in the market. Unique inborn content of the crops and animals cultivated is a part of biodiversity and ecosystem; it requires their protection in and out of their natural habitat. Conserving genetic resources is important for food safety and ensuring food product quality as well as adapting environmental changes such as climate changes and resistance against sicknesses. The number of the species of crops and animals which are agricultured –genetic diversity‐ has descended day by day. This situation resulted after the breeders’ heading for single type, not concerning the diversity. The food originated from the crop and animal is obtained from very limited species and breeds. The variety of all goods being marketed in supply centers which is named as mega, super and hyper as a result of industrial development has focused on single type good and shape after market sustainability, the choice of consumer perception. Genetic erosion, steering on high grounds resulted from crop varieties in general variety and abandoning animal species, has reached to a level threatening the food safety. Genetic resources are public properties and conserving those means serving the public. Farm animal genetic resources can be both conserved within their own natural ecosystems or natural habitats (in situ) and out of their natural habitats (ex situ). This second kind of conserving consists not only rasing somewhere else, but also conserving by freezing crioconservation in gen banks. United Nations Convention of Biological Diversity 4N; CBD, 1992 anticipates the sustainable protection and usage of species, habitats and ecosystems on earth. World countries are members of a commission of Genetic Resources for Food and Agriculture within Food and Agriculture Organization (FAO). In addition to international treaty of genetic resources for Food and Agriculture, various international treaties about biolithite (CITES, Bonn and Berne treaties) anticipates the conserving of some species, regions and ecosystems. In the direction of international processes which our country is a member of, it’s aimed to prevent the reduction of genetic diversity, characterize the crop – animal species and breeds, gather them, protect and use their products. Tekirdağ Department of Animal Science, Faculty of Agriculture, has hosted so far several national and international meetings on the topic. Between 10‐14 May 2004, in Tekirdağ, with the participation of 17 South East European countries Food and Agriculture Organization and our Department of Animal Science organized workshops about the priorities in increasing national capacity in conservation works, management of conservation works, sustainable usage of farm animal genetic resources. On 16 September 2006, in Antalya, 50 participants from 17 countries of XII RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Europe, Central Asia, Far East and Middle East with the Institution of European Association of Animal Production (EAAP) also hosted the satellite work shop of European Regional Focal Point meetings (ERFP) as well as its Annual Meeting. Now, the only NGO in the field of far animal genetic diversity Rare Breed International (RBI) and our department, with General Directorate of Agricultural Research of ministry of Agriculture is holding 8th Global Meeting on the Conservation of Animal Genetic Resources. In this conference, 34 oral presentation and 44 poster presentation, 78 total, were presented from 38 different countries. 34 of the reports were from abroad, but 44 were within our country. With the support of Turkish International Cooperation and Development Agency, the participation of 45 participants from 20 different countries of the world was insured. Also between 1‐ 4 October under Dr. Raphael Mrode’s management a workshop named “The Genetic Relationship Among Animals and the Prediction of Animal Breeding Values” was held within this conference. It was estimated that the conference which 50 participants from our country were in would contribute a lot about this issue. Throughout the conference, meetings about projects like “subsibbreed” carried out by European Regional Focal Point (ERFP) will be held. In the meeting, intragroup ERFP meetings will be organized by work groups of ex‐situ conservation, cryoconservation, ex‐situ conservation, documentation and information. It is also considered that there will be a atmosphere where all project stakeholders ‐also called task forces‐ can share opinion about access and benefit sharing, risk status and indicators and agrienvironmental measures. In 8th Global Conferance on the Conservation of Animal Genetic Resources, reports on protecting animal species breeds for our future, effects of industrialization and globalization of breeding on the loss of animal species. In the “Conference on Conserving the Genetic Diversity of Livestock around the World” held by Namık Kemal University; General Directorate of Agricultural Research and Rare Breed International, as in the RBI conferences, it was aimed to get the production of animal genetic resources, scientists who are partners in the process of conversing animal genetic resources, pragmatists, public institutions, non‐governmental organizations together; to use the manifesto after the conference as a reference book for the case and characterization of animal genetic resources. It is a privilege that this conference is held in our country, which is a domestication center, which has a unique geographical position and unique position on the genetic flow line of rich livestock genetic resources, and which has Rich Livestock Genetic resources. It aims to gather the breeders of livestock genetic resources around the world, researchers, breeders, public institutions, scientists who have multidisciplinary qualifications; and to form a final report of a global action plan about world livestock genetic resources. FAO, the United Nations Food and Agriculture Organization (FAO) since 1992, starting with the World Convention of Biological Diversity, has carried out firstly the studies of preparing a determining document of farm animal genetic resources for food and agriculture in the world status of the continental, regional sub‐units of the country and then making a global action plan for carrying out activities in this regard. In all of these processes the importance and need of cooperation of sharing regional and global information and experiences are stressed. Especially it is known that the process, in which the sustainable conservation of autochtonous farm animal genetic resources pass through as a result value‐added work arises, should make easy the market conditions which protect the rights of international trade and enables the regional and global trade. With this conference it is intended to ensure to provide an environment in which all aspects related to the subject are discussed. In Tekirdag conference the theme "For our future, the sustainable conservation of farm animals breeds diversity, the impact of globalization in the livestock industry on the loss of farm animal genetic diversity; is this a dilemma?" is selected. This series of conferences organized by RBI, the first of which started in Great Britain in 1989 to reflect a particular continent rich in Animal Genetic Resources every three years; were held in RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) XIII Hungary in 1991, in 1994 in Canada, in 1997 in Nepal, 2000 in Brazil, in 2005 in South Africa, in 2008 in Vietnam. The purpose of the eighth conference we organize in Tekirdag is to strengthen the studies of conservation of animal genetic resources, crossbreed although its superiority of maintaining the yield quality with the existence in such processes as global warming will gain more importance without taking into consideration the superior adaptation qualities of the National Genetic Animal resources which are mostly in marginal fields with high yielded other races with an unconscious search or stop the breed extinction process stemming from the altering with other breeds by importing, to raise awareness about re‐providing the maintaining usage of all these in Agricultural production. As the conference organizers, we think that it is important to develop new fellowships and to share our experiences about animal production, product evaluations, performance characteristics of farm animal breeds, morphological characterization of genetics, racial monitoring of levels of protection, the protection strategies for the molecular genetic characterization and the protection of indigenous farm animal breeds in all areas related to the production work of the sustainable use of farm animal genetic resources. The conference is organized as to let every unit from all over the world take part in the conference about farm animal genetic resources and animal production such as universities, research institutes, researchers, producers, students, product handlers, production associations of breeding associations. The Eighth Global conference farm animal on genetic resources aims at discussing all ideas about the process of sustainable protection of the diversity of farm animal breeds for our future and the effects of industrialization over the genetic diversity on the production of animals. We arranged another content in the conference in which we'll be discussing ideas, information, solution proposals about the conservation of autochtonous farm animal breeds which will gain importance in the future as a vital food source due to more efficient production processes during the global warming period. We will also be examining possible genetic effects of the industrialization process on the same race with the same genetic content which are placed almost anywhere in the world and discussing about possible measures to be taken in order to prevent the destruction of the unique genetic material which has formed in thousands of years everywhere in the world at the end of the adaptation process at different ecological systems. Dede Korkut, the famous Turkish poet’s wish dated to the 5th century of "I wish your snowy mountians do not collapse, your shady trees are not cut, your running water never dries out and tip of your wings are never broken. (Karlı kara dağların yıkılmasın, Gölgelice kaba ağaçların kesilmesin, Taşkın akan suların kurumasın, Kanatların ucu kırılmasın)" is the common goal of all of us. Similarly, as the chief of American Duwarmish Indians, Seattle, inspired us in 1853 in his letter, “Our genetic sources and their ecosystem is not a merchandise to be plundered by buying and selling with the unconscious use, the greed soils caused by the unsustainable usage can desert the ecosystem and eat up everything. To provide peace and security in the cities that we have established, we make the sound of lovely flower petals blooming and butterfly wings heard, we have to ensure this before the last river dries, the last tree disappears and the last fish dies.” As the last word, this world is all of ours. Let’s join our hands all together and overcome all problems. As the famous Turkish poet Yunus Emre (1238‐1320) had said: “Come let us all be friends for one, Let us make life easy on us, Let us love and be loved, The world shall be left to no one. (Gelin tanış olalım, işin kolayın tutalım, Sevelim sevilelim, dünya kimseye kalmaz,)”. Prof. Dr. M. İhsan SOYSAL On behalf of Organizing Commity of Conferance INTRODUCTION DRAFT Turkey contains the ancient region of Anatolia which holds a very special place in the early domestication of farm livestock. Some of the earliest remains of domesticated animals were found at the Neolithic sites of Çatalhöyük (Çatal Hüyük) and Haçilar in southern Anatolia dating from circa 7,500 BC. Therefore, the application from Namik Kemal University to host the 8th Global Conference was welcomed by Rare Breeds International (RBI), and accepted as a valuable part of the twentieth anniversary celebrations of its formal recognition in 1991 when it was launched as the global umbrella organisation for conserving animal genetic resources (AnGR). Turkey provides a momentous setting for this important event. The series of RBI global conferences, which have been held previously in Britain (1989), Hungary (1991), Canada (1994), Nepal (1998), Brazil (2000), South Africa (2005) and Vietnam (2008), present excellent opportunities for renewing and developing cooperation in pursuit of the conservation of native AnGR. The presence of international organisations such as FAO and RBI, and the active participation of ERFP through satellite meetings, highlights the value of interaction between the disparate stakeholders in this field of activity. We are grateful to Namik Kemal University for providing the opportunity for livestock breeders and keepers to mix with scientists and academia, and particularly for the further development of relationships between governmental agencies and NGOs. The successful conservation of native AnGR is achieved primarily by these relationships. At the international level FAO is the global governmental body concerned with the creation of policy and the development of structures which guide the application of policy. RBI is the global NGO counterpart which works to facilitate delivery of programmes by its members to support and promote native AnGR. The 8th RBI Global Conference provides a valuable platform to examine and develop the opportunities for ongoing and expanding cooperation within the context of new technologies and progressive science. Reports of both breed survival and the ability of some endangered breeds to compete in the marketplace provide evidence of the efficacy of these policies and programmes. Each conference has its own distinctive flavour which is expressed in disparate ways. It brings together delegates from different parts of the world and from a wide range of cultural backgrounds. It is a rich and fertile mix of philosophical and technical discussion that encourages and enables original thought and productive outcomes. Each global conference also has its own theme and the 8th most appropriately combines sustainability and diversity, but it focuses more specifically on the impact of globalisation and its potential to erode genetic diversity within AnGR. It is a conflict which deserves acute and perceptive attention. Genetic erosion and breed extinction continues despite ongoing governmental and NGO efforts, and work must be intensified to protect endangered native breeds. At a more local level the conference provides the host country with a window to display its native breeds and research programmes to an interested and discerning international audience. Turkey possesses several notable breeds. In some cases, such as the Angora goat, they have achieved international status. In other cases, particularly the native breeds of cattle such as the Anatolian Red or the Yerlikara (Anatolian Black), they have declined to endangered status despite their strong local adaptation and disease resistance. Fat‐tailed Karaman and Dağliç breeds dominate the sheep population, with the fat‐rumped Tuj in the extreme eastern border, and thin‐tailed Kivircik and Gökçeada breeds in western areas. Together these native breeds comprise a rich variety of genetic diversity, and they are being conserved actively. The active work in Turkey is described in papers which comprise a major portion of the conference programme, and which demonstrate a clear commitment to AnGR. The balance between national and international interest is achieved by papers XVI RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) from delegates from many countries in Europe and Asia, ranging from Norway in the north‐west to Nepal in the east, with the bonus of a contribution from South Africa. Publication of the Proceedings not only will be a permanent record to recognise the work and commitment of contributors, but also will enhance the reputation and credibility of those national, regional and international organisations that have demonstrated their involvement in the conference. It is important to place this record before a wider audience to maximise its effect and ensure that the pace of conservation of AnGR does not slacken. On behalf of RBI, I thank the Rector of Namik Kemal University and his colleagues for hosting this conference. I also thank the Organising and Scientific Committees under the guidance of Professor Ihsan Soysal for presenting a varied and valued programme and for their enthusiasm to advance programmes for the conservation of AnGR. I commend the Proceedings to all those with an interest in AnGR. Lawrence Alderson President RBI CONTENTS Oral Presentations The Global Plan Of Action For Animal Genetic Resources Irene Hoffmann ................................................................................................................................................... 01 Sustainable Conservation Of AnGR Through Cooperative Networks G.L.H.ALDERSON ................................................................................................................................................. 05 Animal Genetic Resources Conservation And Sustainable Utilization: Regional Experiences In Europe A. Oya AKIN ......................................................................................................................................................... 11 Population Genetics Of The Island Jersey Cattle Breed: Data, Management And Politics MW Bruford, GLH Alderson................................................................................................................................. 19 Farm Animal Genetic Diversity And Conservation In Turkiye Mehmet ERTUĞRUL, M. İhsan SOYSAL, A. Oya AKIN .......................................................................................... 23 Cryopreservation Strategies For Farm Animal Genetic Resources In Europe S.J. HIEMSTRA ..................................................................................................................................................... 29 Rare Native Dairy Cattle Breeds: Quo Vadis? E. MARTYNIUK, N. SAETHER, J. KRUPINSKI.......................................................................................................... 35 Molecular Characterization, Evaluation And Conservation Of Indigenous Goat Breeds Of Pakistan Masroor Ellahi Babar, Tanveer Hussain, Haleema Sadia, Misbah Shaheen, Asif Nadeem, Akhtar Ali, Abdul Wajid and Sajjad Ali Shah ................................................................................. 43 In Vitro Conservation And Preliminary Molecular Identification Of Some Turkish Domestic Animal Genetic Resourcesi (Turkhaygen‐I) Sezen ARAT.......................................................................................................................................................... 51 Sustainable Breeding, Farming And Utilisation Of Autochthonous Cattle, Sheep And Goat Breeds In Serbia V. BOGDANOVIC, P. PERISIC, R. DJEDOVIC, S. STOJANOVIC ................................................................................ 59 Honamli Goat: Rising Star Of The Taurus Mountains Bekir GÖK, Ahmet Hamdi AKTAŞ, Şükrü DURSUN ............................................................................................... 65 The Conservation And Utiliztion Of The Genetically Diverse, Native Icelandic Livestock Breeds, With Reference To Selfsufficiency And National Food Security Ó.R. DÝRMUNDSSON........................................................................................................................................... 73 The Present Studies On Animal Genetic Resources In Bandirma Sheep Research Station Mesut YILDIRIR, Tamer SEZENLER, İsmail ERDOĞAN, M. Akif YÜKSEL, Deniz SOYSAL ........................................ 79 Use Of Molecular Information For The Characterization And Conservation Of Farm Animal Genetic Resources: Results Of Large Scale International Projects And Perspectives Offered By New Technologies P. AJMONE‐MARSAN........................................................................................................................................... 85 Genetic Diversity Of Five Indigenous Goat Population Of Nepal N. A. Gorkhali, Han Jianlian, B.S. Shrestha.......................................................................................................... 95 Genetic Diversity Of Turkish Native Sheep In Conservation Studies İnci TOGAN, Sevgin DEMİRCİ, S. Can AÇAN, Evren KOBAN BAŞTANLAR, Hande ACAR, Eren YÜNCÜ, Cihan AYANOĞLU, Arif PARMAKSIZ............................................................................................. 101 Trends In Methods For Genetic Evaluations Of Farm Animals And The Control Of The Rates Inbreeding Raphael Mrode.................................................................................................................................................. 107 Milk Yield And Body Weight Of White Maritza Sheep D.P.Dimov.......................................................................................................................................................... 113 th XVIII RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Molecular Characterization Of Conserved Some Turkish Native Goat Breeds B. ÇINAR KUL, Ö. KORKMAZ AĞAOĞLU, B. AKYÜZ, E. ÖZKAN, Ö. GÜCÜYENER, Ö.ÖZMEN, M. AYTAÇ, O. ERTUĞRUL................................................................................................................. 121 PRP Gene Based Scrapie Susceptibility In Native Turkish Sheep: Do We Need To Introduce A Breeding Programme To Select For Resistance To Scrapie In Turkey? Emel OZKAN, M. İhsan SOYSAL, Begüm UZUN, Ebru GOKALP, İnci TOGAN ...................................................... 131 Reproductive Characterization Of Black Racka Rams I.EGERSZEGI, P. SARLOS, A. MOLNAR, S. CSEH, J. RATKY................................................................................... 137 Haplotype Variation Of Exon 4 Estrogen Receptor‐Α (Erα) Gene In Turkish Sheep Breeds O. Ozmena, I. Seker, B Cinar Kul, O. Ertugrul .................................................................................................... 143 Certain Carcass And Meat Quality Characteristics Of Anatolian Water Buffalos A. YILMAZ, B. EKİZ, M.İ. SOYSAL, İ. YILMAZ, H. YALÇINTAN .............................................................................. 149 The Relationships Between Milk Constituents And Various Milk Properties In Anatolian Buffaloes Ö.ŞEKERDEN, Y.K. AVŞAR .................................................................................................................................. 157 Determination Of Live Weight, Daily Weight Gains And Survival Rate Properties In Different Time Of Morkaraman Sheep Grown In Local Conditions S. KOPUZLU, E.SEZGİN, S.YÜKSEL, Ö. BİBEROĞLU, N. ESENBUĞA, A. ÖZLÜTÜRK, M. BAYRAM ........................ 163 From Milk Protein Polymorphisms To Breeding Practices In Turkey H.DINC, E. OZKAN, E. KOBAN, I. TOGAN............................................................................................................ 171 Some Of Common Features Of Eastern Anatolian Red Cattle, Its Local Position And Importance As Genetic Resources Sadrettin YÜKSEL, Erdoğan SEZGİN, Sinan KOPUZLU........................................................................................ 175 An Investigation On The Carcass Percentage Of Anatolian Grey Breed In Raised Edirne Province S. KÖK, M. İ. SOYSAL, E. K. GÜRCAN .................................................................................................................. 179 Autosomal And Mitochondrial Genetic Diversity Of Turkish Native Cattle Breeds E. KURAR, Y. OZSENSOY, M. DOGAN, Z. BULUT, V. ALTUNOK, A. ISIK, A. CAMLIDAG, M. NIZAMLIOGLU .......................................................................................................... 185 One Of The Native Animal Genetic Resources And Its Importance In Animal Husbandry: Zavot Cattle Sadrettin YÜKSEL, Erdoğan SEZGİN, Sinan KOPUZLU........................................................................................ 193 Determination Of Some Morphological Structure, Body Size And Growth Properties Of Hemşin Sheep Grown In Artvin E.SEZGİN, S. KOPUZLU, S. YÜKSEL, N. ESENBUĞA, Ö.C. BİLGİN......................................................................... 199 Restoration Of Polish Native Breeds Of Cold‐Blooded Horses: Challenges And Problems G.M.POLAK, J. KRUPINSKI.................................................................................................................................. 207 Local Breeds, Dispersion And Economic Roles In The Northeast Of Iran Zakizadeh, S, J. Bokaian, H.R. Monazami.......................................................................................................... 213 The Importance Of Fiber Production For Conservation Of Native Sheep And Goat Breeds And Silkworm Lines In Turkey G. DELLAL, Z. ERDOĞAN, E. PEHLİVAN, F. SÖYLEMEZOĞLU, A. YANAR............................................................. 217 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) XIX POSTER Association Of Insulin‐Like Factor Binding Protein 2 Gene With Body Composition Traits In Iranian Commercial Broiler Lines A. JAVANROUH ALIABAD, H.R. SEYEDABADI, B. TAHERI DEZFULI ..................................................................... 225 The Phenotypic And Genetic Correlations Between Milk And Reproductive Traits In Holstein Cattle A. Sahin, Z. Ulutas, E. Sirin, Y. Aksoy ................................................................................................................. 233 Estimates Of Phenotypic And Genetic Parameters For Milk Yield And Reproductive Traits Of Holstein Cattle In Turkey Using An Animal Model A. Sahin, Z. Ulutas, E. Sirin, Y. Aksoy ................................................................................................................. 239 Use Of Image Analysis For Indirect Estimates Of The Carcass Measurements Of Kivircik And Turkgeldi Sheep Breeds Ahmet Refik ÖNAL, Yahya Tuncay TUNA, Ertan KÖYCÜ, Muhittin ÖZDER ....................................................... 247 Body Measurements Of The Kalofer Long‐Haired Goat Breed In Bulgaria ATANAS VUCHKOV, DOYTCHO DIMOV, SIDER SEDEFCHEV............................................................................... 251 Environmental Effects On Productive And Reproductive Performance Of Khuzestani Buffaloes In Iran B. TAHERI DEZFULI, A. NEJATI JAVAREMI, M.A. ABBASI, J. FAYAZI, M. CHAMANI ............................................ 259 Investigation Of “Natural Resistance Associated Macrophage Protein 1 (Nramp1)” Gene Polymorphism In Native Cattle Breeds In Turkey B.EKİM, K.S.DİKER ............................................................................................................................................. 265 An Important Genotype For The Turkish Agro‐Biodiversity: Gökçeada Goat C.TÖLÜ, T. SAVAŞ .............................................................................................................................................. 267 The Current Status, Conservation Programme And Sustainable Utilization Of Turkish Grey Cattle Deniz SOYSAL..................................................................................................................................................... 275 Some General Properties And Regional Status Of Indigenous Tuj Sheep And Its Importance As A Gene Resource E. SEZGİN, S. KOPUZLU, S. YÜKSEL, A. SEZGİN................................................................................................... 281 Some General Features, Regional Status And Importance Of Kaçkar Goat Breed As A Gene Resource E. SEZGİN, S. KOPUZLU, S. YÜKSEL, E.E. ERMİŞ, Ayşe SEZGİN............................................................................ 287 Potential Ecological Impacts Of Commercially Produced Bombus Terrestris L. (Hymenoptera: Apidae) Colonies F. GUREL, B.A. KARSLI........................................................................................................................................ 291 The Conservation Of Genetic Resource Of Dağliç Sheep Breed In Breeder’s Conditions And A Study On Achieving Economic Sustainability By Commercial Crossbreeding: Konya Province Case T. CANATAN, M. KAN, N.K. AKBULUT, G. KELEŞ, Ş. DOĞAN, B.E.TEKE .............................................................. 297 Native Breed Gene Resources And Their Local Distribution In Kutahya Region Hayri DAYIOĞLU, M. Kasım ÇAYCI, Altuğ ATALAY, Cem TOKATLI...................................................................... 303 Conservation Studies Of Ankara Goat Halil EROL.......................................................................................................................................................... 311 Conservation Studies of Herik Sheep Halil EROL, H. İbrahim AKCADAG, Murat UNAL ................................................................................................ 313 Some Characteristics Of Gökçeada Sheep Breed In Bandirma Sheep Research Station İsmail ERDOĞAN, Mesut YILDIRIR, Tamer SEZENLER, M.Akif YÜKSEL............................................................... 315 On The Origin Of Wool Sheep Johannes A. Lenstra, James Kijas, Simon Boitard and Ben Hayes on behalf of the International Sheep Genomics Consortium ................................................................................. 319 XX RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Importance Of Caucasian Honeybee And Its Characteristics As A Gene Resource M. KARA, E. SEZGİN, A. KARA ............................................................................................................................ 321 Body Measurement And Some Production Traits Of Anatolian Water Buffalo Raised In Bandirma Sheep Research Station M.Akif YÜKSEL, Mustafa KÜÇÜKKEBAPÇI, Mesut YILDIRIR ............................................................................... 329 Effect Of Body Condition Score On Some Body Measurements, Milk Production And Milking Flow In Friesian Cows In Yemeni Cold Areas Mahfoudh .A. Al‐ Hard ...................................................................................................................................... 333 Body Measurement And Growth Characteristics Of Sakiz Sheep Raised In Bandirma Sheep Research Station Mesut YILDIRIR, İsmail ERDOĞAN, Tamer SEZENLER, M.Akif YÜKSEL............................................................... 341 Preimplantation Genetic Diagnosis (Pgd) Availability In Animal Genetic Resources Protection N. BİLGEN, B. ÇINAR KUL, O. ERTUĞRUL ........................................................................................................... 345 Daglic, The Hardy Sheep Of The Centralanatolianmountains Is Losing Its Altitude Necdet AKAY, Mehmet KÖSE, Ahmet Hamdi AKTAŞ, Seyit ÜMÜTLÜ ................................................................ 349 Conservation Of Denizli And Gerze Chicken Breeds Neval ÖZDOĞAN ............................................................................................................................................... 355 Conservation Of Native Çine Çapari Sheep Breed As Genetic Resource O. KARACA, O. YILMAZ, İ. CEMAL ...................................................................................................................... 357 Changes Of The Horse Breeding In The Last Century In Turkey Özlem GÜCÜYENER HACAN, Halil AKÇAPINAR.................................................................................................. 367 Genetic Polymorphism Of Β ‐ Casein (Β–Cn) In Iraqi Cow Milk Talib Ahmed Jaayid ........................................................................................................................................... 371 The Comparison Of Some Reproduction Traits And Lambs Growth Performance Of Ex‐Situ And In‐Situ Conserved Of Kivircik Sheep Tamer SEZENLER, Mesut YILDIRIR, Ayhan CEYHAN, İsmail ERDOĞAN.............................................................. 377 Conservation Of Aquatic Genetic Resources Yusuf Bozkurt .................................................................................................................................................... 385 Cryopreservation And Aquaculture Yusuf Bozkurt .................................................................................................................................................... 389 Polymorphism Of PIT1 Gene And Its Association With Growth And Body Composition Traits In Iranian Commercial Broiler Line Z. RODBARI, M. ALIPANAH, H.R. SEYEDABADI, C. AMIRINIA, B. TAHERI DEZFULI............................................. 393 Estimates Of (Co)Variance Components For Direct And Maternal Effects On Birth Weight Of Karayaka Lambs Z. Ulutas, E. Sirin, Y. Aksoy, A. Sahin ................................................................................................................. 399 Assessment Of Genetic Diversity In Local Sheep Breeds Of Albania And Kosovo By Microsatellite Markers A. HODA, B. BIJO, H. BYTYQI, G. HYKAJ ............................................................................................................. 407 Sustainable Sheep And Goat Production Based On The Local Breeds In Montenegro B. MARKOVIĆ, M. MARKOVIĆ, D. RADONJIĆ, M. VELJIĆ.................................................................................... 413 Mongolian Bactrian Camel And Some Issues In Its Breeding And Conservation Of Genetic Resources D.Jantankhorol, N.Togtokhbayar ...................................................................................................................... 421 Genetic Resources And Morphological Characteristics Of Cattle Breeds In Kosovo H. BYTYQI, H. MEHMETI, S. MUJI, M. THAQI, A. JAHJA, B. MEHMEDI, N. MESTANI ......................................... 425 The Goat Resources In Kosovo H. BYTYQI, M. THAQI, F. KRASNIQI.................................................................................................................... 433 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) XXI Conversation Of Farm Animal Genetic Diversity In Palestine Iyad Badran ....................................................................................................................................................... 437 The Diversity Of Georgian Local Cattle Levan Tortladze, Giorgi Khatiashvili.................................................................................................................. 445 Morphological And Managerial Characteristics Of The Busha Cattle Reared In Macedonia And Its Importance As A Genetic Resource M. ADAMOV, G. BUNEVSKI, N. ADAMOV.......................................................................................................... 451 Model The Preservation Of Indigenous Breeds M. BRKA, H. OMANOVIĆ, E. ZEČEVIĆ, A. DOKSO ............................................................................................... 455 Phenotypic Diversity Of Some Domestic Farm Animals In Sudan Y.A. HASSAN ...................................................................................................................................................... 459 Overview On Agri‐Environmental Measures Yasemin ÖNER, A. Oya AKIN, Mehmet ERTUĞRUL ........................................................................................... 465 Breeding Values Of Introduced Cows’ Population Of Simmental Breed Cattle Austrian Selection Vladimir Radionov, Tatiana Railean.................................................................................................................. 467 The Global Plan of Action for Animal Genetic Resources * Irene Hoffmann Animal Genetic Resources Branch, FAO The first International Technical Conference on Animal Genetic Resources for Food and Agriculture, organized by the Food and Agriculture Organization of the United Nations, took place from 3 to 7 September 2007, in Interlaken, Switzerland. The main achievement of the Conference was the adoption of the Global Plan of Action for Animal Genetic Resources (the Global Plan of Action), the first ever international framework for the promotion of the wise management of animal genetic resources for food and agriculture, endorsed by governments (FAO, 2007b). The political and technical processes leading to its adoption are described in Hoffmann et al. (2010). The Global Plan of Action for Animal Genetic Resources consists of three parts: I. the Rationale; II. the Strategic Priorities for Action; in which twenty‐three Strategic Priorities are clustered into four Priority Areas: Area 1: Characterization, inventory and monitoring of trends and associated risks (2 Strategic Priorities); Area 2: Sustainable use and development (4 Strategic Priorities); Area 3: Conservation (5 Strategic Priorities); Area 4: Policies, institutions and capacity‐building (12 Strategic Priorities), and III. Implementation and Financing of the Global Plan of Action for Animal Genetic Resources. The Commission on Genetic Resources for Food and Agriculture (CGRFA) that had guided the development of the Global Plan of Action was requested to oversee its implementation and to develop a funding strategy. Major multilateral and bilateral funding institutions were invited to provide contributions to support to the Global Plan of Action. The Global Plan of Action describes the essential role of the FAO in supporting country‐driven efforts to its implementation, in particular, in continuing to facilitate global and regional collaboration and networks; supporting the convening of intergovernmental meetings; maintaining and further developing the Domestic Animal Diversity Information System (DAD‐IS); developing communication products; providing technical guidelines and assistance, and coordinated training programmes; promoting the transfer of technologies relating to sustainable use, development and conservation of animal genetic resources; and coordinating future preparation of global status and trends reports on animal genetic resources. A summary of FAO’s activities and partnerships and projects directed at supporting implementation of the Global Plan of Action so far is presented in FAO (2009; 2011a). The Global Plan of Action and the State of the World’s Animal Genetic Resources for Food and Agriculture (the State of the World) (FAO, 2007a) have been published in all UN languages. Since 2007, FAO distributed more than 54 000 copies of the different products in various languages1. Several National Coordinators for the Management of Animal Genetic Resources (National Coordinators) have prepared national language versions of the State of the World “in brief”, the Global Plan of Action and the Interlaken Declaration for awareness raising and policy making at national level. Countries are taking important steps in its implementation, although at different * 1 Invited paper RBI 8th Global Conference on the Conservation of Animal Genetic Resources Namik Kemal University – Faculty of Agriculture, Department of Animal Science ‐ Turkey CGRFA/WG‐AnGR‐6/10/Inf. 2. 2 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) speeds and with different priorities. While developing countries aim to strengthen linkages between genetic diversity, livelihoods and food security, several developed countries highlight the links between genetic diversity and landscapes, and focus their activities on development, labelling and marketing of high‐value products (Hoffmann and Scherf, 2010). Several countries are currently revising their livestock or breeding policies and strategies, and regional organizations, for example AU‐IBAR in Africa, have included use and conservation of genetic resources in their strategic plans (AU‐IBAR, 2009). FAO focuses its support to the implementation of the Global Plan of Action on areas of strategic importance. As regards monitoring and assessment, FAO and partners pursue the storage of data in publicly accessible databases. The Domestic Animal Diversity Information System (DAD‐IS), which is recognized by the Convention on Biological Diversity as the Clearing‐House Mechanism for animal genetic resources, has been further developed. The global breeds data base within DAD‐IS is crucial for monitoring the success of the Global Plan of Action. As regards technical support to promote capacity development and policy and strategy advice, FAO received an increasing number of requests for technical assistance, many of them related to policy development. FAO and its partners have contributed to operating or developing projects involving more than 100 countries, organized more than 20 regional capacity development events and developed seven technical guidelines. Linked to the development of norms and standards, FAO and partners have continued to pursue the standardization of methods for characterization of animal genetic resources, a prerequisite for cross‐country comparisons and meta‐studies. FAO intensified its cooperation with the Convention on Biological Diversity, and collaborated with a wide range of partners on cross‐cutting issues such as climate change and value addition, and on identifying ‐benefits of better animal genetic resources management. At its twelfth session, the CGRFA decided on two lines of reporting on the implementation of the Global Plan of Action, one on the process of its national implementation and the other on the impact these national processes have on the animal genetic resources themselves: a reduction in the loss and the better management of animal genetic resources are the final measurable indicators for the success of the Global Plan of Action. FAO regularly reports to the CGRFA on the support it has given to countries for their national implementation of the Global Plan of Action, including on the development of guidelines and methods (FAO, 2009; FAO, 2011a). Countries will report on progress for the implementation of the Global Plan of Action in a four‐year interval, starting in 2011. FAO will synthesize these reports; the second Synthesis Progress Report will be made available to the CGRFA in 2017, as part of updating the State of the World report. Regarding the monitoring of the status of the genetic resources, FAO has to prepare bi‐annual “status and trends reports” based on the national breed population data available in DAD‐IS (FAO, 2011b). Unfortunately, population data for 36% of all breeds are still missing; this situation has not significantly improved since 2007. The scarcity of data will also impact on the indicator to measure trends in genetic diversity of domestic animals that is currently being developed by FAO. In addition, countries have not agreed on a specific target for livestock genetic diversity or ex situ collections. The CGRFA also adopted the Funding Strategy for the implementation of the Global Plan of Action for Animal Genetic Resources2 and requested FAO to implement it and to establish a FAO Trust Account. The Funding Strategy sets out procedures for the use of funds received through the FAO Trust Account. The Funding Strategy was published3 and made available in the official FAO languages, and donors were invited to contribute. The Trust Account has, so far, received contributions around one million USD from the governments of Germany, Norway and Switzerland. At its thirteenth Session, the CGRFA decided to launch the first call for proposals for the Trust Account of the Funding Strategy of the Global Plan of Action. The First Call for Proposals will assure a competitive and 2 3 CGRFA‐12/09/Report, Appendix C. www.fao.org/docrep/012/i1674e/i1674e00.htm The Global Plan of Action for Animal Genetic Resources 3 transparent process of project development, implementation and monitoring in support of the implementation of the Global Plan of Action. A recent informal country survey (Hoffmann and Scherf, 2010) indicates that even without FAO direct support, there is a new and unprecedented momentum for the promotion of the wise management of animal genetic resources as a means to improve food security and sustainable development worldwide following the adoption of the Global Plan of Action. The country experiences imply that countries have made strategic use of national, bilateral and multilateral resources to advance the implementation of the Global Plan of Action. CHALLENGES Sustainable development equally includes environmental protection including biodiversity, economic growth and social equity, both within and between generations. Animal genetic diversity is part of agricultural biodiversity. FAO contributed to the expert meeting, “The role of biodiversity for food and agriculture in feeding the world and in light of global changes,” (FAO and PAR, 2011) and prepared a scientific paper on the link between biodiversity and sustainability (Hoffmann, 2011). Other scientific papers were prepared on the interactions between animal genetic resources and climate change, covering positive and negative effects of livestock on the environment and environment‐related threats to livestock biodiversity (Hoffmann, 2010a, 2010b). The latest assessment by FAO found that a global total of 8 054 breeds have been reported (FAO, 2011b). 1 053 transboundary breeds were reported in 2010, of which 504 are regional transboundary breeds and 549 are international transboundary breeds. For 36% of breeds the risk status is unknown: 13 % of international transboundary breeds, 17% of regional transboundary breeds and 39% of local breeds. Of the 613 breeds (8%) classified as extinct, only 7 (1%) are transboundary breeds. A total of 1 710 breeds (21 %) are classified as being at risk, 22% of all local and 16% of all transboundary breeds (FAO, 2011b). FAO (2011b) indicates that the threats to breed survival in the past century was highest in regions that have the most highly specialized livestock industries with fast structural change, and in the species kept in such systems. In two FAO questionnaire surveys (one on threats to breed diversity and one on the contributions of different threats to the extinction of 952 breeds) three threats were mentioned by most respondents and hence can be regarded as the most significant in eroding livestock genetic diversity across all species: 1. economic and market drivers, 2. poor livestock sector policies, 3. poor conservation strategies (FAO, 2009c). Pilling (2010) stresses that an analysis of threats should equally aim at recording the presence / absence of particular threats and at providing a better understanding of their spatial and temporal dynamics. Another study (Hoffmann, 2011) uses a country‐level dataset to assess trade‐offs between livestock genetic diversity and economic development goals. Despite the incompleteness of country data, the results of the analysis tend to confirm the importance of economic development drivers for the risk status of breeds. Research on the sustainable use of livestock genetic diversity is difficult because of the scarcity of detailed data for breeds’ status and the drivers affecting it, the multi‐level stakeholders involved and the trade‐offs between the various social and environmental global public goods concerned. Genetic diversity conservation is a global public good while livestock keepers and breeders, as managers of breed diversity, aim to improve their livelihoods and well‐being. The results of Hoffmann (2011) point to an increasing dichotomy between intensive livestock production systems for food production based on few transboundary breeds and low external input systems where local breeds provide multiple services for the livelihoods of their keepers. They also seem to indicate that countries that have achieved immediate food security needs and surpassed a certain average income are more likely to invest in breed population monitoring and conservation. Given the rapid global changes, poor countries as well as poor livestock keepers would need incentives to embark on improved genetic resources management at an earlier stage in economic development. However, unless better ways are found to maximize co‐benefits between biodiversity conservation and 4 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) economic development, the threats for livestock genetic diversity are expected to continue with accelerating pace. Genetic erosion may be included in the list of externalities not captured by market prices, and innovative ways, either market‐based or regulatory, could be explored to reward “providers” and charge “polluters”. Another reason for the loss of breeds is the current undervaluation of the positive externalities they provide ‐ the non‐market products and services. Research in the assessment of true environmental costs and valuation of non‐market products and services, including ecosystem services, provided by livestock should be intensified in order to close the mismatch between the private and public interest in breed conservation (FAO, 2007c). Especially for poor livestock keepers, the conservation of breeds and other dimensions of biodiversity has to go hand in hand with securing and improving their livelihoods (FAO, 2009b); this includes value‐adding to the breeds’ products (LPP et al., 2010; Mathias et al., 2010). Another potential for local breeds lies in their perceived superiority as regards functional traits (Gandini et al., 2010), which may become more important in future. However, due to the speed of change, in situ conservation has to be accompanied by ex situ conservation. REFERENCES AU‐IBAR, 2009. Strategic Plan 2010‐2014. Nairobi. FAO, 2007a. The State of the World’s Animal Genetic Resources for Food and Agriculture, Rome. FAO, 2007b. Global Plan of Action for Animal Genetic Resources and the Interlaken Declaration, Rome. FAO, 2007c. The State of Food and Agriculture 2007. Paying Farmers for Environmental Services. Rome. FAO, 2009a. Detailed report on FAO activities in the follow‐up to the International Technical Conference on Animal Genetic Resources for Food and Agriculture, CGRFA/WG‐AnGR‐5/09/Inf.2 FAO, 2009b. Livestock keepers – Guardians of biodiversity. Animal Production and Health Paper 167, Rome. FAO, 2009c. Threats to animal genetic resources – their relevance, importance and opportunities to decrease their impact. CGRFA Background Study Paper No. 50, Rome. FAO, 2011a. Detailed FAO Progress Report on the Implementation of the Global Plan of Action for Animal Genetic Resources (CGRFA/WG‐AnGR‐6/10/Inf.2) FAO, 2011b. Status and Trends of Animal Genetic Resources – 2010 (CGRFA‐13/11/Inf.17) FAO and PAR, 2011. Biodiversity for Food and Agriculture ‐ Contributing to food security and sustainability in a changing world. http://www.fao.org/fileadmin/templates/agphome/scpi/SCPI_Compendium/PAR‐ FAO_Biodiversity.pdf Gandini et al., 2010. Motives and values in farming local cattle breeds in Europe: a survey on 15 breeds. Animal Genetic Resources 47, 45–58. Hoffmann, I. 2010a. Climate change and the characterization, breeding and conservation of animal genetic resources. Animal Genetics, 41 (Suppl. 1), 32–46. Hoffmann, I. 2010b. Climate change in context: Implications for livestock production and diversity. In Odongo, N.E., M. Garcia, G.J Viljoen (eds) Sustainable improvement of animal production and health. IAEA‐FAO, 33‐44. Hoffmann, I., 2011. Livestock biodiversity and sustainability. Livestock Science, Special Issue “Assessment for sustainable development of animal production systems”. Livestock Science 139, 69–79 Hoffmann, I., B. Scherf, 2010. Implementing the Global Plan of Action for Animal Genetic Resources. Animal Genetic Resources 47, 1‐10 Hoffmann, I., D. Boerma, B. Scherf, 2010. The Global Plan of Action for Animal Genetic Resources – The road to common understanding and agreement. Livestock Science 136, Issue 1 Animal Breeding for Poverty Alleviation: Harnessing Science for Greater Impact, 7‐14. LPP, LIFE Network, IUCN–WISP and FAO. 2010. Adding value to livestock diversity – Marketing to promote local breeds and improve livelihoods. FAO Animal Production and Health Paper. No. 168. Rome. http://www.fao.org/docrep/012/i1283e/i1283e00.pdf Mathias, E., P. Mundy & I. Köhler‐Rollefson, 2010. Marketing products from local livestock breeds: an analysis of eight cases. Animal Genetic Resources 47, 59‐72 Pilling, D., 2011. Threats to animal genetic resources for food and agriculture –approaches to recording, description, classification and analysis. Animal Genetic Resources 47, 11‐22 SUSTAINABLE CONSERVATION OF AnGR THROUGH COOPERATIVE NETWORKS G.L.H.ALDERSON Rare Breeds International, 6 Harnage, Shrewsbury, Shropshire SY5 6EJ, UK lawrence@clltd.demon.co.uk Abstract Significant and organised conservation of animal genetic resources (AnGR) began in the mid‐ twentieth century with the formation of the Food and Agriculture Organisation of the United Nations (FAO) and the formation of Rare Breeds Survival Trust (RBST) in the UK. However, governmental and non‐governmental actions were pursued separately to a large extent until the early 1990s when signing of the Convention on Biological Diversity coincided approximately with the formation of Rare Breeds International. Until that time there had been ongoing genetic erosion, but subsequently there has been increasing cooperation which has encouraged the development of networks enabling successful conservation projects to be developed and implemented. They are the blueprint for sustainable and effective conservation of AnGR. Keywords: AnGR, FAO, NGO, cooperation Introduction An historical review of progress for the conservation of animal genetic resources (AnGR) must consider not only both governmental and non‐governmental contributions but also their interaction and assess whether the final outcome is greater than the sum of the parts, or whether there are negative aspects of duplication or contradiction. Early governmental actions Although earlier individual incidents of conservation of livestock breeds can be cited, the first notable governmental actions occurred in the early twentieth century. In 1925 a dedicated Kerry cattle area was created in the Republic of Ireland, and in 1927 the Wichita refuge was established in USA for Texas Longhorn cattle. The global development of the conservation concept was realised in 1945 by the formation of the Food and Agriculture Organisation (FAO) of the United Nations. Although it took some time for FAO to focus its efforts on programmes for the conservation of AnGR, its impact gradually increased resulting in a substantial archive of guidelines and reports. The establishment of the Commission of Animal Genetic Resources for Food and Agriculture initiated among FAO member nations in the late 1990s is another milestone in AnGR networking. Much valuable work on breed surveys was done by Mason (Mason, I.L., 1951; Mason, I.L., 1967) and others, such as Epstein (Epstein, H., 1971), who made area reports for FAO. There also were some national initiatives such as State programmes in Hungary in the 1960s for Grey Steppe cattle, Racka sheep and Mangalitsa pigs. Early NGO actions Although the formation of breed societies in the nineteenth century could be considered a form of NGO activity, organised NGO development for the conservation of native AnGR did not take place until the 1960s when the movement began in the UK. It was triggered by joint action of the Zoological Society of London (ZSL) and Royal Agricultural Society of England (RASE) and acted as the 6 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) catalyst for the formation of the Rare Breeds Survival Trust (RBST) which was registered formally in 1973. It established several significant programmes which set a precedent for similar developments elsewhere. In 1975 it created a semen gene bank, developed a network of approved conservation centres or farm parks, organised a show and sale for rare breeds, and published a monthly magazine (Ark). In the mid‐1990s it launched the Traditional Breeds Meat Marketing Scheme, and instituted DNA testing to develop breed profiles for endangered native breeds. Other national NGOs were formed in many countries from 1976 onwards. Rare Breeds International (RBI) was created in 1989 and registered in 1991 as the ‘umbrella’ NGO to coordinate international NGO activities (Alderson & Ramsay, 2001). Its members form a grassroots network rich in experience of native AnGR and it seeks to work with governmental organisations to link legislation to management and policy to practical action. Collaboration The contributions of both governmental and non‐governmental organisations to the conservation of AnGR were reviewed in a study which interviewed experts to discover the major milestones in the history of AnGR management (Kubbinga, B. et al, 2007). It concluded that conservation of AnGR was a bottom‐up process, starting at grassroots (NGO) level and leading to policy at governmental level. Three events of particular importance were identified. The first was the formation of an NGO (RBST) in 1973; the second was the Technical Consultation convened in Rome by FAO in 1980 with delegates from both governmental agencies and NGOs; the third was the governmental Convention on Biological Diversity (CBD) in 1992 which, although it lacked a specific framework for AnGR conservation, finally recognised the fundamental objective of NGOs (i.e. the conservation of native breeds at risk) and the recommendations of the 1980 Technical Consultation. However, interaction between governmental agencies and specialist ‘rare breeds’ NGOs still was very limited in many countries until 1990, and often their objectives were not compatible. While ‘rare breeds’ NGOs were seeking to protect native AnGR, some other agencies were actively promoting the use of exotic breeds and donating obsolete ‘developed world genetics’ to developing countries in the guise of philanthropic aid. Even governmental bodies were not immune from this practice. FAO’s prevailing policy during the 1960s and 1970s was based on the introduction to tropical areas of high‐performance temperate breeds by the use, for example, of Holstein‐Friesian semen. The outcome was a continuing erosion of native AnGR with local adaptation. The formation of RBI and the signing of CBD at about the same time changed the situation. Collaboration began to develop constructively and with greater impact during the 1990s. Governmental (FAO) and NGO (RBI) links developed actively on a global basis. At the 3rd RBI global conference in Canada in 1994 there were presentations by a member of the USA Department of Agriculture, a member of the Canadian parliament and two FAO officers, and there were similar inputs at succeeding RBI conferences in Nepal (1998), Brazil (2000), South Africa (2005) and Vietnam (2008). RBI and national NGOs also spread their network laterally to link with environmental, landscape, food quality and food security interests. Meanwhile, FAO launched the State of the World’s Animal Genetic Resources (SoW‐AnGR) project (FAO, 2007) during the period 2001‐5 as an outcome of CBD, and the preparation of Country Reports required active cooperation in each country between the appropriate government departments and the national NGO. Similarly, the Global Plan of Action (GPA) (FAO, 2007a), which resulted from the meeting of the International Technical Conference in Interlaken in 2007 detailed priority actions progressing through characterisation, sustainable utilisation, conservation and policy, in a bottom‐up format which inevitably required input from NGOs. It stated that “The effective management of animal genetic resources, at all levels, depends on the inclusion and willing participation of all relevant stakeholders ‐ ‐ ‐ NGOs and the private sector should be encouraged to participate and support implementation of the GPA for AnGR.” Sustainable Conservation ıf AnGR Through Cooperative Networks 7 Current situation Current status of AnGR The GPA noted that the Country Reports “confirm the serious erosion of genetic diversity in both developed and developing countries” and a key issue identified in Strategic Priority Area 3 was that 21.36% of mammalian breeds (excluding deer and rabbits) were at risk of extinction in 2006 and the status of 35.39% of breeds was unknown (Table 1). During the last five years breeds have become extinct at the rate of one each month. Thus 60 years after FAO was created, and 40 years after the emergence of NGOs, the situation remains precarious and possibly appears to be deteriorating. In 1994 18.87% breeds were at risk, and the status of 31.19% was unknown (FAO, 1995), although an extra 2213 breeds had been listed in the intervening decade (Table 1). year 1994 2006 1994 2006 number number % % at risk 501 1040 18.87 21.36 Table 1 Risk status unknown not at risk 828 1326 1723 2105 31.19 49.94 35.39 43.24 total 2655 4868 extinct 364 641 12.06 11.64 Current challenges The immediate challenge is to prevent, or minimise, the extinction of further breeds. More than 800 mammalian breeds are classified as endangered, and this presents a formidable task. An associated challenge is to clear the ‘unknown’ backlog through identification of breeds and inventories of their numbers and location. It is likely that this will swell further the number of endangered breeds. Threats to AnGR must be identified and support mechanisms provided to anticipate and avert the threats. Characterisation of breeds, including morphology, production traits and DNA profiling, will be necessary to identify useful/unique traits and added‐value opportunities. Current major threats FAO identified three key issues in the GPA namely: • Displacement of local breeds by importation of exotic breeds causing loss of native AnGR • Indiscriminate cross‐breeding which compromises the genetic integrity of local populations • Animal breeding patents which threaten the freedom of livestock keepers. There is widespread agreement that breed substitution / introgression is a serious threat especially in the developing world, where breeds such as Ankole cattle in Uganda are increasingly threatened by exotic breeds and crosses, but even in the developed world it is damaging native AnGR. For example, in the UK cattle population in 2006 there were more exotic breeds than native breeds, and the number of animals in native cattle breeds was less than 14% of the total number of cattle, mainly because of the impact of Holsteinisation (Figure 1). 8 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 1 Pedigree Cattle of Native Breeds in UK 1994-2006 60 50 40 % of total Beef Dairy 30 All 20 10 0 1 2 3 4 Recently other threats have become more prominent. In particular the division of opinion surrounding climate change creates uncertainty for livestock keepers. Is it a reality or an illusion? Is it a threat or an opportunity? Currently it presents problems for breeds with local adaptation to non‐ intensive grazing as a result of the infamous ‘Livestock’s Long Shadow’ report by FAO’s Livestock Information and Policy Branch in 2006 (Steinfeld et al, 2006) and the subsequent failure to recognise the difference between intensive and extensive systems of production with regard to net carbon emissions (Alderson, L., 2008). Disease is a more obvious and defined threat. The spread of disease may be accelerated by climate change. For example, bluetongue serotype 8 has spread northwards through Europe as far as Sweden, followed by serotype 1 which now has reached northern Europe. Breeds which are geographically concentrated are at particular risk, not only from disease epidemics but also from disproportionate control measures. Several breeds in UK with limited geographical distribution lost as much as 40% of their population in the FMD outbreak in 2001, although the most critically endangered breeds already had been distributed more widely by RBST in response to the FMD outbreaks in 1967 and 1981. Disease control is dictated by governmental policy. Issues such as vaccination against bluetongue require central direction, but other issues, such as culling of badgers to control bovine tuberculosis, require joint action by government agencies and livestock keepers. The way forward Meeting the challenges Two separate responses are necessary to counteract genetic erosion. Emergency actions are required as a priority to deal with immediate challenges and to counteract the threats. They are determined by the specific character of each challenge, and can not be defined by any standardised procedure or protocol. Equally important, a longer‐view strategy is necessary to develop ongoing sustainable conservation, and this requires a deeper understanding of the essential elements of success. Sustainable Conservation ıf AnGR Through Cooperative Networks 9 Elements of success New enterprises often follow a three‐stage process (Hodges, J. 2002). Initially there are individuals with vision, and visionaries in the field of AnGR conservation usually have emerged from NGOs. This is followed by organisers who create the infrastructure of institutions and often this is achieved most effectively with centralised planning which pre‐supposes governmental involvement. Finally, there must be teams of activists to carry out the practical projects which deliver the outcomes that justify both the vision and the institutions. This process has passed through all three phases in many parts of the world, but funding from the Global Environment Facility (GEF) and other sources has failed to deliver adequate support for practical AnGR projects which are carried out by breeders and keepers of native breeds of livestock. Consequently, during the 1990s the erosion of AnGR continued. The position now has improved but not significantly, and the vision has been only partially realised. Three constituent elements are required to ensure that the vision is realised, namely policy, research and practical action. Policy is a governmental responsibility and provides the framework (skeleton) on which programmes for conservation can be built, but there also is a governmental responsibility to provide the necessary financial resources. Research puts flesh on the bones and gives activists a stronger information base for decision‐making. Practical action is the essential function, even though it often is neglected by those in the corridors of power. It requires governmental and scientific support to deliver useful outcomes. These phases are inter‐dependant; in isolation each is limited in its potential impact and achievement. The appointment by respective governments of National Coordinators, and the development of Regional Focal Points (RFP), all within the hierarchy of the FAO Global Focal Point in Rome, has created a wide governmental network with the potential for active and effective support for AnGR. NGOs recognise and welcome this network, but there is a danger that it could duplicate or fall into counter‐productive conflict with the NGO network, and it is essential that they work together in a symbiotic partnership. NGOs are an integral part of the overall structure. Organisations such as RBST (UK), ALBC (USA), RBTA (Australia) and others hold a wealth of data and experience, and they should remain as focal points within a national context. This was recognised by FAO in the Interlaken Declaration: “We recognize that the genetic resources of animal species most critical to food security, sustainable livelihoods and human well‐being are the result of both natural selection, and directed selection by smallholders, farmers, pastoralists and breeders, throughout the world, over generations. The result is a wide variety of livestock breeds that provide a diverse stream of benefits to the environment, humanity and its cultural heritage.” Global collaboration Each sector makes a distinctive contribution, and it is desirable that the disparate expertise found in governmental agencies, research institutes and universities, conservation NGOs and the farming community, is combined in cooperative programmes. The current efforts to achieve standardisation of criteria and thresholds for the definition of breeds at risk provide a prime example. The process has been developed by joint efforts of governmental and non‐governmental programmes. It was initiated at the RBI global conference in Canada in 1994, but there was limited progress until it became the central theme of a seminar in London convened by RBI and ERFP in 2010 (Alderson, L., 2010). Ongoing working groups formed by ERFP and FAO now are approaching a conclusion. The outcome is likely to combine the best aspects of the existing FAO and RBI systems. It probably will be based on the FAO standard criterion of numerical scarcity with thresholds of 100 and 1000 breeding females for critical and endangered status respectively, but it will be expanded to recognise NGO distinctions between species, the need to introduce a third tier of vulnerability, and to introduce other primary indicators of risk, namely genetic erosion and geographical concentration (Table 2). 10 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) category critical endangered vulnerable * numerical ^ geographical " genetic Table 2 Endangerment categories for sheep breeds numerical* geographical^ <300 <12.5 <3000 <25 <6000 <50 number of breeding females distance (km) from mean focal point rate of inbreeding per generation genetic" >3 1.0‐3.0 0.5‐1.0 Other examples of joint action include the genetic impact protocol which was initiated by a government department in South Africa and promoted by an NGO (RBI), and the development of markets for products from native AnGR which is assisted by both governmental designations of geographical origin and special quality (PDO, PGI, TSG) and NGO marketing projects such as the Traditional Breeds Meat Marketing Scheme (TBMMS) in Britain, Iberian processed ham in Spain and many initiatives with Ark of Taste, the Slow Food foundation for biodiversity. Knowledge transfer (KT) is a related activity, and exchange of knowledge between members has been a primary objective of RBI. For example, the expertise in poultry breeding and husbandry developed in Canada by RBI Trustee, Roy Crawford, was utilised by other NGOs to develop their national poultry conservation programmes. Conclusions Sustainable and effective conservation of AnGR requires cooperation by governmental and non‐governmental bodies developed in active networks. The combination of their disparate expertise has the potential to provide a comprehensive resource necessary to counteract current and emerging threats and challenges, and to minimise further genetic erosion. Knowledge transfer is an extra product of both cooperation and networks. Governmental support for practical projects often has been deficient, but precedents have demonstrated that the most successful programmes are likely to use a bottom‐up process initiated by NGOs, but requiring a centralised (governmental) structure to be implemented with full effect. REFERENCES Alderson, L. (2008) Grazing livestock and greenhouse gases in the UK. RASE Journal 169, pp 87‐93 Alderson L. (2010) Report from seminar "Native breeds at risk, criteria and classification", www.lawrencealderson.com Alderson, L. & Ramsay, K. (2001) The role of Rare Breeds International as a global organisation for the conservation of farm animal genetic resources. AGRI 31, pp 9‐14 Epstein, H. (1971) The origin of domestic animals of Africa. Africana Publishing Corporation, New York FAO. (1995) World Watch List for domestic Animal diversity, edited by Beate D. Scherf, Rome FAO. (2007) The State of the World’s Animal Genetic Resources for Food and Agriculture, edited Barbara Rischkowsky & Dafydd Pilling. Rome FAO. (2007a) Global Plan of Action for Animal Genetic Resources and the Interlaken Declaration, Part II, pp 14‐ 33 Hodges, J. (2002) Conservation of farm animal biodiversity: history and prospects. AGRI 32, pp 1‐12 Kubbinga, B., Hoffmann, I. & Scherf, B. (2007) Passing on the fire – To further inspire people to contribute in the management of animal genetic resources. AGRI 41, pp 1‐7 Mason, I.L. (1951) The Classification of West African Livestock. Commonwealth Agricultural Bureau. Mason, I.L. (1967) The Sheep Breeds of the Mediterranean. FAO, Rome. Steinfeld, H., Gerber, P., Wassenaar, T., Castel, V., Rosales, M. & de Haan, C. (2006) Livestock’s Long Shadow – Environmental Issues and Options, FAO, Rome, pp 390 ANIMAL GENETIC RESOURCES CONSERVATION AND SUSTAINABLE UTILIZATION: REGIONAL EXPERIENCES IN EUROPE A. Oya AKIN ERFP Steering Committee Member, Republic of Turkiye Ministry of Food, Agriculture and Livestock, General Directorates of Agricultural Research and Policy Summary The European Regional Focal Point for Animal Genetic Resources (ERFP) is the European implementation of the Global Strategy of the Food and Agriculture Organisation of the United Nations (FAO) for the management of farm animal genetic resources (FAnGR). ERFP is a communication platform managed by the Secretariat. Under the control of the Steering Committee, it publishes the National Coordinators' information and ensures the exchanges of information and experience between the different countries and the governmental and nongovernmental organisations (NGOs). It works with the sub-regional organisations in order to reinforce the common approach in neighbouring countries or having the same problems or needs. In this framework, it receives an information support from the University of Hanover, in particular for the maintenance of the European database and the exchanges with the Domestic Animal Diversity Information System (DADIS) of the FAO. It establishes closer working relationship with international NGOs such as Rare Breeds International (RBI), The SAVE Foundation (SAVE), Danubian Alliance for Conservation of Genes in Animal Species (DAGENE) or the European Forum of Farm Animal Breeding (EFFAB). For all the scientific aspects, it receives help from the European Association of Animal Production Working Group on Animal Genetic Resources (EAAP WG-AGR). Keywords Regional focal point, farm animal genetic resources, conservation, sustainable utilization Terms of Reference for the European Regional Focal Point (ERFP) and Programme for Animal Genetic Resources 1. Development of the European Regional Focal Point World food security and poverty alleviation are global challenges for present and future generations. At the same time, the conservation and sustainable utilization of biological diversity as well as the fair and equitable sharing of the benefits arising out of the use of genetic resources are central tasks of the global community, as agreed by the adoption of the Convention of Biological Diversity in 1992. The Millenium Development Goal 1 "eradicate extreme poverty and hunger" and Goal 7 "ensure environmental sustainability" highlight these challenges. As an important part of the agricultural biodiversity, animal genetic resources are an essential basis for livestock production and offer opportunities to adapt animal breeds to changing environments, especially in the light of climate change. Hence, the European Regional Focal Point for Animal Genetic Resources (ERFP) was initiated in 1998 and became formally operational in 2001 as the European part of FAO's global coordination structure for animal genetic resources which is based upon national and regional focal points. Over the years, the collaboration and coordination facilitated by the ERFP in Europe has developed successfully. There are now 45 countries involved. Experience gathered since the establishment of the ERFP lead to the preparation of new terms of reference for the organisation and 12 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 - 8 October 2011) long term planning in the form of a Multi Year Programme of Work (MYPOW) for the period 2010 to 2014. Since its establishment, ERFP has been funded through voluntary financial contributions made by donor countries. Voluntary additional financial contributions may also be made by donors for specific programmes or projects co-ordinated by the ERFP. The financial management is carried out by the Secretariat of the European Federation of Animal Science (EAAP) in Rome. However, under the MYPOW a new funding mechanism is being established, see point 5 below. The organisational core of ERFP consists of the Assembly of National Coordinators, Steering Committee (SC) and Secretariat. Working Groups consisting of NC’s or other experts in the member states are the most important tools in the activities coordinated by the ERFP. Some short-term work may be carried out by Task Forces responding to very acute needs. The Assembly may also ask a named group to carry out ad hoc actions related to the needs of the common ERFP programme or the needs of the Secretariat as issues arise. The objectives of the ERFP are: • To support the in situ and ex situ conservation and sustainable use of AnGR in European countries. • To facilitate the implementation of the Global Plan of Action for AnGR in Europe. • To assist and enhance the AnGR activities of NCs at the European level. • To develop and maintain regular contact and exchange of relevant information on AnGR horizontally between European NCs and EAAP and vertically with the Global Focal Point in Rome using existing structures. • To stimulate the funding and organisation of regional projects, research, workshops and national programmes for AnGR within the European Region. • To maintain an appropriate liaison with the European Commission, the FAO Commission on Genetic Resources for Food and Agriculture, the Secretariat of the Convention on Biological Diversity and regional and international NGOs. For scientific aspects, it is supported by the European Association of Animal Production’s Working Group on Animal Genetic Resources (EAAP WG-AGR). • To stimulate and coordinate the maintenance and further development of national and regional AnGR databases and to encourage European information networking on AnGR. The ERFP works with existing operational structures in countries and seeks partnerships and collaboration with existing organisations. ERFP has been involved in facilitating regional communications; providing technical assistance; coordinating training, research and planning activities amongst countries; development of regional policies; assisting in identifying projects; and interacting with government agencies, donors, research institutions and non-government organizations. 2. Global Plan of Action The international community has, in September 2007, adopted the first ever Global Plan of Action for Animal Genetic Resources (GPA), comprising twenty-three Strategic Priorities which are aimed at combating the erosion of animal genetic diversity and at using animal genetic resources in a sustainable fashion. The Strategic Priorities for Action, contained within the GPA, propose specific measures to reverse the ongoing trends of erosion and underutilization of animal genetic resources (AnGR). Sustainable Conservation ıf AnGR Through Cooperative Networks 13 The Strategic Priorities for Action contain the following four Strategic Priority Areas: • Characterization, Inventory and Monitoring of Trends and Associated Risks The actions provide a consistent, efficient and effective approach to the classification of animal genetic resources, and to assess trends in, and risks to, animal genetic resources. • Sustainable Use and Development The actions are to ensure sustainability in animal production systems, with a focus on food security and rural development. • Conservation The actions focus on steps needed to preserve genetic diversity and integrity, for the benefit of current and future generations. • Policies, Institutions and Capacity-building The actions directly address the key questions of practical implementation, through coherent and synergistic development of the necessary institutions and capacities. The main responsibility for implementing the Global Plan of Action rests with national governments who appoint National Coordinators (NCs) to take charge of their national programmes. The implementation of the GPA by individual countries is facilitated by, and benefits from, the existence of international networks of NCs. Regional Focal Points and regional networking have a vital and important role in building collaborative partnerships, in coordinating regional management efforts in animal genetic resources, in further developing information sharing and enhancing technical cooperation, training and research. In Europe, this collaboration is co-ordinated by ERFP. 3. Operational Structure of ERFP 3.1 Assembly of National Coordinators The Member States of ERFP are represented in the Assembly by National Coordinators who are nominated by the respective Ministry. The main decision making body of ERFP is the Assembly of NCs or their representatives. In addition, representatives of the European Commission, FAO, EAAP, NordGen and NGOs are invited as observers. An organisation chart is found below (Annex 1). The Assembly brings together all NCs in the European region at the Annual Meeting, usually in connection to the annual EAAP conference. Other meetings might be organised if required. The Assembly approves the ERFP budget and provides overall technical and policy guidance to the operation of ERFP. It holds the overall responsibility for implementing the MYPOW. The Assembly may establish or terminate Working Groups, Task Forces and Ad hoc actions, takes decisions regarding their general scope and review progress made by them. It mandates and oversees the Steering Committee and the Secretariat to carry out its decisions. The Assembly meets annually. The Annual Meeting consists of: • presentation of results produced by the Working Groups, Task Forces and Ad hoc actions; • exchange of information on relevant national and sub-regional activities; • decision on the organisational and general functions within ERFP; • discussion on and adoption of MYPOW with prioritised areas and respective budget allocation for the Working Groups, Task Forces and Ad hoc actions in the coming years; • approval of the annual report and the account for the previous year (based on the auditor’s report which is focussed on reviewing the accomplishments of the decisions made at the previous years Assembly and SC meetings); • approval of annual programme and budget for the coming year (the annual year equals the calendar year); • election of the members and chair of the Steering Committee and auditors (who are all members of the Assembly); • every four years, election of the Secretariat for a 4-years period. 14 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 - 8 October 2011) The Assembly is chaired by the Chair of the Steering Committee. Voting at the Assembly is by majority vote of the NCs except voting on financial matters where consensus is required. Voting can also take place by means of email when it is deemed necessary to do so. 3.2 Steering Committee (SC) • consists of 5 members of the Assembly and a chair, each elected by the Assembly for a 4 year term of office (it includes representatives of each of the European sub-regions – South, Central, East, West and North, with the chair being outside the regional consideration). To ensure continuity, one member of the Steering Committee is replaced by a new member on an annual basis. A re-election is possible only after a break-period. • plans or executes the activities of the ERFP as decided upon by the Assembly of NCs – it evaluates project proposals and makes funding decisions on them. • mandates the Secretariat in carrying out its decisions and monitors the financial position of the ERFP in conjunction with the Secretariat. • establishes short-term Task Forces as required • represents the ERFP in communications with other institutions within the mandate of the Assembly. Decisions of the Steering Committee are made by consensus and can also taken by means of email when it is deemed necessary to do so. 3.3 Secretariat The election of the Secretariat is made by the Assembly of NCs for a 4-year period. A reelection for a maximum of a second 4-year period is allowed. Proposals for hosting the Secretariat are invited by the Assembly one year before the end of the 4-year period from the NCs. NCs may propose offers made by any institution within their country they consider competent to host the Secretariat. Such offers should be made in a standardized format. The responsibilities of the Secretariat are: • to distribute relevant information on AnGR and to facilitate communication among the NCs • to communicate with the Global Focal Point at FAO and other regional focal points • to give secretarial support to the Assembly of the NCs and to organise its Annual Meeting • to give secretarial support to the SC • to execute decisions made by the Assembly and the SC • to support the Working Groups, Task Forces and ad hoc actions such as the ERFP-funded projects as appropriate • to be responsible for the financial management of the ERFP budget • to provide technical and financial reports on a regular basis • to maintain and update the ERFP website • to publish the ERFP newsletter Sustainable Conservation ıf AnGR Through Cooperative Networks 15 4. ERFP activities 4.1. ERFP Working Groups Working Groups (WG) are established by the Assembly on a permanent basis to work on longterm tasks. Members of a Working Group should be experts in the respective task and should be nominated by their National Coordinator. NCs are invited to nominate one member for each Working Group. Each WG is coordinated by a WG leader elected by the WG members. The WG leader has the responsibility to present a draft annual work plan to the Annual Meeting of the Assembly of NCs for adoption. The WG leader should also oversee the implementation of the work plan, in liaison with the Secretariat and the SC, where appropriate, and to encourage involvement of all the WG members. The WG budget available for implementing the work plan should be partitioned by year. Working groups will receive a fixed budget annually accepted by the Assembly. The budget may include travel costs for the WG meetings, the publication of reports and/or other actions, consumables and other costs. Durables will not be considered an eligible expense nor will be salaries. The WG’s should be used to provide guidance on issues of a technical and advisory nature and should publish technical and advisory information for the benefit of all NC's. The technical and advisory material from the WG’s should reflect the requirements needed for the implementation of the Global Plan of Action. The Assembly of NCs will discuss and adopt the priority areas in accordance with the MYPOW. The WGs should facilitate the collaboration and networking of relevant stakeholders in the European region. For information: at present, in 2010, two Working Groups are established on • Ex situ conservation (cryo-conservation) • Documentation and information. The membership of the working group on documentation and information will include a representative of the organization responsible for the maintenance and development of the EFABIS network and will also include a representative from the FAO and EAAP who will attend in the capacity of observer. 4.2. ERFP Task Forces Task Forces (TF) are established by the Assembly or by the Steering Committee on a temporary basis to solve specific tasks. Funds are reserved in the approved overall budget for TF activities. The mandate, budget, leader and members of the TF are decided by the Assembly or the SC and are based upon suggestions received from NCs. TF should consist of 3-8 experts, of which at least the leader should be a member of the Assembly. The budget would cover only the travel and meeting costs. TFs may be established whenever common views of the European region are needed or where a common action would be necessary in order to respond to an urgent issue in the AnGR sector. TFs would deliver a report on the outcomes of their work to the Assembly. For information: at present, in 2010, three Task Forces are established on • Access and benefit sharing • Risk status and indicators • Agri-environmental measures. 16 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 - 8 October 2011) 4.3. ERFP Ad hoc Actions Ad hoc actions are usually decided by the Steering Committee in the form of projects or meetings to solve specific short-term problems ad hoc. Currently, ERFP is funding 3 projects per year coordinated and carried out by NCs selected after evaluation of the proposals submitted in the ERFP Call for Action. The projects have successfully increased the collaboration between countries and as an outcome there are reports containing reviews and guidelines on relevant topics. The common projects serve also as an initiating platform for joint EU projects. Ad hoc actions could therefore be in the form of projects, workshops, meetings or consultancies as decided by the Steering Committee. The rules of procedure for ad hoc actions will be further elaborated upon. 4.4 Information and communication tools • ERFP website • ERFP Newsletter • EFABIS ERFP currently supports three information and communication tools: the ERFP website, the ERFP newsletter and the EFABIS database for AnGR in the European region. The ERFP website plays an important role in enhancing the activities of ERFP and the dissemination of information. Currently, the website is maintained under contract by the BLE in Bonn. The ERFP newsletter is published by the Secretariat approximately twice a year. The EFABIS database has been created to serve as an information tool for the management and conservation of European Animal Genetic Resources. The EFABIS development and maintenance has been supported by EC funding. The current project EFABIS-Net will run until October 2010 and is coordinated by EAAP. ERFP currently supports EAAP for the management and improvement of the Database with the amount of 10,000 Euro per year. 5. Funding ERFP contributions are received on a voluntary basis. To reflect the activities of the ERFP, the annual budget is used on the following items: the Assembly, Steering Committee, Secretariat incl. the website, Working Groups, Task Forces, Ad hoc actions, EFABIS database and the EAAP fee for account keeping. The budget is decided by the Assembly. The new funding approach is based on the Gross Domestic Product rating according to the FAO / UN scale, with categories from A to E. Country contributions are listed according to this scale, in the context of the overall required annual budget. The targeted sum of 123,500 Euro is required to ensure that sufficient funds are available in the transition period and to enhance ERFP activities in the future. In the proposed ERFP budget the lowest contribution would be 600 Euro and the highest would be 11,000 Euro. Sustainable Conservation ıf AnGR Through Cooperative Networks 17 6. Multi Year Programme of Work (MYPOW) of the European Regional Focal Point (ERFP) for Animal Genetic Resources for the period 2010 – 2014 Over the past nine years, ERFP has successfully facilitated collaboration, coordination and exchange of information and experience among countries and organizations in Europe. The experience gathered over this period has led to the preparation of new terms of reference for the work of ERFP and a multi-year programme of work for the period 2010 to 2014. The European Regional Focal Point for Animal Genetic Resources (ERFP) has a light organisational structure made up of the Assembly of National Coordinators (representatives from all European countries), Steering Committee and Secretariat. The activities are carried out based upon a Multi Year Programme of Work (MYPOW). The Secretariat and Steering Committee plan and execute the activities as decided upon by the Assembly. According to the ERFP Terms of Reference the Working Groups, Task Forces and ad hoc actions are the most important tools to implement the activities. The Assembly discusses and adopts the MYPOW with prioritised areas and respective budget allocations for the Working Groups, Task Forces and ad hoc actions for the planned period. The previous manner of project funding by so-called “calls for action” will be replaced by the new Working Groups, Task Forces and ad hoc actions. After the 8th call for action the ERFP will hence not launch another call, but will commit to finance the ongoing projects until their completion. The prioritised areas for the period 2010 – 2014 have been discussed at the annual meeting of the Assembly of National Coordinators in Crete in August 2010 and the following areas have been agreed: 6.1. Ex situ conservation (cryo-conservation) of animal genetic resources (Working Group) In addition to the long-term storage of semen, which is a relatively simple and cheap operation for preserving genetic variation, embryos and tissue are also valuable for the storage of entire genotypes, in particular for local breeds at a critical stage of endangerment. There are differences between countries on how cryo-conservation schemes are organised, especially on how breeding associations and AI centres are involved. Furthermore, there is European and national (sanitary) legislation governing the collection and cryo-conservation of genetic material. In some species, major technological limitations exist, while in others, major advances have been made. The review of available technology and urgent needs of legislation could be done in collaboration across countries. 6.2. Documentation and information of animal genetic resources (Working Group) Over the past number of years, a number of European institutions have developed a regional information system for animal genetic resources (EFABIS) as a contribution and gateway to transfer data from national information systems (national inventories) to the global information system, DADIS, at the FAO. While EFABIS has been developed by a number of collaborating project partners, and has funding in place until the end of 2010, there is a need to transfer the regional database and the supporting national inventories into a permanent information infrastructure for AnGR in Europe. Therefore a draft concept for the future of the EFABIS database is needed, so that the Assembly can decide on the future organisation and implementation of the database. National Focal Points in charge of the national inventories could be nominated by National Coordinators in such countries which have not yet done so. Representatives from the European Association of Animal Production (EAAP) and FAO will also be invited to participate. 18 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 - 8 October 2011) 6.3. Access and benefit sharing (ABS) of animal genetic resources (Task Force) Current CBD discussions are expected to adopt an International Regime on ABS. This is likely to consist of a framework structure, which would require further elaboration for specific aspects of genetic resources, including Animal Genetic Resources (AnGR). In particular, the specific policies and measures which might best constitute components of a specific International Regime for AnGR, need further elaboration. Although the practices for animal genetic resources are very different, it is worth thinking about the political implications and possible benefits of common guidelines or recommendations or even a formalised agreement on AnGR. 6.4. Risk status and indicators of animal genetic resources (Task Force) The risk status of AnGR, especially with regard to local breeds, is an essential basis on which to take informed decisions and initiate activities to support breeds at risk. There are several concepts and methodologies used to assess the risk status. Different indicators are in use by individual European countries, the FAO and the European Commission. A harmonisation of such concepts is needed if the risk status is to be comparable at country, regional and global level. The European SEBI indicators have been a starting point in this direction and will provide the basis for a continuation of European harmonisation activities. A draft concept should be developed and presented to the Assembly for its consideration, discussion and decision, with regard to further progress in this area. 6.5. Agri-environmental measures (support schemes for animal genetic resources) (Task Force) European farmers of local breeds have benefited from economic support under EU agrienvironmental measures for some time. For many breeds, these payment schemes have been effective in halting the decline of population numbers. Further actions in this area could be aimed at developing the self-sustainability of local breeds so that they could be maintained without the need for external economic support. In the development of strategies, a combination of production, multifunctional, market and non-market values, including eco-system services, should be a target towards achieving increased profitability within local breeds. By sharing experiences and knowledge, we can propose more effective and cost-efficient schemes towards sustainable use and conservation of local breeds. A new EU agri-environmental programme after 2013 should hopefully maintain the powerful support for local breeds with encouragement towards higher degrees of self-sustainability. References ERFP Website http://www.rfp-europe.org POPULATION GENETICS OF THE ISLAND JERSEY CATTLE BREED: DATA, MANAGEMENT AND POLITICS MW Bruford1, GLH Alderson2 1 School of Biosciences, Cardiff University (BrufordMW@cf.ac.uk) 2 Rare Breeds International (lawrence@clltd.demon.co.uk) In 1999, with funding obtained from the UK Department of Environment, Food and Rural Affairs (then the Ministry of Agriculture, Fisheries and Food) we carried out a genetic survey of UK cattle and sheep breeds and develop new statistical approaches to analyse molecular data for rare and minority breed conservation. As part of this project a study was carried out by MWB, Lounès Chikhi, Benoit Goossens and Alan Treanor (Ministry of Agriculture, States of Jersey), to assess the genetic diversity and structure of the island Jersey cattle breed. We were ably assisted by the Royal Jersey Agricultural and Horticultural Society (RJA & HS) who allowed us to access many of the island’s herds to enable one of the first comprehensive studies of the genetic structure of a cattle breed across its entire native range. The Jersey had at that time become a popular breed across large parts of the world, but off‐island populations had substantially changed from the indigenous population on the island of Jersey, which had been isolated from any imports of cattle from the rest of the world, including England and France, since 1789. As geneticists, this study presented an excellent opportunity to examine the structure of an isolated, island breed, where we could rule out the effects of recent introgression from other breeds as a source of genetic variation. Furthermore unusually, very detailed pedigree records have been maintained for much of its history, potentially providing information of the breed’s dynamics and its changes over time and giving context to the results we would gain. We examined the genetic diversity and structure of the island Jersey, and compared our estimates to those obtained for other breeds at the time. We also hoped to examine a longstanding problem in livestock genetic diversity by addressing the effects of differing sampling design (across the entire island, within parishes, and farms) on estimates of genetic diversity. By doing so, we also tested for evidence of inbreeding (a perceived problem within the breed which previous pedigree‐ based studies had attempted to quantify) and assessed the correlation between genetic differentiation and geographic separation among parishes. We carried out microsatellite genotyping for 12 loci in 223 individuals representing all of Jersey’s parishes (church districts) except one. The results (reported in Chikhi et al 2004) were surprising. We found relatively high levels of genetic diversity across the island (HE = 0.64) a value that, at the time, was comparable to many continental breeds that had not undergone documented upgrading. Furthermore, although limited (and statistically significant, in some cases) genetic structure was detected among parishes and some farms, Bayesian partition analysis strongly supported the notion that the breed was a single genetic unit (Probability of K = 1 was 0.98). Finally, we could not detect evidence for inbreeding in the molecular data, and we inferred that gene‐flow across the island to have been sufficient to overcome local genetic drift in nearly all comparisons. In the context of discussions ongoing at the time, we concluded that the level of genetic diversity and its distribution within the island was substantial enough to provide the raw material for ongoing and future selection programs, including marker assisted selection, and concluded that it was therefore unnecessary to import unrelated genetic material to the island to mitigate against perceived low genetic variation. The genetic distinctiveness of the island Jersey breed had been demonstrated in several molecular studies (e.g. Wiener et al 2004) and there was evidence, including from molecular data (e.g. Hansen et al 2002) that this distinctiveness is less pronounced in Jersey cattle off‐island, which implied that introgression (upgrading) from other breeds has occurred at some time in the past. Further, selection regimes even in putatively non‐introgressed continental 20 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) populations are known to have differed substantially from on‐island management practices (particularly in terms of male effective population size). In 2007, the RJA & HS decided, however, to apply to remove the 1952 State legislation preventing the importation of cattle semen onto the island, following a vote where 79% of registered milk producers participating favoured the proposition (representing 62% of the total dairy farmers on the island). Scientific evidence in favour of commencing importation of semen centred around work carried out by Dr Maurice Bichard, which concluded that “the Island herd is some 15% to 20% behind the genetics of Jersey herds internationally in terms of average milk yields. It also demonstrates that genetic progress from 1988 to 2007 has been slow (0.6% per annum) principally because of the small cattle population and lack of uptake by producers. In addition …the effect of the dairy industry restructuring in 2002 which reduced the population (from 4,500 cows to 3,300) to a level where even genetic maintenance, because of inbreeding, may not be achievable in the medium to long term (cited in States of Jersey, 2008). Unsurprisingly, perhaps, the evidence from our study in 2004 was not cited in the applications since it indicated very low levels of inbreeding in the island Jersey population. However, it was also stated in the application that “To safeguard the pedigree of the Island breed the RJA&HS Council have resolved to only register the offspring of bulls with a pedigree that shows that all its forebears have a pure Jersey pedigree for at least 7 generations”. It is now a matter of historical record that the review of the Corporate Services Scrutiny Panel of the States of Jersey ruled in favour of removing the importation ban on 16th July 2008, paving the way for the subsequent importation of genetic material into this population, with the proviso that “the storage of a complete set of current local genetics off‐Island as a precursor to any importation” would be required. During the consultation process, along with other organisations, we were allowed to submit evidence from our study on the genetic diversity and inbreeding status of the island population. The transcripts from the review document affirm that some elements of inbreeding considerations were discussed. These specifically addressed the potential negative consequences of using a limited number of imported sires, and links to a study carried out by GLH in 2000 which showed that the list of active Jersey bulls on UK mainland has a strong North American influence; the North American population at the time being characterized by a small cohort of related dominant sires. However, our molecular data are not explicitly referred to in the transcript of the discussions on genetic diversity and how it may change as a consequence of the importation – in effect our results seem largely to have been overlooked or simply ignored. But how important are these considerations? It is without question that a strong majority of milk producers on the island placed a greater priority on the perceived rapid improvement of the breed over its genetic distinctiveness. It is also evidently the case that livestock production is first and foremost a business. The Unique Selling Point of Jersey cattle has traditionally been ‘Gold Top’ milk, the luxury creamy product that is still marketed with a strong regional focus today. Interestingly, the following statement can still be found on the marketing website for this product: “The Islands of both Jersey and Guernsey have, for decades, prohibited any other breed of cattle from their land to ensure that the blood line and off‐spring are kept pure. Channel Island milk is rich and creamy yet is still only 5% fat. It tastes delicious as a drink in its own right, and anything made with Channel Island milk also takes on this superiority.” (www.gold‐top.co.uk). It seems, therefore, that marketing of Jersey cattle products still values the distinctiveness of these island breeds, even in light of the decision of 2008, which, it could be argued, renders this marketing ploy obsolete. If one examines the implications of this dilemma in the context of global Farm Animal Genetic Resources (FAnGR) policy and recommendations and if, in particular, one examines the UK national report for the FAO’s State of the World’s Animal Genetic Resources in 2002, the following statements are to be found: Population Genetics Of The Island Jersey Cattle Breed: Data, Management And Politics 21 4.2.2 Distinctive breeds (designated D in Appendix 3) are important because distinctiveness is identified by FAO as a high priority criterion and because of its cultural interest. Native breeds at risk with special morphological characteristics, performance characteristics or great genetic distance should be identified and prioritised in conservation programmes. Such breeds are of particular interest under the Convention on Biological Diversity (CBD). Their genetic importance may justify incentive payments without the qualification of environmental factors, and they should have priority in characterisation studies. And in Recommendation 5.1.3.2: Breeds at Risk (Locally Adapted, Distinctive and Rare). National cooperation is recommended in the following areas: • Use of biological impact studies. Assessment of the possible effect of substitution of native AnGR by exotic breeds by the application of genetic (biological) impact studies (Rare Breeds International 2001) preceding importation, including the evaluation of incoming genetic material is considered advisable. The above definition and recommendation is broadly in line with FAnGR policy enacted by the FAO and many other countries in the context of conserving locally distinct genetic resources. In Appendix 3 of the UK Report, the Jersey (Island) breed is recorded as D (Distinctive) and L (Locally Adapted). It can, of course, be debated as to whether the evidence base for the breed designations used by the UK in the SOWAnGR Report are sufficiently robust to justify these designations and whether, by extension, what has occurred in Jersey contravenes these recommendations. It is also the case that the autonomy of the States of Jersey renders the applicability of these recommendations rather questionable. However, in our opinion, there is little doubt that the actions carried out in 2008 are contrary to the spirit of the UK report. At the very least, it we would argue that additional research on characterization of locally adapted traits should have been carried out prior to the importation of semen (following 4.2.2). In a sense, this example shows the need to demonstrate such local distinctiveness in a sound scientific manner, to provide evidence for or against actions such as occurred in 2008. In 2007 Rare Breeds International released the following policy statement on British cattle breeds: “Breeds and populations that are at risk are recognised by Rare Breeds International (RBI) through the application of three primary indicators, namely numerical scarcity, geographical concentration and genetic erosion. The severity of risk is categorised in three steps of Critical, Endangered and Vulnerable. A significant number of breeds or populations in Britain are at risk, but the exceptional importance of a few merits a high prioritisation for their conservation. The highest priority currently is placed on three cattle populations, namely Vaynol, Chillingham and Jersey (Island). Vaynol cattle are found only in one herd and have a breeding population of only one bull and circa twenty cows. The herd originated about 100 years ago. Chillingham cattle are a semi‐feral group found in one closed herd in Northumberland with a small reserve group in Scotland. The population has been closed since the eighteenth century and numbers less than 100 animals. Jersey (Island) cattle have been a closed population since the late nineteenth century, and are the source of all other Jersey populations. The priorities are to increase the numbers of Vaynol cattle and to protect the integrity and distinctiveness of the closed populations of Jersey (Island) and Chillingham cattle.” 22 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) While the Island Jersey cattle breed is not numerically scarce, the importation of semen and the inevitable change in the genetic structure of the breed on the island, may change its status in the medium‐term. There are many examples where introgression of genetic material from other populations or breeds has altered the status of a breed seemingly irretrievably (even in cases where original breed semen is available) and from our perspective, the potential irreversibility of the loss of distinctiveness of a population is a vital consideration. The production ethic that has driven, for example, the surge of the Holstein in locally adapted breeds across the globe has already changed the genetic landscape of the world’s domestic cattle in a potentially irreversible manner, and many local FAnGR is in danger of being lost as a consequence. It is our contention, therefore that while the decision to wed the Island Jersey to this process may seem attractive in the short term, but we would argue that I may prove counter‐productive in the medium term, and then it may be too late or be perceived as being too difficult to undo. REFERENCES 1. 2. 3. 4. 5. 6. Chikhi L, Goossens B, Treanor A, Bruford MW (2004) Population genetic structure of and inbreeding in an insular cattle breed, the Jersey, and its implications for genetic resource management. Heredity 92: 396‐401. Corporate Services Scrutiny Panel (2008) Review into the proposed importation of bovine semen. Report S.R. 10/2008. Defra (2002) UK Country Report on Farm Animal Genetic Resources 2002. http://www.defra.gov.uk/publications/2011/05/10/pb7959‐farm‐animal‐genetic‐resources‐2002/ Hansen C, Shrestha JNB, Parker RJ, Crow GH, McAlpine PJ, Derr JN (2002) Genetic diversity among Canadienne, Brown Swiss, Holstein, and Jersey cattle of Canada based on 15 bovine microsatellite markers. Genome 45: 897‐904. States of Jersey (2008) draft european communities legislation (implementation) (bovine semen) (jersey) regulations 200‐ Report lodged 14th March 2008. Wiener P, Burton D, Williams JL (2004) Breed relationships and definition in British cattle: a genetic analysis. Heredity 93: 597‐602. FARM ANIMAL GENETIC DIVERSITY AND CONSERVATION IN TURKIYE Prof. Dr. Mehmet ERTUĞRUL1, Prof. Dr. M. İhsan SOYSAL2, A. Oya AKIN3 1 2 Ankara University Agricultural Faculty Animal Science Department Namık Kemal University Agricultural Faculty Animal Science Department 3 General Directorates of Agricultural Research and Policy Summary Turkiye is one of the most significant countries in the world in terms of biological diversity and animal genetic resources. The rich genetic diversity of Anatolia results from the accumulated and blended genetic diversity of farm animals belongs to different cultures that lived and ruled in different times. Various environmental conditions that Anatolia’s wide geography holds the different needs and preference of livestock breeders also contribute to diversity of farm animal genetic resources. In recent years Turkey has been placing strong emphasis on management of farm animal genetic resources. Actually, almost all activities related conservation and sustainable utilization of the farm animal genetic resources are coordinated and supported financially and technically by the General Directorates of Agricultural Research and Policy (GDAR) on behalf of the Ministry of Food, Agriculture and Livestock. In this context, 13 sheep, 5 goat, 6 cattle, 1 water buffalo, 1 bee, 2 chicken breeds and 3 silkworm lines are conserved ex situ or in situ, on 6 different GDARP institutes, original breeding areas with small herds and 2 Gene Banks. On the other hand, community based improvement programme has been started since 2005, in order to enhance some of the production values of local sheep, goat and water buffalo breeds in their original rearing conditions. (18 sheep, 4 goat and 1 water buffalo breeds) Main objectives of the program are: to conserve farm animal genetic resources using current methods, to support sustainable utilization of farm animal genetic resources, to characterize our local breeds (genotypic and phenotypic), to build national researcher capacity, to combine and disseminate knowledge, to enhance public awareness. Keywords Conservation, sustainable utilization, farm animal genetic resources Introduction Anatolia or Asia Minor has attracted attention of humanity since ancient times and carried historical significance due to its unique location that connects two continents as a bridge, its climate that allows different seasons to be seen at the same time, natural diversity, and its geographical structure. The rich genetic diversity of Anatolia results from the accumulated and blended genetic diversity of farm animals belongs to different cultures that lived and ruled in different times. Various environmental conditions that Anatolia’s wide geography holds the different needs and preference of livestock breeders also contribute to diversity of farm animal genetic resources. Consequently, Anatolia possesses a rich collection which covers various genotypes. 24 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Anatolia has been sustained the collection by protection of animal husbandry until this century. At the beginning, increase in food demand parallel to the rising of human population was tried to meet by current genotypes and rising of animal number. Due to developments in economic, industrial, and social conditions, changes in preferences of consumption in the following periods, living in rural areas get difficult and migration to city centre have started number of young person in these populations has decreased. On the other hand because of increased number of animals in previous years lead to overgrazing and resulted disturbing of pastures. These areas which should be serving to animal production have been used for plant production or inactivated. For these reasons sustainability of traditional animal production, especially small ruminant production in major part of Anatolia has been affected negatively. This change caused dramatic decline of animal number and some genotypes to be endangered. Moreover, due to the seeking of more productive breeds by eligible livestock farmer’s to adapt their farm into the economically productive level, crossbreeding of current animal breeds with other randomly selected local or cultured breeds caused possible gene losses. This negative process especially occurs in sheep production sector also exhibits more pessimistic appearance in cattle production sector. Government applications via subsidies and incentives which aim to increase cattle population to enhance meat production encourage crossbreeding between local and cultured breeds. This result dramatic reduces of local cattle population and becoming extinction threshold of the cattle breeds. However this wide geography possesses variety of regions and locations that different ways of animal rearing is feasible or inevitable. In most of these regions, it is possible to raise local breed herds economically, increase livestock farmers’ welfare, and conserve genetic resources and traditional production culture. For that reason, it must be accepted that there is a need for improvement of regulations and policies which will help conservation and sustainable utilization of farm animal genetic resources and ensure using the gifts of nature via these animals. Thereby, it will be possible to provide food security for future generations’ needs by keeping the animal genetic material which will contribute resolving of current and potential problems. Considering the issues discussed so far, it can be deliberated that Turkiye’s genetic resources are in serious threats. However consciousness for conservation of genetic resources was established synchronized with the other countries and there significant steps were taken for conservation of both animal and plant genetic resources even though further progress is still needed. The first example of conservation of genetic resources in Turkiye was realized at the first quarter of the 20th century by Turkish scientist Mirza Gökgöl. In his study, thousands of wheat samples were collected all around of Turkiye, over 18.000 different types was characterized and 256 wheat varieties among them was determined (Karagöz et al 2010). This study which can be accepted as the beginning of the efforts on conservation of plant genetic resources had been executed concurrently with argues on necessity of conservation of world’s plant genetic resources. Conservation of animal genetic resources has been mentioned firstly in a symposium arranged at 1959 in USA. Following this communications which emphasis importance of issue has been started presenting, sequentially in various scientific meetings. These excitations and increased social consciousness on conservation of environment caused speed up studies in animal genetic resources and FAO and UNEP published their first collective study named as “Conservation of animal genetic resources” in 1970. Turkish Republic have interested in firstly by attending to a meeting with a delegate in 1980 at July in Rome. Almost at the same years has been called attention to the subject by preparing communications, thesis, and seminar in various faculties in the country. After that ‘Farm Animal Genetic Resources Conservation Project’ has been prepared by Ankara University Agricultural Faculty Animal Science Department and submitted to the General Directorates of Agricultural Research and well accepted in the beginning of the 1990s. Project has been started with the conservation of 4 cattle breed which had a high risk of extinction. In the following period Farm Animal Genetic Diversity and Conservation in Turkiye 25 while the number of animal species and breeds were increasing, all conservation methods both in situ and ex situ were implemented. Following parts of the article, the activities and the process on conservation of animal genetic resources in Turkiye were outlined briefly. National Focal Point of AnGR The National Focal Point consists of two committees called ‘National Consultative Committee on Animal Genetic Resources Conservation’ (NCC‐AnGR Conservation) and ‘Animal Breed Registration Committee’ and the National Coordinator. These committees were established according to ‘Veterinary Services, Plant Health, Food and Feed Act.’ Two regulations were published named ‘Animal Genetic Resources Conservation Regulation’ and ‘Animal Breed Registration Regulation’ in 2002. The NCC‐AnGR Conservation has members from relevant ministries, universities, trade associations and NGOs, and its principal role is to provide advice to Government and interested parties on issues relating to farm animal genetic resources inventory, characterization, conservation and sustainable utilization. The activities concerning characterisation, conservation, collection and utilisation of the farm animal genetic resources are undertaken in close collaboration with the Agricultural and Veterinary Faculties of the country, The Scientific and Technological Research Council of Turkey (TÜBİTAK), breeders’ associations and farmers. The program is focused mainly on scientific advancements, but it is also providing some data for policy makers of the Ministry to use particularly in regulation and supporting of animal genetic resources conservation and sustainable utilization in Turkey. In this context 13 sheep, 5 goat, 6 cattle, 1 water buffalo, 1 bee, 2 chicken breeds and 3 silkworm lines are conserved ex situ or in situ, on 6 different GDARP institutes, original breeding areas with small herds and 2 Gene Banks. Farm Animal Genetic Resources Conservation Project Farm Animal Genetic Resources Conservation Project has been started in 1995 with some of the native cattle breeds at risk of extinction. Sub projects are carried out by General Directorate of Agricultural Research (GDAR) in order to conserve and characterize the domestic animal breeds. The projects include conservation and identification (either phenotypic or genotypic) of 4 sheep, 4 cattle, 1 water buffalo, 1 goat, 1 bee and 2 chicken breeds and 3 silkworm lines in 6 institutes of GDAR. Conservation and Pre‐Molecular Identification of Some of the Native Domestic Animal Genetic Resources of Turkey‐ I The cryo‐conservation project which is named ‘Conservation and Pre‐Molecular Identification of Some of the Native Domestic Animal Genetic Resources of Turkey‐ I’ (TURKHAYGEN‐I) started in March 2007. This project aims to establish gene banks to conserve national animal genetic resources, to characterize our local breeds, to build national researcher capacity in animal genetics and animal biotechnology, and to combine and disseminate knowledge. The Project’s live animal material collection and DNA isolation, semen and embryo freezing for most of the breeds are completed. In situ Conservation Programme Furthermore, to encourage local farmers in community based conservation and improvement programs some incentives have paid per animal. There are two types of subsidy, one for in situ conservation of local cattle, water buffalo, sheep and goat breeds, and the other for the improvement of sheep, goats and water buffalo in breeders’ condition. In the frame of the programme some local breeds conserved in their original breeding areas; 26 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Cattle; Native Black (Yerli Kara), Anatolian Grey (Boz Irk), South Anatolian Red (Kilis), East Anatolian Red (Doğu Anadolu Kırmızısı), Native Southern Yellow (Yerli Güney Sarısı), Zavot Buffalo; Anatolian Water Buffalo (Anadolu Mandası) Sheep; Kivircik, Sakiz, Karagul, Herik, Cine Capari, Hemsin, Norduz, Daglic Goat; Angora Goat (Ankara Keçisi), Kilis, Norduz and Honamli This year was the sixth year of that kind of subsidy and the subsidy payment has been very attractive for the local farmers especially farming in remote areas (Table.1). Table.1 AnGR Subsidy payment (per head/ euro) on Community Based Programme Programme Species In situ Conservation Improvement Cattle 170 ‐ Water buffalo 170 215 Sheep 30 17 Goats 30 17 There are two types of subsidy, one for in situ conservation of local cattle, water buffalo, sheep and goat breeds, and the other for the improvement. Pure breeding and selection have been used in the extent of the small ruminant and water buffalo improvement projects, which covers approximately 6.500 head in each breed populations (18 sheep, 4 goat and 1 water buffalo breeds). There is no detailed information about current number and population distribution of farm animal breeds, which is necessary for future planning of AnGR conservation and sustainable utilization. Breed inventory will help prioritization of conservation activities and policy requirements. Management of the research process and administrative procedures of the conservation program The programme is considered as a medium‐high priority in Research Master Plan of GDARP for 2006‐2010 periods. Like other research programs under the coordination of GDARP, priority research topics are outlined in Research Master Plan. Relevant scientists prepare proposals according to these prioritised topics and submit to the management of their institute. The first step for the evaluation of the project proposals is Institute Research Committee; second step is Program Evaluation Meeting. There is a special Program Evaluation Group for Biodiversity and Genetic Resources Researches, and holds meeting every year to discuss research projects submitted after evaluation by Institute Research Committees. The final scientific authority of evaluation is related Research Scientific Committee (RSC) which is located at the headquarters of GDAR. The approved projects are subject to monitoring and evaluation process until finalized. Knowledge dissemination of this program is being carried out through web sites of GDAR and research institutes, Ministry publications, provincial extension services, training of trainers, demonstration activities, and using mass media opportunities (documentary films, TV and radio interviews, periodicals). Breed Registration Animal breed registration is performed in a different way than conducted in other countries. Local and improved animal breed, type and lines of Turkey are registered by Animal Breed Registration Committee. The Committee holds one annual meeting and overviews a submitted animal registration form and decides its approval or denial. The Animal Breed Registration List includes morphologic, physiologic, genetic and other characteristics of the breed to be registered and it has been prepared based on scientific data. Farm Animal Genetic Diversity and Conservation in Turkiye 27 Current Legislation: Veterinary Services, Plant Health, Food and Feed Act Animal Breed Registration Regulation Secretariat: General Directorates of Agricultural Research and Policy Committees and Working Groups: Animal Breed Registration Committee Animal Breed Registration Sub‐Committees Working Groups Registered Local Breeds 2004 : Anatolian Black Cattle (Yerli Kara), Anatolian Red Cattle (Kilis), Native Southern Yellow Cattle (Yerli Güney Sarısı), Turkish Grey Cattle (Boz Irk), Eastern Anatolian Red Cattle (Doğu Anadolu Kırmızısı); Anatolian Water Buffalo (Anadolu Mandası); Awassi (Ivesi) Sheep, Sakiz Sheep, Gokceada Sheep, Karacabey Merino Sheep, Daglic Sheep, Red Karaman (Mor Karaman) Sheep, Tushin (Tuj) Sheep, Norduz Sheep; Angora (Ankara) Goat, Hair (Kılkeçi) Goat, Norduz Goat; Angora Rabbit; Local silkworm lines (Bursa Beyazı, Bursa Alaca, Hatay Sarisi); Caucasian (Kafkas) Bee. 2005 : Kivircik Sheep, Akkaraman Sheep, Karayaka Sheep; Kilis Goat; Kangal Dog; Turkish Van Cat. 2006 : Malya Sheep; Akbas Dog. 2007 : Anatolian Merino Sheep, Central Anatolian Merino Sheep. 2008 : Cine Capari Sheep, Angora Cat. 2009 : Acipayam Sheep, Sonmez Sheep. 2010 : Polatli Sheep, Bafra Sheep, Bursa Roller Pigeon. Animal Recording System Eartags individually identify animals and allow identification‐registration, monitor animal movements as well. Current Legislation: ‐ Regulation on the Identification, Registration and Monitoring of Bovine Animals ‐ Regulation on the Identification, Registration and Monitoring of Small Ruminant Animals Secretariat: General Directorates of Food and Control ‐ Bovine recording system executing since 2002 ‐ Sheep and goat recording system preparations completed. National Priorities for Conservation and Sustainable Utilization of Farm AnGR The main priority for Turkey is establishment of a national management system for AnGR. Development of a National Strategy and Action Plan (NAP) which aims to outline actions for the sustainable utilization and conservation of farm animal breeds has a great importance. Comprehensive inventory needed to characterize and evaluate the diversity of AnGR in different agro‐ecological zones and different management conditions. Due to changing rearing and climate conditions, sustainable breeding programmes are necessary to reach the food security goals. Strengthening policy, institutional structures, legal and regulatory frameworks will be a crucial impact on the sustainable use and conservation of AnGR. 28 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) National priorities for each of the 4 strategic priorities of the Global Plan of Action for Animal Genetic Resources are: 1 Characterization, inventory and monitoring of trends and associated risks: • Taking urgent measures to complete the AnGR inventory which covers all aspects of the livestock sector, • Enhancement the number of morphologic, physiologic and genetic characterization projects of farm animal breeds, • Strengthen the animal recording systems. 2. Sustainable use and development: • Improvement of feeding and management conditions in conjunction with genetic improvement of the breeds, • Consideration of geographical, climatic, socio‐economic, cultural and breed diversity of regions while conducting animal breeding programs, • Support to use special products of local breeds • Execution of breeding programmes for low input breeding systems 3. Conservation: • Expedition and diversification of the current activities on conservation of domestic AnGR • Until detailed information available on risk status, conservation of almost all local breeds both in situ and ex situ methods, • Maintenance conservation studies and including some more breeds, • Duplication of the conservation herds and enhancement of the population sizes in order to eliminate possible health, natural disaster or economic risks which may force the breeders giving up the breeding activities 4. Policies, institutions and capacity building: • Establishment of an influential collaboration among the research programs, carried out by various institutions and universities, • Further development of effective legal and organizational framework for the management of AnGR, • Establishment of breeders organizations and niche market systems, • Improvement of public awareness on AnGR conservation and sustainable utilization via documentary films and booklets of local breeds, TV and radio interviews. REFERENCES Akın, O. 2007. Evcil Hayvan Genetik Kaynaklarını Koruma Projesi. Türk Tarım Dergisi, 173, 35‐37 Düzgüneş, O. 1987. Türkiye’nin Biyolojik Zenginlikleri ‐ Hayvancılıkta Genetik Kaynaklar. Türkiye Çevre Sorunları Vakfı Yayınları, 316 s, 41‐66. Ankara Ertuğrul, M., Dellal, G., Elmacı, C., Akın, A. O., Pehlivan, E., Soysal, M. İ. ve Arat, S. 2010. Çiftlik Hayvanları Genetik Kaynaklarının Koruması ve Sürdürülebilir Kullanımı. Türkiye Ziraat Mühendisleri Odası VII. Teknik Kongresi. 11‐15 Ocak, 2010, 179‐198. Karagöz, A., Zencirci, N., Tan, A., Taşkın, T., Köksel, H., Sürek, M., Toker, C. ve Özbek, K. 2010. Bitki Genetik Kaynaklarının Koruması ve Kullanımı. Türkiye Ziraat Mühendisleri Odası VII. Teknik Kongresi. 11‐15 Ocak, 2010, 155‐177. CRYOPRESERVATION STRATEGIES FOR FARM ANIMAL GENETIC RESOURCES IN EUROPE S.J. HIEMSTRA 1 * 1 Centre for Genetic Resources, the Netherlands (CGN), Wageningen University and Research Centre, P.O. Box 65, 8200 AB Lelystad, the Netherlands * Corresponding author: sipkejoost.hiemstra@wur.nl Abstract European countries have developed national strategies and action plans implementing the Global Plan of Action for animal genetic resources. National action plans include development and implementation of cryopreservation strategies for animal genetic resources. Although some cross‐ border collaboration exists in Europe, cryopreservation programmes are national responsibilities and generally organised at the national level. National cryopreservation programs have different specific objectives and involvement of stakeholders and institutions varies. National experts indicate that there is a need for further development of national frameworks for cryopreservation and for exchange of state of the art knowledge and experiences between countries. The aim of the European Regional Focal Point is to support development of national conservation programmes and to enhance stronger international collaboration through development of a European cryopreservation strategy. Keywords: Cryopreservation, European collaboration, animal genetic resources, local breeds Introduction In 2007, the international community has adopted the Global Plan of Action for Animal Genetic Resources (FAO, 2007b). European countries are currently implementing the Global Plan. Already since the 1970s and 1980s many European countries have been paying attention to local breeds and have saved many of them from total extinction and contributed actively to assessing the State of the World’s Animal Genetic Resources (FAO, 2007a). European countries are individually and in collaboration carrying out active work on animal genetic resources (Mäki‐Tanila and Hiemstra, 2010). During the 2nd half of the 20th century, specialized livestock breeds were developed in Europe. High‐input high‐output breeds and the associated (intensive) production systems were widely promoted and distributed within and outside Europe. At the same time population sizes of many native breeds have decreased dramatically. About 30% of the European breeds are reported “at risk” (FAO, 2007a). Although there are still threats to native breeds in Europe, luckily most of the breeds survived. There has been growing awareness about the values of native breeds among a variety of stakeholders, that is also reflected in promoting conservation and sustainable use of genetic resources in EU and national policies. In situ conservation is often regarded as the preferred conservation method for maintaining variation in local breeds, because it ensures that a breed is maintained in a dynamic state. This may be true when the dynamics of a breed are characterized by slow and balanced adaptation to (changing) conditions, but reality is different. Many factors can positively or negatively influence breed dynamics (Hiemstra et al., 2010). When in situ conservation programmes are not properly planned, breeds may be threatened. Therefore both medium and long term conservation of livestock genetic diversity will greatly benefit from a complementary cryopreservation (ex situ) strategy. Cryopreservation is the collection and deep‐freezing of semen, ova, embryos or tissues which may be used for future breeding or regenerating animals (FAO, 2010). Cryopreservation of germplasm is not only a very useful tool to maintain genetic diversity within breeds and to support the genetic 30 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) management of breeds, but also, in the worst case, the cryopreserved germplasm could be used to re‐establish a breed or population. European countries have developed national strategies and action plans to implement the Global Plan of Action for Animal Genetic Resources (FAO, 2007b). Strategies Priority area three of the Global Plan of Action (“Conservation”) includes an ex situ conservation component in order to preserve genetic diversity and integrity for the benefit of current and future generations. In many countries gene bank collections have been established, however national programmes are quite different in terms of stakeholder involvement and institutional framework (e.g. Pizzi et al., 2010). The aim of this paper is to discuss the main issues for further development of cryopreservation strategies in Europe and to describe the current state of cryopreservation and recent initiatives. State of cryopreservation in Europe According to the State of the World’s Animal Genetic Resources report (FAO, 2007a) most in vitro conservation programmes in Europe are found in the western and central part of the region. Several gene banks were recently founded and there is a need for further development. In many cases cryopreservation is restricted to the storage of semen from a limited number of breeds. A few countries have gene banks preserving semen of all main species. The report also mentioned that – despite the presence of rich AnGR diversity in combination with real threats (such as political instability) ‐ in vitro conservation programmes are largely absent in the eastern parts of the European region. Furthermore, ownership and access, information and documentation, optimization of the core collection and the ratio between gametes and embryos were mentioned as imported issues for further development. More recently, FAO implemented a survey (Boettcher and Akin, 2010), including various matters related to AnGR conservation, including multinational gene banks. Results of the survey show that many countries practise AnGR conservation, with in situ programmes being the most common. The number of cryoconservation programmes was about half the number of in situ programmes for most livestock species. Fully operational gene banks were reported in about 20 percent of the countries, and plans for a gene bank within 5 years were indicated in an additional 50 percent of the countries. Lack of financial support and low priority in national livestock policy were the most commonly cited obstacles for gene banking. Comparing different regions, this survey indicated that cryoconservation programmes are most common in North America, followed by Europe, and then Asia, the Near East, Africa and Latin America. In addition to other comparisons of national cryopreservation programmes (e.g. Blackburn, 2004; Danchin Burge et al., 2006; Danchin‐Burge et al., 2011), a detailed survey was carried out within the European Commission co‐funded project EURECA (www.regionalcattlebreeds.eu) to compare cryopreservation activities and policies for cattle breeds in Finland, France, Italy and the Netherlands. The purpose of the survey was to detect similarities and differences between these four countries, to compare the countries’ strategies and with the international Guidelines, and to formulate recommendations for initiating or strengthening cryopreservation programmes (Pizzi et al. (2010). Pizzi et al. (2010) showed that although overall objectives were rather similar for the four European national cryopreservation programmes studied, the programmes have developed differently. In particular the institutional framework and stakeholders responsibilities and involvement are different. All countries expressed the need for national or public funding for national cryopreservation programmes with long term objectives. However, the close involvement of breeders of local breeds, breed associations and AI centres in linking the cryopreservation schemes with routine AI operations was considered as the most important factor for the development of efficient cryopreservation programmes. Cryopreservation Strategies For Farm Animal Genetic Resources In Europe 31 The most commonly cryopreserved genetic material of European local cattle breeds in the four countries is semen (Pizzi et al., 2010). Another European wide survey (Hiemstra et al. 2010) also showed that for 93 out of 108 breeds only semen is stored, whereas only in 26 out of 108 breed both semen and embryos are stored. Sampling strategies and selection of donors vary between the four countries surveyed by Pizzi et al. (2010). Two main sampling strategies were observed: 1) few bulls with many doses are stored, and 2) semen of as many bulls, but fewer straws is collected. For example, in the Netherlands and Italy, the majority of bulls have less than 200 doses stored as genetic reserve. Conversely, in France and Finland, almost 50% of the bulls have more than 1000 doses collected. In France, Finland and the Netherlands, almost a quarter of the bulls stored were born before 1980, which is an important genetic reserve for the particular breeds. Depending on the national veterinary regulations, semen for the national gene banks has been collected on AI centres with high veterinary standards, but there is also semen collection for the gene bank “on farm”. Furthermore, experts involved in the cryopreservation programmes of Finland, France, Italy and the Netherlands were asked to identify and rank the key factors affecting the state of AnGR cryopreservation in their country. Internal factors (Strengths and Weaknesses) and external factors (Opportunities and Threats) were identified and used to assess the national situation regarding cryopreservation and to identify and design new or better policies at national or European levels. Pizzi et al. (2010) and Hiemstra et al. (2010) finally concluded that there is a need for countries to (further) develop and implement national regulatory frameworks for cryopreservation. European Regional Focal Point The main responsibility for implementing the Global Plan of Action rests with national governments. The implementation of the GPA by individual countries is facilitated by, and benefits from, the existence of international networks of NCs. Regional Focal Points, such as the European Regional Focal Point for Animal Genetic Resources (ERFP) play a vital and important role in building collaborative partnerships, in coordinating regional management efforts in animal genetic resources, in further developing information sharing and enhancing technical cooperation, training and research (www.rfp‐europe.org). The ERFP was initiated in 1998 and became formally operational in 2001 as the European part of FAO's global coordination structure for animal genetic resources. Over the years, the collaboration and coordination facilitated by the ERFP in Europe has developed successfully. In 2010 the General Assembly of the ERFP adopted a new Multi Year Programme of Work (MYPOW) for the period 2010‐2014. ERFP has also established close working relationship with international NGOs such as Rare Breeds International (RBI), The SAVE Foundation (Safeguard for Agricultural Varieties in Europe), Danubian Alliance for Conservation of Genes in Animal Species (DAGENE) or the European Forum of Farm Animal Breeding (EFFAB). For all the scientific aspects, it receives help from the European Association of Animal Production Working Group on Animal Genetic Resources (EAAP WG‐AGR). The ERFP does not create new structures but relies as far as possible on existing functional structures in the different countries. Among other objectives the ERFP aims to support the in situ and ex situ conservation and sustainable use of AnGR in European countries. The ERFP works with existing operational structures in countries and seeks partnerships and collaboration with existing organisations. Already in 2003 ERFP published Guidelines for the Constitution of National Cryopreservation Programmes for Farm Animals (ERFP, 2003) and organised a workshop on this topic (Planchenault, 2003). The ERFP also significantly supported the development, review, testing and validations of the Draft Technical FAO Guidelines for the Cryoconservation of AnGR (FAO, 2010) through various workshops involving more than 120 scientists, technicians and decision makers. 32 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Working Group Ex Situ Conservation of ERFP The Assembly of National Coordinators of the ERFP established several Working Groups and Task Forces (www.rfp‐europe.org). The Ex Situ Conservation Working Group is one of the ERFP Working Groups that works on a permanent basis on long term tasks. Members of the Working Group are experts in the respective task and are nominated by their National Coordinator. The general aim of the Working Group is to regularly exchange experiences and knowledge between European countries in order to support the establishment, further development, efficiency and effectivity of national gene banks for farm animal genetic resources. For the period 2011‐2013 the Ex Situ Working Group of ERFP identified a number of high piority topics for the next two or three years, including i) prioritization – genetic aspects, ii) development of national legal and institutional frameworks, iii) maintenance and development of the CryoWeb database, and iv) development of a European gene bank strategy vision paper. To further develop national gene banks, there is a need to further exchange experience and knowledge between European countries. Moreover, the ERFP will initiate further discussions about a European strategy or European vision on ex situ conservation of farm animal genetic resources. Prioritization and sampling strategies In order to capture maximum genetic diversity in a gene bank, and because of limited availability of funding, prioritization of breeds, animals and type of germplasm/tissue for conservation will remain a relevant issue. Availability of new technologies (e.g. genomics, cryobiology, reproductive technology) may affect prioritization and sampling strategies. There is for example a need to further improve methods for prioritisation for conservation that take account of new genomic measurement and simultaneously exploit phenotypic, farming‐system, socio‐economic and geographic information. National cryopreservation programmes should use and implement state of the art knowledge and best practices for the selection of donor animals for conservation and to decide about the type of genetic material (semen, embryo, oocyte, tissue) to be stored. According to the ERFP and FAO Guidelines (ERFP, 2003; FAO, 2010), one common purpose of a germplasm repository is to provide the possibility of recreating breeds or breeding lines in case they are lost as a consequence of a calamity. Storage of germplasm for this purpose would typically be long‐term storage, without frequent use of the stored material and without the need of regular updating of the collection. A second way to make use of gene bank resources is to support in vivo conservation. Additionally, gene bank resources may be used as a back‐up in case genetic problems occur. Finally, gene banks can serve as the primary source of material for national scientists performing DNA research. The last decades have seen increasing possibilities for gene banking as a result of advances in cryobiology and reproductive technology. Semen and embryos can be obtained, cryopreserved, and used for most species of farm animals. Although embryos have an advantage over semen in breed reconstitution, cryopreservation of embryos has been limited to a smaller number of farm animal species. An advantage of cryopreservation of oocytes over embryos is that through in vitro fertilization (IVF) desired matings can be selected at the time of thawing, rather than at the time of freezing. However techniques for freezing and thawing of oocytes still require more development. The banking of somatic cells on the other hand requires only the collection and direct freezing of a piece of tissue. This would become an attractive strategy for cryoconservation of AnGR, if production of live animals from somatic cells through Somatic Cell Nuclear Transfer (SCNT) becomes efficient, safe, reliable and ethically acceptable. Future prospects for cryoconservation may benefit from breakthroughs in cryopreservation and generation of offspring from cryopreserved i) (parts of) ovaries, ii) Embryonic Stem Cells (ESC), iii) spermatogonial cells, iv) primordial germ cells or v) through parthenogenetic embryo production. Cryopreservation Strategies For Farm Animal Genetic Resources In Europe 33 Legal framework As said before, national cryopreservation programmes vary in institutional and legal frameworks. No single particular system of organization and institutions will be ideal for all situations and countries. The optimal system will depend on a wide variety of factors, including the types of existing infrastructure and related institutions, technical capacity of personnel, species of interest, stakeholders, and level of government versus private support. According to the FAO Guidelines on Cryoconservation (FAO, 2010), evaluation of the major institutions and stakeholders, their goals and their capacity to contribute to conservation programmes will be an essential step in the initial phases of the development cryoconservation strategies. Establishment of linkages among institutions will be critical to maximize efficiency. Collaboration with breed societies, the private sector and individual owners of breeding animals is crucial. Collaboration with artificial insemination (AI) centres for example is usually highly beneficial, whereas these centres will have both the technical capacity and the infrastructure for collection, freezing and storage of germplasm. Breed associations such as co‐ operative breeding and herd‐book associations may see it as their responsibility to maintain breeds. As an organization they are clearly interested in the long‐term well‐being of the breeds and may organize and financially support cryoconservation activities. The Ex Situ Working Group of ERFP noted that many countries want to further develop or refine their national legal and policy framework for cryopreservation activities. There are already substantial gene bank collections (at different sites) but a clear legal framework is often lacking. Members of the Working Group indicated that exchange of experiences, legal framework documentation, protocols, contracts, access rules and other information would be very helpful. Maintenance and development of the CryoWeb database Proper documentation of gene bank collections is crucial for the management of gene bank collections. Cofunded by the European Commission, the database tool CryoWeb was developed and implemented. For maintenance and further development of the CryoWeb database tool it is important to establish a CryoWeb user group and to link national databases at European level. Development of a European gene bank strategy for AnGR In the State of the World’s AnGR report (FAO, 2007a) it was recommended that all countries should have their own or shared gene banks that contain cryopreserved material of their locally developed breeds and lines. Because many transboundary breeds exist, coordination between countries is required. Cooperation would be facilitated if national and regional gene banks operate under internationally agreed protocols Hiemstra et al. (2010) recommended that countries should (further) develop cryopreservation activities within the framework of a national programme for AnGR. Besides the use of national cryopreserved stocks to support genetic management of local breeds, transnational cooperation should be encouraged to avoid duplicates in long‐term cryoreserve of transboundary breeds and in order to make optimal use of limited funds. Boettcher and Akin (2010) reported that very few multinational gene banks exist, but interest in such activities was high. Aversion to multi‐country gene banks was noted in only about 10 percent of countries. Among the factors contributing to the paucity of multi‐country AnGR gene banks are a lack of funding, regulations on international exchange of genetic material and a lack of consensus on procedures for the operation of gene banks. Relative to other regions, the greatest level of willingness and capacity to collect germplasm for multinational gene bank purposes was found in Europe. 34 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Where plant genetic resources conservation is strongly dependent of a multi‐lateral system of international seed banks (including a security back up at Svalbaard repository), such a framework for international collaboration in conservation for animal genetic resources, does not exist. However, in order to increase cost‐efficiency and to reduce duplications between national European gene bank, there may also be a clear advantage in organising conservation of AnGR across countries in Europe (and possibly other regions). Danchin‐Burge et al. (2011) compared for example French, Dutch and US Holstein Friesian semen collections. They first concluded that the national cryobanks captured substantial amounts of genetic diversity, compared with the current population, and the comparison showed to what extent the US, French and Dutch collections were genetically similar. It is important to further elaborate collaboration models and institutional arrangements between countries, regions and stakeholders. In particular cryopreservation programmes and conservation of transboundary breeds may require new funding mechanisms and/or institutional arrangements. When designing programs for conservation of animal genetic diversity, not only technical criteria are relevant, but also legal, sanitary, socio‐economic and institutional issues. In this context a range of future use options (e.g. research, breeding, etc.) should be considered as part of the development of collaborative models between countries. REFERENCES Blackburn, H., 2004. Development of national animal genetic resource programs. Reprod. Fertil. Dev. 16:27‐32. Boettcher, P.J. and Akin, O., 2010. Current arrangements for national and regional conservation of animal genetic resources. Animal Genetic Resources, 2010, 47, 73–83. Danchin‐Burge, C., Verrier, E., Moureaux, S. and Tixier‐Boichard, M., 2006. Sampling protocols and review of the French National Cryobank collections. Commun. 33‐3 in Proc. 8th World Congr. Genet. Appl. Livest. Prod., Belo Horizonte MG, Brazil. Danchin‐Burge, C., Hiemstra, S.J. and Blackburn, H., 2011. Ex situ conservation of Holstein‐Friesian cattle: Comparing the Dutch, French and US germplasm collections. J. Dairy Sci. 94: 4100‐4108. ERFP, 2003. Guidelines for the Constitution of National Cryopreservation Programmes for Farm Animals. Publication No. 1 of the European Regional Focal Point on Animal Genetic Resources. Hiemstra, S.J. (editor). ERFP, 2011. European Regional Focal Point for Animal Genetic Resources. www.rfp‐europe.org. Website last visited 10 August 2011. FAO, 2007a. The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by Barbara Rischkowsky & Dafydd Pilling, Rome. FAO, 2007b. The Global Plan of Action for Animal Genetic Resources. FAO, 2010. Draft Guidelines for the Cryoconservation of Animal Genetic Resources. CGRFA‐13/11/Inf.21. Hiemstra, S.J., de Haas, Y., Mäki‐Tanila, A. and Gandini, G., 2010. Local cattle breeds in Europe – Development of policies and strategies for self‐sustaining breeds. ISBN 978‐90‐8686‐144‐6. Mäki‐Tanila, A. and Hiemstra, S.J. 2010. Regional issues on animal genetic resources: trends, policies and networking in Europe. Animal Genetic Resources, 2010, 47, 125‐136. Pizzi, F., Duclos, D., Woelders, H. and Mäki‐Tanila, A. , 2010.. Role and state of cryopreservation in local cattle breeds. In: Hiemstra, S.J., de Haas, Y., Mäki‐Tanila, A. and Gandini, G., 2010. Local cattle breeds in Europe – Development of policies and strategies for self‐sustaining breeds. ISBN 978‐90‐8686‐144‐6. Planchenault, D., 2003. Proceedings of the Workshop on Cryopreservation of Animal Genetic Resources in Europe. Paris, February 23rd, 2003. Salon International de l’Agriculture. RARE NATIVE DAIRY CATTLE BREEDS: QUO VADIS? E. MARTYNIUK1,3*, N. SAETHER2 and J. KRUPINSKI1 1 National Research Institute of Animal Production, ul Wspolna 30, 00‐ 930 Warszawa, Poland 2 Norwegian Genetic Resources Centre, Pb 115, NO‐1431 Ås, Norway; 3 Department of Genetics and Animal Breeding, WULS, ul Ciszewskiego 8, 02‐786 Warszawa, Poland * Corresponding author: elzbieta_martyniuk@sggw.pl Abstract Some native endangered European cattle breeds traditionally used as dairy or dual purpose breeds are no longer considered attractive for milk production. The lack of interest of farmers to continue milking these traditional dairy breeds is affected by a number of different factors. The key ones include low economic efficiency and profitability (high labour requirements not justified by relatively low production level and small herd size), husbandry conditions (extensive production system or summer grazing that makes milking more challenging, difficult and expensive) and social factors (alternative livelihoods opportunities or ageing of traditional dairy farmers). What are the options to ensure continued utilisation of traditional breeds? What are the options if the population size of a breed is too small to develop unique products with added market value that will make up for the lower milk performance and ensure profitability? What are the consequences of movement from dairy utilisation toward beef production and the use of these breeds in suckling systems? What will be the product in such production system ‐ high quality beef and / or grazing services? Is the introduction of suckling system a threat to the traditional dairy traits in these breeds? These questions are addressed in this paper using examples of native endangered Norwegian and Austrian breeds, and the situation regarding Polish Red cattle. The possible impacts of alternative scenarios have been considered based on decision options regarding utilisation of rare dairy breeds, looking from the perspective of a farmer, as well as consideration given to the animals and the environment. Keywords: dual purpose native cattle breeds, utilisation, conservation programmes 1. Introduction As of 30th July, the DAD‐IS breed database contained information on 948 cattle populations kept in Europe (http://dad.fao.org/). These records cover 437 local breeds that are present in one country only, 27 regional breeds and 71 international breeds. Within reported local breeds 122 are already extinct, 59 are classified as critical, 90 as endangered, and 43 have unknown risk status. Only 123 breeds are not at risk of extinction, which means that their population size is higher than 1000 females or 20 males. The numbers above indicate that that majority of local breeds are rare due to small population size, and endangered due to the risk of their extinction (FAO, 2007). Most rare cattle breeds are included in conservation programmes with the aim to maintain or increase population size and to manage within population genetic variability. However, the long term survival of local cattle breeds in production systems is largely the responsibility of farmers and their willingness to keep these breeds, which is related to the breed profitability. The most successful way to conserve a breed is to ensure valorization of food products associated with a particular breed (Verrier et al., 2005), or by creating links between breed and specific landscapes, an extensive farming system, or the use of the breed for hobby activities, etc. (Lauvie et al, 2011). Taking into account their cultural value (Gandini and Villa, 2003), rare breeds can 36 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) be also important in the wider sense, as resource for local livestock production and local development. Therefore, the future of the rare European local cattle breeds is not only of concern to farmers, breeders and the research community, it will also be of general public interest and concern, as awareness of environmental, social, cultural and public values of breeds is enhanced. The historical development of many native cattle breeds resulted in their dual utilisation, firstly to supply local people with milk, and also to provide beef and veal. In many circumstances, such breeds were kept in extensive pastures and remote outlying grazing areas. Some geographically confined local breeds were also used to provide draught power for crop production. Over time, the dairy performance of the dual purpose breeds lagged behind dedicated dairy breeds that were subject to intensive selection toward enhanced milk yield and milk content. The second limiting factor was production systems that offered modest or even difficult husbandry conditions with limited provision of high quantity and quality fodder. In spite of a long tradition of milk utilisation and high milk quality produced from species‐rich semi‐natural grasslands and pastures, some breeders are questioning if this is the best approach to maintain rare native breeds. If milk production is not economically viable, are there other options that would support continuous utilisation of such breeds? The obvious solution would be to turn towards beef production and use cows of these breeds in a less labour demanding suckling system. This approach would allow the continued utilisation of breeds and maintain their role in providing environmental services. However, to date, opinions on a path forward for the appropriate transformation of breed profiles are diverse. For some breeders, the way to continue using a breed at their farm is to maintain the breed within a suckling system. Such farmers also advocate for allowing part of the population to be used and selected for beef production. For others breeders and scientists, this approach is controversial, especially if the breed is rare and included in official conservation programme, as they find it hard to support a practise that will create a sub population of an already threatened breed. An other argument might be that they believe that a dual purpose breed should be milked. In this paper, we examine this issue, and consider the pros and cons for changing the profile of the breed or allowing a breed population to develop in two directions. While this it is occurring in a number of breeds, there is still strong opposition to this approach, and therefore discussion on this subject is appropriate and timely. 2. Case studies In Norway, the process of using dual purpose cattle solely for beef production is underway, as presented at Table 1. Out of over 3197 cows of native breeds, registered in herdbooks in 2010, over 50% are kept within a suckling system. Table 1. Utilisation of native dual‐purpose Norwegian cattle breeds (Norwegian Genetic Resources Centre, 2011) Endangered breed native to Norway No of cows in herdbooks No of cows under the suckling system % of cows under the suckling system Sided Trønder and Nordland (STN) 1096 326 30 % Telemark 657 330 50 % Western Red Polled 211 117 55 % Western Fjord 848 565 67 % Døla 211 153 73 % Eastern Red Polled 174 138 79 % Total 3197 1629 Rare Native Dairy Cattle Breeds: Quo Vadis? 37 The total cow population in Norway in 2009 was 306 016, with 233 000 cows under a milk recording scheme. The predominant Norwegian Red cattle (NRF) constituted 98% of all dairy cows in the national dairy recording scheme. Over time, the share of suckler cows in the total cow population was substantially increasing, from about 4% in 1992 to 20% in 2009. However, due to substantial higher milk production of the native NRF (average milk yield of 6900 kg) in comparison with the endangered native breeds (Table 2), the speed of transformation of some dairy herds into suckling herds was much slower in case of NRF breed than in the six native breeds. While in Døla and Eastern Red Polled breed the share of cows under a suckling system is over 70%, the breeding association of the Norwegian STN breed decided in August 2010 not to register in herdbooks cows that are kept under the suckling system (STN‐avl). The association finds it more important to keep the breed as a pure dairy breed than ensuring pedigree recordings for all animals of this endangered breed. Table 2. Average milk performance of native Norwegian breeds 2010 Endangered breed native to Norway No of cows in herdbooks No of cows with complete milk recording scheme Average milk yield Sided Trønder and Nordland (STN) 1096 540 4200 Telemark 657 159 3900 Western Red Polled 211 56 4000 Western Fjord 848 196 3800 Døla 211 35 3000 Eastern Red Polled 174 33 3900 Total 3197 1019 The herds of native endangered cattle breeds in Norway are usually smaller than the national average, they are more often engaged in organic production and they have higher contribution to grazing outlying land, thus providing environmental services. Taking into account substantially lower milk performance, high labour requirements and costs, as well as difficulties to organize milking during summer grazing of far away pastures, from the perspective of farmers, conversion into a suckling system provides a good option, especially when considering alternative livelihoods opportunities and aging of traditional dairy farmers. However, what is reasonable the view of a single farmer or breeder perspective is not necessarily good in terms of the long‐term viability of the breed itself. Reducing dairy herds in breeds with small population sizes and low levels of milk recording makes genetic improvement very difficult, in terms of selection of both males and females. As shown in Table 2, already only a small fraction of Norwegian native endangered breeds have so called “complete milk performance records”, so there is really no room for further decrease. Nevertheless, farmers must take decisions that make business sense and cannot be over concerned with the conservation or management of the breed itself. 38 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 3. Austrian example: number of herds and cows under the suckling system in comparison with total population size of dairy dual purpose native cattle breeds (Berger, 2011). Breeds Suckling system 2009 Total population size 2010 2010 No herds No cows No herds No cows No of dairy cows Austrian Simmental 674 4 698 808 5 507 232 632 Original Pinzgau 474 2 597 500 3 073 5 478* Tyrolean Grey 358 922 391 1 517 4 817 *Total population size comprise of Pinzgau and Pinzgau x Red Holstein crosses In Austria, the transformation process towards suckling system was initiated in 1995, with the introduction of subsidies for suckling cows. Availability of financial support has stimulated the movement especially in case of part‐time and ageing farmers, and was enhanced by low milk prices. In case of three Austrian breeds, the moment toward a suckling system appears to be popular (Table 3). The total population size of Austrian Simmental and even original Pinzgau is high enough to accommodate a division in the utilisation of the breed without adversely impacting breeding programmes. In case of the Tyrolean Grey, initially the breeders’ association would not register in herdbooks cows that were kept under the sucking system. However, about five years ago, they were forced to register such animals (Berger, 2011). Similar transformation processes to keep part of a breed population under the suckling system is happening with a number of other native dual purpose breeds, for instance in the Czech Republic, the Slovak Republic, Sweden and Switzerland. The situation is different in regard to the Polish Red cattle breed, which was traditionally developed for meat‐milk utilisation. A highland variety of the breed was kept in difficult production environments, with feeding based on summer pastures and hay/straw in the winter. This led to the development of a medium sized breed that is highly adapted, able to utilize low quality fodder over the winter period and gain weight back fast when grazing season starts. However, the breed has also very modest milk production, about 3500kg per lactation with high fat content of 4.2‐4.5% and protein 3.3‐3.6%. The Polish Red population was upgraded using a number of higher productive breeds like the Danish Red, Jersey and in last 30 years, Angler (Instytut Zootechniki, 2011a). Since 1999, when the fraction of original population without admixtures (150 cows in 16 herds) was introduced into the conservation programme, the purebred population has been developing rapidly, as presented in Figure 1. Rare Native Dairy Cattle Breeds: Quo Vadis? 39 Figure 1. The number of herds and numbers of Polish Red cows included in the conservation programme (Instytut Zootechniki, 2011b) The Polish Red cattle have the longest history of breeding in Poland. In 1894, during the period of the partitionsof Poland, a first breeders’ society of Polish Red cattle was established in Malpolska region; in 1906 the official milk performance recording was introduced, and in 1913 herdbooks were established. In the between war period, the breed accounted for 25% of total cattle population in the country (Instytut Zootechniki, 2011a). Milk quality and milk properties of Polish Red are outstanding. High content of milk components, high biological value of the milk and very good processing properties are highly valued by breeders. Nevertheless, the milk performance is low, and thus, under some circumstances, dairy utilisation is not profitable. However, meat quality of Polish Red is very high, supporting a movement toward beef production. Some breeders are advocating being allowed to further develop toward beef production, but their proposals are not well received so far. Breeders willing to turn their herds into suckling systems would like to continue participation in the conservation programme. They would also like to enter into a beef recording scheme and select their herds towards meat production while maintaining high adaptation and fitness qualities of the breed and continue providing environmental services. However, many breeders and others believe that abandoning milk utilisation and further selection towards beef performance will result in losing the breed itself. The debate is continuing and leads to the question what are the pros and cons for such developments and who actually is in a position to take decision on this matter. 3. SWOT analysis In order to have a better understanding of the various aspects related to transformation of the dual purpose breed into the suckling system a SWOT analysis was undertaken, its results are summarised in Table 4. 40 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 4. SWOT analysis for dual purpose breeds moving towards the suckling system Strengths • The only way to keep a native breed by some farmers who cannot / don’t want to continue milking utilisation • Maintaining traditional production system, grazing extensive pastures and outlying lands • Demonstrating that the breeding is in the hands of breeders themselves and that the breed can evolve according to their needs • Demonstrating that breeding is not static, breeding is a tool for changing a breed, sometimes to completely different use than traditional utilisation Weaknesses • Loosing traditional knowledge about managing dairy cows of this breed (feeding, reproduction etc.) • Loosing cultural heritage (tradition related to milking / processing/products) • Loosing traditional knowledge about breeding (beef cattle breeding is less knowledge intensive than dairy e.g. no individual mating to improve very specific traits in progeny of given cows) • Loosing information on milk performance and udder conformation of the breed – no further milk recording • Loosing the opportunity to be an actual alternative breed for milk production in extensive production systems. • The risk of dividing an already endangered breed into two even smaller populations (creating sub populations of already endangered breeds.) Opportunities • Utilize additional beneficial traits e.g. high beef quality, higher twinning rate • Development of niche market for meat products • Providing better income for farmers • Lower labour requirements • Attracting farmers that want to produce beef to use native breed – might result in population increase Threats • Replacement of native breed with imported beef breed by some suckler cow producers • With breed replacement it is not certain that the other breed will be adapted to given conditions and provide the same landscape management service • Loosing genetic distinctive features related to milk traits (no further selection) • Loosing breed identity (national heritage value) 4. Conclusions The issue is not a simple one, in case of a number of native endangered cattle breeds the transformation process is well advanced, driven by breeders and their needs to get better economic returns and still utilize the breed they are used to and know well. The motives and values in farming local cattle breeds in Europe are very diverse, but the economic ones are prevailing (Gandini et. all, 2010). The consequences for the breed itself are very much related to the initial size of the population, the speed of transformation, and the ability to continue breeding efforts and control Rare Native Dairy Cattle Breeds: Quo Vadis? 41 inbreeding as well as ability to maintain other important breed characteristics. There is no simple solution, and development of a given breed should be considered on a case by case basis. There are other examples of controversy and potential tension between stakeholders in to the genetic management of the breed. The well described one concerns the Rouge Flamande cattle and its crossbreeding with Danish Red cattle (Lauvie et all, 2008). The person responsible for the conservation of rare cattle breeds, representing the French technical institute is against the crossbreeding practiced by breeders' association that focus on development objectives. The crossbred upgraded animals are used for breeding by the breeders association, who claims that the percentage of genes from the Danish Red breed is controlled, limited and tends to stabilize (Lauvie et al., 2008). This example raises another question: who is in charge and who is in a position to take decision on the future of a breed. We are looking forward to discussing during the RBI conference, the issues related to the conservation of dual purpose cattle breeds in instances where dairy production is becoming less desirable by farmers. 5. REFERENCES Berger B. (2011). Personal communication, June 2011. FAO (2007). The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by Barbara Rischowsky and Dafydd Pilling, FAO, Rome. Gandini, G., Villa, E. (2003). Analysis of the cultural value of livestock breeds: a methodology. J. Anim. Breed. Genet. 120, 1–11. Gandini, G., Avon, L., Bothe‐Wilhelmus, D., Bay, E., Colinet, F.G., Choroszy, Z., Diaz, C., Duclos, D., Fernandez, J., Gengler, N., Hoving‐Bolink, R., Kearney, F., Lilja, T., Mäki‐Tanila, A., Martin‐Collado, D., Maurice‐Van Eijndhoven, M., Musella, M., Pizzi, F., Soini, K., Toro, M., Turri, F., Viinalas, H., the EURECA Consortium, Hiemstra, S.J. (2010). Motives and values in farming local cattle breeds in Europe: a survey on 15 breeds. Animal Genetics Resources Information 47, 45–58. Instytut Zootechniki, (2011a). (http://www.bioroznorodnosc.izoo.krakow.pl/bydlo/dokumenty) Instytut Zootechniki, (2011b). (http://www.bioroznorodnosc.izoo.krakow.pl/bydlo) Lauvie, A., Audiot A., Couix, N., Casabianca, F., Brives, H., Verrier E.(2011). Diversity of rare breed management programs: Between conservation and development. Livestock Science, LIVSCI‐01548; No of Pages 10, Article in Press doi:10.1016/j.livsci.2011.03.025 Lauvie, A., Danchin‐Burge, C., Audiot, A., Brives, H., Casabianca, F., Verrier, E. (2008). A controversy about crossbreeding in a conservation programme: the case study of the Flemish Red cattle breed. Livestock Science 118 (1–2), 113–122. STN‐avl (http://www.stn‐avl.no) Verrier, E., Tixier‐Boichard, M., Bernigaud, R., Naves, M. (2005). Conservation and value of local livestock breeds: usefulness of niche products and/or adaptation to specific environments. Anim. Genet. Resources Info 36, 21–31. MOLECULAR CHARACTERIZATION, EVALUATION AND CONSERVATION OF INDIGENOUS GOAT BREEDS OF PAKISTAN Masroor Ellahi Babar* Tanveer Hussain, Haleema Sadia, Misbah Shaheen, Asif Nadeem, Akhtar Ali, Abdul Wajid and Sajjad Ali Shah 1 Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore‐ Pakistan *Corresponding author e‐mail: drbabar@hotmail.com Abstract: Pakistan is endowed with diverse livestock genetic resources. In the present study the 9 microsatellites markers along with complete mitochondrial displacement region and cytochrome b gene was studied in two goat breeds (Damani and Nachi) to explore their genetic polymorphism, relationships, domestication and phylogeny. The average observed and expected heterozygosity in Damani and Nachi populations using microsatellite markers was observed as 0.73, 0.51 and 0.56, 0.63 respectively and average heterozygosity was 0.58 in both breeds. Average number of observed alleles was 3.2 in Damani and 4.6 in Nachi for all loci. The mean polymorphic information content for both breeds of goat was 0.70 indicating the usefulness of markers panel. Nei’s standard genetic identity in both breeds was 0.25. The mean Fis, Fit and Fst values were ‐0.06, 0.15 and 0.20 in both breeds with gene flow value of 0.95. Analysis of sequences of mitochondrial D‐loop and cytochrome b revealed 164 polymorphic sites in a total amplified region of 2622 bp in selected animals with overall transition/transversion bias of 6.199. A total of ten different haplotypes were identified. The phylogenetic analysis of these breeds along with reported data throughout the world indicated the separate clad of Nachi haplotypes and close relation between Damani and Indian goat and possibility of being ancestor of modern goat populations. The measures of genetic variation revealed that there is good scope for effective improvement, conservation and designing national breeding policies for goat breeds in future. Key word: Genetic resource, Polymorphisms, Phylogenetic analysis, Goat breeds, Pakistan Introduction: It is generally realized that the small ruminants in Pakistan offer a higher potential for milk, meat and wool production. Goats are important components of Animal Genetic Resource (AnGR) of Pakistan and play an important role in the economy of poor farmers. Pakistan is having 59.9 million heads of goat population (Anonymous 2010‐11). Pakistan is the third largest goat producing and Tenth Sheep producing country in the world after China and India (Khan et al., 2008) having 30 documented goat breeds (Bakht et al., 2003) distributed in all types of geographical regions of the country. The understanding of genetic structure, variation and relationships among different breeds is very essential for designing suitable breeding policies to conserve and utilize the available rich goat genetic resource of Pakistan. This depends on the knowledge of their genetic structure based on molecular markers like microsatellites, mitochondrial displacement loop and cytochrome b region. Microsatellites, also called short tandem repeats (STR) are among the preferred method of genetic assessment due to their abundance, high polymorphism, low mutation rate, ease of amplification through PCR and small product size (Boyce et al., 1996). The use microsatellites for genetic characterization of goat (Chenyambuga, 2002) and sheep (Parsons et al., 1996) is now accepted world wide. The abundant phylogenetic information is contained by mitochondrial D‐loop and cytochrome b gene for intra and interspecies differences and considered a good marker for 44 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) genetic differentiation and phylogenetic relationships studies (Zardoya and Meyer, 1996, Loehr et al., 2006). This study was designed for the genetic characterization of two important goat breeds (Damani and Nachi) to assess their genetic diversity, differentiation and phylogenetic relationship between them and with other goats around the world. Material and Methods: Blood collection and genome extraction Ten mL of the blood samples were collected from 25 animals of Damani (Khyber Pakhtunkhwa province) and Nachi (Punjab province) goat breeds into 200 µL ethylenediamine tetra‐acetic acid (EDTA) containing falcon tubes from jugular vein. These unrelated animals were selected from different government livestock farms and breeding areas. Inorganic method (Sambrook and Russell, 2001) was used for genomic DNA extraction. The final concentration of DNA was brought to 50 ng/uL and stored at ‐80 C0 before further use. Mitochondrial Genome: Mitochondrial D‐loop and cytochrome b primers (Table 1) for Goat (Gene Bank Accession No. AF533441) were designed through software Primer3. (Steve and Skaletsky, 2000). (http://frodo.wi.mit.edu/). PCR was performed and conditions were optimized. All primers showed good results almost at the same reaction conditions and PCR cycle i.e. Initial denaturation at 95 C0 for 4 minutes and at 94 C0 for 30 seconds, annealing at 57 C0 for 30 seconds, extension at 72 C0 for 30 seconds and final extension at 72 C0 for 7 minutes. PCR product was purified by ethanol precipitation and final product was amplified by 1.5‐2 % agarose gel. PCR products were further processed for sequencing (Sanger et al., 1977). in Genetic Analyzer 3100 ABI, the samples were analyzed using the ABI PRISM sequencing analysis software version 3.7. Primers Table 1: Mitochondrial Cytochrome b and D‐loop Primers Goat. 5’‐3’ sequence Product (bp) Cyto b1 F: CCAATGATATGAAAAACCATCG R: TCTTAGGCGCCATGCTACTA 752 Cyto b2 F: ACAGGAATTCCATCAGACACAG R:AACCAGAAAAGGAGAATAGCCA 575 D‐loop 1 F: AAGCCATAGCCTCACTATCAGC R: ACATCTGGTTCTTTCTTCAGG 830 D‐loop 2 F: GATCACGAGCTTGTTGACCA R: TAAACACATAGGTTTGGTCCCAG 659 Microsatellite markers: All 9 microsatellites (Table 2) were optimized for PCR amplification through Bio‐Rad thermo cycler with a total reaction volume of 25 uL containing 100 ng template DNA, 50 mM KCl, 10 mM Tris‐HCl, 2 mM dNTPs, 1.5 mM MgCl2, 1.25 pmol/ uL of forward and reverse primers and 0.15 uL of 5U Taq polymerase (Frementas USA). Touch‐down PCR was used for amplification. The initial denaturing at 95 C0 for 4 minutes was followed by 35 cycles each for 30 seconds at 94 C0 for denaturation, 45 seconds at 64 to 54 C0 for annealing and 45 seconds at 72 C0 for extension followed by 7 minutes at 72 C0 for final extension. The products were electrophoresed on 12% non denaturing polyacrylamide gel in 1X TAE buffer at 120 volts for 7 hours. Molecular Characterization, Evaluation and Conservation of Indigenous Goat Breeds of Pakistan Marker Name Table 2: Microsatellite Markers Description Product size Tm (°C) 45 Position on Chromosome MAF70 124‐166 62, 59 4 OarAE101 99‐123 54, 54 6 MAF33 121‐141 55, 52 9 OarVH72 121‐135 66, 71 25 BM1818 253‐284 57, 60 32 ILSTS011 167‐173 58, 56 24 MM12 122 58, 50 9 ETH152 157‐169 67, 64 5 OarFCB48 143‐167 60, 60 17 Statistical Analysis The results of polyacrylamide gel electrophoresis were analyzed by the relative flow method. Statistical analysis for calculation of genetic variability measures such as observed and expected number of alleles, observed and expected heterozygosity, Shannon’s index, Fs, Fit, Fst, gene flow and Polymorphic Information Content (PIC) was carried out on both breeds for each microsatellite marker. Genetic identity between the breeds was calculated according to Nei (1978). POPGENE version 1.31 (Yeh and Yong, 1999) and POWER STAT software were used for calculations. The sequences of d‐loop and Cyt b were blast against reference sequence by using Chromas software version 2.2.10 (Tatusova et al., 1999) and Single Nucleotide Polymorphism (SNPs) was detected. Haplotypes were made for both breeds. MEGA version 5 (Kumar et al., 2011) was used for Phylogenetic analysis through Neighbor‐joining method. Results: In the studied 9 microsatellites 53 alleles were found in both breeds. Number of alleles per locus ranged from 1 (MAF33 in Damani) to 7 (OarAE101 in Nachi). Average value of observed number of alleles (Na) per loci was 3.2 in Damani and 4.6 in Nachi, while effective number of alleles was 2.7 and 2.9 in Damani and Nachi respectively. The observed heterozygosities in all studies breeds ranged from 0 (MAF33) to 1 (MAF70, BM1818, ETH152, OarFCB48) with an average of 0.0.73 in Damani goat while in 0 (OarVH72) to 1 (MAF70) with averg valu 0.51 in Nachi goat. (Table 3). Expected heterozygosities ranked between 0 (MAF33) to 0.80 (ILSTS011) with average of 0.56 in Damani while 0.43 (ETH152) to 0.77 (MAF70 and OarAE101) with average 0.63 in Nachi. Shannon's Information index value ranged between 0 MAF33 in Damani to 1.61 in Nachi for OarAE101 marker. The average heterozygosity between both breeds was observed as 0.58. Average values of Fis, Fit and Fst were calculated as ‐0.06, 0.15 and 0.20 with average gene flow of 0.95. The average PIC value for both of goat populations was 0.70 showing usefulness of the studied microsatellites. PIC value ranged from 0.54 (MAF33) to 0.83 (ILSTS011). The Nei's unbiased measure of genetic identity between studied breeds was observed as 0.26. (Nei 1978). (Table 4). The allelic frequency of all microsatellite markers in Damani and Nachi are shown in Fig 1 and 2. 46 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 3. Average genetic variation statistics for all loci in both goat breeds Breeds Na Ne I Ho He Ave. Fis Fit Fst Nm PIC H MAF70 Damani 4 2.67 1.12 1.00 0.64 0.68 ‐0.45 ‐0.28 0.11 1.95 0.74 Nachi 5 4.02 1.47 1.00 0.77 OarAE101 Damani 4 3.18 1.22 0.65 0.70 0.72 0.16 0.28 0.14 1.46 0.82 Nachi 7 4.12 1.61 0.55 0.77 MAF33 Damani 1 1.00 0.00 0.00 0.00 0.21 0.74 0.90 0.63 0.14 0.54 Nachi 3 1.78 0.70 0.11 0.45 OarVH72 Damani 2 1.88 0.66 0.75 0.48 0.60 0.37 0.44 0.11 1.93 0.61 Nachi 4 3.76 1.35 0.00 0.75 BM1818 Damani 2 2.00 0.69 1.00 0.51 0.51 ‐0.67 ‐0.13 0.32 0.52 0.71 Nachi 3 2.11 0.90 0.72 0.54 ILSTS011 Damani 5 4.65 1.57 0.70 0.80 0.75 0.09 0.19 0.11 1.93 0.83 Nachi 5 3.66 1.39 0.66 0.74 MM12 Damani 3 2.81 1.06 0.50 0.66 0.59 0.34 0.40 0.08 2.63 0.64 Nachi 5 2.18 1.07 0.27 0.55 ETH152 Damani 2 2.00 0.69 1.00 0.51 0.46 ‐0.67 ‐0.15 0.31 0.54 0.61 Nachi 4 1.74 0.76 0.55 0.43 OarFCB48 Damani 6 4.16 1.55 1.00 0.77 0.71 ‐0.24 ‐0.09 0.12 1.82 0.81 Nachi 6 2.797 1.37 0.77 0.68 Mean Damani 3.2 2.70 0.95 0.73 0.56 0.58 ‐0.06 0.15 0.20 0.95 0.70 Nachi 4.6 2.93 1.18 0.51 0.63 Na: Observed no. of alleles; Ne: Effective no. of alleles; I: Shannon’s index; Ho: Observed heterozygosity; He: Expected heterozygosity, Nm: Gene flow estimated from Fst = 0.25(1 ‐ Fst)/Fst. Locus Table: 4. Nei's Unbiased Measures of Genetic Identity and Genetic distance (Nei 1978) Nei's genetic identity (above diagonal) and genetic distance (below diagonal). Population ID Damani Nachi Damani Nachi *** 1.33 0.26 *** Nei's genetic identity (above diagonal) and genetic distance (below diagonal). Analysis of sequences revealed 164 polymorphic sites in amplified region of 2622 bp of mitochondrial D‐loop and cytochrome b in selected animals. Ten haplotypes were identified in both breeds (5 in each) and all the haplotypes were rich in A/T content. There were more transitions than transversions in the identified haplotypes. Neighbor joining tree of haplotypes of Damani and Nachi with already reported haplotypes of goat from different countries (India, iran, Bhutan, China, Egypt, Nigeria, Morocco, Zimbabwe, Korea, Libya, South Africa, Turkey, Austria and France) with Cattle (Bos taurus) as outer group. Fig 3. Molecular Characterization, Evaluation and Conservation of Indigenous Goat Breeds of Pakistan Fig 1: Allele Frequencies of All Microsatellite Markers in Damani Goat Fig 2: Allele Frequencies of All Mcrosatellite Markers in Nachi Goat 47 48 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Fig 3: Phylogenetic tree of observed haplotypes of Damani and Nachi with reported haplotypes from around the globe using Cattle (Bos taurus) as outer group by MEGA 5 using Neighbor‐joining method Discussion: The panel of 9 microsatellites selected for this study showed moderate to high polymorphism except MAF33 in Damani goat. The PIC value was 0.70 indicating the greater heterozygosity in both breeds which is greater then the values calculated in Chinese (0.620), Korean (0.350) and Saanen (0.570) goats (Kim et al 2002). The set of 9 microsatellites markers can be utilized for genetic characterization and forensic purposes effectively for goat breeds. The average heterozygosity of both goat breeds was 0.58 which is a little lower than the 0.77 to 0.82 by Yang et al. 1999 and 0.67 to 0.73 by Wang et al., 2006 in Chinese goat breeds but greater than Boer goats value 0.49 (Visser et al 2004) However observed heterozygosity (0.51) was less than expected heterozygosity (0.63) in Nachi is indicating the presence of overall loss of heterozygosity in this breed. (De Araujo et al. 2006). The mean value of Fis (heterozygote deficit) was ‐0.06 is so low indicating low inbreeding coefficient between two breeds which is evident by the far geographical location of both breeds i.e. in two different provinces. The genotyping through microsatellites thus indicated that this is an effective tool for the genetic evaluation of different goat breeds. Molecular Characterization, Evaluation and Conservation of Indigenous Goat Breeds of Pakistan 49 The ten complete mitochondrial D‐loop and cytochrome b gene haplotypes of Damani and Nachi were having high degree of polymorphisms (164 Single Nucleotide Polymorphism) and the richness of A/T and transitions. The NJ phylogenetic tree indicated 6 main groups of haplotypes, Pakistani Nachi and a Damani goat; a Damani, another Pakistani and Bhutan goat; Egyptian, Nigerian, Morocco, South African and Zimbabwe isolates; Chinese, Iranian and Korean haplotypes; Turkish and Syrian; French and Austrian isolates were clearly clustered together. However three Damani haplotypes and an Indian haplotypes were in separate branches. The most ancestor type of was of the Indian and a Damani goat in the NJ tree. The nucleotide frequencies are 31.86% (A), 27.37% (T), 14.05% (C), and 26.73% (G).The overall transition/transversion bias was 6.199. The data will highly informative for further phylogenetic studies, genetic differentiation and forensic applications in future. The findings of this study will facilitate the researchers and breeders to understand the genetic relationships and breed differences for making future conservation and breeding policies for goat breeds in the country. Acknowledgements: Higher Education Commission of Pakistan is acknowledge for funding. Livestock and Dairy Development Departments of Punjab (Angora Goat Farm, Rakh Khairewala, Layyah) and Khyber Pakhtunkhwa are appreciated for help in blood sampling. REFERENCES: Anonymous. (2011). Pakistan Economic Survey. Government of Pakistan, Finance division, Economic Advisor’s Wing Islamabad. Bakht, B. K., A. Iqbal and I. Mustafa. (2003). Sheep and Goat Production. Department of Livestock Management University of Agriculture Faisal Abad‐Pakistan: 16‐28. Boyce, W. M., P. W. Hedrick, N. E. Muggli‐Cockett, S.Kalinowski, M. C. Penedo and R. R. Ramey. 1996. Geneticvariation of major histocompatibilty complex andmicrosatellite loci: a comparison in Bighorn sheep. Genetics145:421‐433. Chenyambuga, S.W. (2002). Genetic characterization of indigenous goat populations of sub‐Saharan Africa using microsatellite DNA markers. PhD Thesis, Department of Animal Science and Production, Sokoine University of Agriculture, Sokoine, Tanzania. De Araujo, A.M., S. E. F. Guimaraes., T. M. M. Machado., P. S. Lopes., C. S. Pereira., F. L. R. Da Silva, M. T. Rodrigues, V. D. S. Columbiano and C. G. Da Fonseca, 2006. Genetic diversity between herds of Alpine and Sannen dairy goats and the naturalized Brazilian Moxoto breed. Genetic Molecular Biology. 29: 67‐ 74. Khan M. S., Khan M. A. Mahmood, S. (2008) Genetic resources and diversity in Pakistani goats. Int J Agric Biol 10: 227‐231. Kim, K. S., J. S. Yeo., J. W. Lee., J. W. Kim and C. B. Choi. (2002). Genetic diversity of goats from Korea and China using microsatellite analysis. Asian‐Australasian Journal of Animal Sciences 4: 461‐465. Kimura M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111‐120. Loehr, J., K. Worley, A. Grapputo, J. Carey, A. Veitch and D.W. Coltman (2006). Evidence for cryptic glacial refugia from North American mountain sheep mitochondrial DNA. J. Evol. Biol. 19: 419‐ 430. Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genet 89: 583‐590 Parsons, Y. M., Cooper, D.W. and Piper, L. R. (1996). Genetic variation in Austrian Merino sheep. Animal Genetics 27: 223‐228. Sambrook, J. and D. W. Russell. (2001) Molecular Cloning: A laboratory Manual, 3rd edition, Cold spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA 50 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Sanger, F., Nicklen, S., and Coulson, A. R. (1977)."DNA sequencing with chain‐terminating inhibitors". Proc. Natl. Acad. Sci. U.S.A. 74 (12): 5463–7. Steve, R., and H. J. Skaletsky. (2000). Primer 3 on the www for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa. NJ: 365‐386. Tamura, K, D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. (2011) MEGA5:Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution (submitted). Tatusova, T. A., and Madden, T. L. (1999). "Blast 2 sequences ‐ a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174: 247‐ 250. Visser, C., C, A, Hefer, E, van Marle‐Koste and A, Kotze, (2004). Genetic variation of three commercial and three indigenous goat populations in South Africa. South African Journal of Animal Sciences 349 (Suppl.1): 24‐ 27. Wang Z. Z., Z.P Yang., Y. H. Ma., Q.H. Wang., Y.j Mao., H. Chang., Q. L. Zhou and M. Xu (2006). Analysis of genetic diversity among seven goat populations in the Middle and Lower Yangtse River Valley and East and South Mainland near the Sea. Chinese Journal of Animal and veterinary Sciences. 37(1): 1‐6. Yang, L., S. H. Zhao., K. Li, Z. Z. Peng and G. W. Montgomery. (1999). Determination of genetic relationships among five indigenous Chinese goat breeds with six microsatellites markers. Animal Genetics 30: 452‐ 455. Yeh, F. C. and R. Yong. (1999). POPGENE version 1.31: Microsoft‐based Freeware for Population Genetic Analysis. University of Alberta, Edmonton, Canada. Zardoya, R. and A. Meyer. (1996). Phylogenetic performance mitochondrial protein coding genes in resolving relationship among vertebrate. Mol. Biol. Evol. 13: 933‐942. IN VITRO CONSERVATION AND PRELIMINARY MOLECULAR IDENTIFICATION OF SOME TURKISH DOMESTIC ANIMAL GENETIC RESOURCESI (TURKHAYGEN‐I) Sezen ARAT TUBITAK MAM GMBE (GEBI) Genetic Engineering and Biotechnology Institute, Gebze, Kocaeli, Turkey sezen.arat@mam.gov.tr INTRODUCTION: Animal genetic resources are considered as a part of the present biodiversity. Unfortunately; our native animal genetic resources have not been appreciated as it should have been; some are already gone extinct and some are at the edge of extinction. Yet, animal genetic resources must be considered as the insurance of the future, since they may have an important potential to improve social and economic life. Conservation of animal genetic resources is important; because, there might be a need of recovering the lost/decreased genetic variation and they might be possessing special genes or important genetic information. Conservation strategies must be planned (i) not to lose the genes or gene combinations that might be of use, (ii) to make use of the advantages of heterosis, (iii) to use the present resources as the insurance of the future, (iv) to preserve the cultural products, and (v) to use the present material in diverse research fields. In fact, animal genetic resources have been being conserved upon national conservation projects in economically developed countries (Hiemstra and FAO, 2003). Conservation of animal genetic resources includesinsituandex‐situprograms (Ertugrul M, 2005; Dhsan S., 2004; Hiemstra and FAO, 2003). The animals are conserved alive at their native place in context ofinsituprogram.Ex‐ situconservation programs include both conserving the animals alive in a place different than their native place like zoo or breeding farm; and conserving the material (e.g. cryopreservation) taken from the animal like gamete, embryo, sperm, tissue or cell, and DNA. These conservation methods have become more effective with the new advances in the modern biology, more specifically, in molecular genetics and biotechnology (Matsas et al, 2004; Shivaji et al, 2003; Mariante et al, 2002). Cryopreservation technique makes possible the long term storage of high number of samples in small volume containers. Moreover, rapidly developing technology enables to apply cryopreservation techniques to different species like cattle, sheep, keci, at, swine, poultry (Piltti et al, 2004; Stachecki et al, 2004; Bagis et al, 2004; Aller et al, 2002; Leibo and Songsasen 2002; Dobrinsky JR 2002 and Dobrinsky JR 2001). There are important improvements in extracting embryonic stem cells and germinative cells, and their cryopreservation. It can be depicted that these topics will define the agenda in the future. Reports on the production of germ cells from embryonic stem cells shows that this technology can be used in ocnservation studies in the future (Zwaka and Thomson 2005; Wakamaya et al., 2005; Geijsen et al., 2004; Lacham and Kaplan 2004; Toyooka et al., 2003). In the future, using the cryopreserved sperm would only need the female individuals of the population in restoring the decreased genetic diversity in the population as well as the decreased population size. Moreover, cryopreserved embryo and sperm might enable us to bring back the individuals of a lost breed. Cryopreserving healthy germ cells and embryo may help to eradicate animal health problems that might emerge in the future, as well (Piltti et al, 2004; Stachechi et al, 2004). Studies on resolving the phylogenetic relationships between breeds would be helpful in identifying the priorities in conservation of the animal genetic resources (ReistMartive et al, 2003). There are numerous DNA markers to analyze the genetic variation among breeds and among 52 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) individuals within the breeds, for example, Amplified Fragment Length Polymorphism (AFLP), Random Amplified Polymorphic DNA (RAPD), mikrosatellite or Short Tandem Repeats (STR), Sequence Tag Site (STS), Expressed Sequence Tag (EST), Restriction Fragment Length Polymorphism (RFLP), Single Nucleotide Polymorphism (SNP), mitochondrial DNA sequencing (cytochrom b, cytochrom c oxidase 1, ND1,ND34, ND56 and Dloop), ribosomal subunit proteins and Major Histocompatibility Complex (MHC) loci sequences (Shivaji et al, 2003). These markers are employed in conservation studies aiming to identify the rare and important breeds, and the populations having high genetic diversity (Hall, 2004). Embryo cloning techniques might also be employed in conservation of animal genetic resources for different purposes. As the technology develops, there will be an increase in the application ways of these techniques. Recent advances in science more specifically in nuclear transfer (NT) technology are promising. There are successful studies on cloning of an adult individual using NT as well as on NT between closely related species, which indicated the possibility of restoring the populations having few members left and saving the species facing extinction (Chen et al., 2002; Loi et al., 2002; Kitiyanant et al, 2001; Loi et al., 2001; Arat et al., 2004, 2003, 2001). That is why, several US biotechnology companies, agricultural organisations and zoos have started to construct tissue and cell banks (Ryder et al, 2001). Turkey, which has a great number of endemic species, has an important share in the genetic resources of the earth. Therefore, Turkey must conserve its biodiversity and make use of it where necessary, which is accepted as the indicative of economic and genetic richness, and is proved to be useful in medicine, agriculture and industry. In addition, biologic diversity is connected with populations' ecologic, cultural and spiritual richness and with its past. However, the increase in the population size as well as the economic pressure speed up the changes in traditional farming techniques and causes the decrease in biodiversity. Animal genetic resources are considered within the context of biodiversity components, and they also meet the world's demands in food and agriculture. The production traits of native breeds have been affected by the ecological, sociological and economical features of populations and in time the breeds having high productivity traits are preferred over low productive indigenous breeds. As in other countries, the breeding and hybridization practices are being conducted and highly productive animals are being imported to increase the productivity of local breeds of Turkey. Consequently, this brought about the decrease in biodiversity of farm animal genetic resources and endangered their existance. Thus, the importance of preserving the balance between breeding studies and conservation of the animal genetic resources was revealed. The archeological and genetic data indicates that domestication centers for cattle, sheep, goat, and probably swine are in the southwest Asia including a part of Anatolia (Bruford et al, 2003). Our native breeds, being the closest relatives of the first domesticates, must be given priority in conservation (Bruford et al, 2003). Molecular genetics studies have shown that the European cattle, sheep and goat breeds have originated and spread from Anatolia ((Loftus et al., 1999; Troy et al., 2001, Bruford and Towsend, 2004, Lenstra et al., 2005). The information lost during this stage might still be present in Turkish native breeds. Yet, the 47% sharp decrease in the last two decades (Oskam et al, 2004), hybridizations with non native breeds and preferring non native highly productive breeds over native breeds are the important threats in losing of the genetic information present in our native breeds. It must be stated that employing molecular genetics in management strategies may also lead to loss of some genetic information. For example, using molecular genetics in breeding and management of livestock species in context of food safety as in eradication of diseases like BSA and scrapie (European Food Safety Authority Report, 2003), may cause losing some of the alleles. The management strategies must be constructed carefully and accordingly. The importance of our native genetics resources is widely accepted andexsituconservation studies must be started immediately. Moreover, genetic studies must be carried out and their In Vitro Conservation And Preliminary Molecular Identification Of Some Turkish Domestic Animal Genetic Resourcesi 53 economic value must be estimated, the priority of the populations and/or breeds must be identified forin‐situconservation. It has been shown that the gene pool of the populations in breeding farms can easily differentiate from the breed's gene pool (Koban, 2004) due to genetic drift and wrong management strategies. Therefore, the results of the proposed project will guide breeding farms in both choosing the individuals to conserve and constructing proper management strategies. The results of the projects, which are either completed or ongoing, on Turkish native breeds will guide the proposed project. These studies include the linkage analysis between some production traits and blood and milk protein polymorphisms. Following the new advances in DNA technology, DNA markers have also been employed in Turkey in studying genetic variation with and among breeds, in locating the domestication centers, in pedigree analysis and in studying the production traits. Conservation of the biological richness and diversity is one of the main concerns in most of the countries' agenda. Several different establishments in the world have been carrying out studies on the conservation of the endangered species (Ryder, 2001; Millennium Seed Bank; Wildlife Conservation and Monitoring Center; Conservation on Biological Diversity; Japanese Ministry of Agriculture; Mariante et al., 2002; Matsas et al., 2004; Hiemstra and FAO, 2003). In Turkey, the establishment of a central bank or an institute with affiliated banks for conservation, thus enabling the sharing of the samples and knowledge among the country has been emphasized within the priority subjects in context of TUBDTAK (Turkish Scientific and Technological Research Council)'s Vision2023 Science and Technology Prevision Project. In addition, "Biodiversity Conservation Program" within the area of "Biotechnology and Genetic Technologies" was listed among the priority action topics by the Turkish Academy of Sciences (TUBA) Molecular Life Sciences and Technology Foresight Project (20032023). Moreover, the importance of conservation of animal genetic resources was emphasized in the 1st Comission Report of the II. Agriculture Assembledge (2004). Furthermore, Turkey took part as contractor in the international agreements on conservation of the biodiversity and genetic resources. One of these agreements is the UN Convention on Biological Diversity. In the meantime, a commission to work on conservation of animal genetic resources was formed by FAO (UN Food and Agricultural Organisation) and started its studies. The proposed project will contribute to fulfil the commitments resulted from these agreements. In conclusion, the reasons stated above and the "commonwill" on the conservation of native animal genetic resources resulted from the preliminary studies have lead the preparation of the proposed study. The project aims at conserving some of the native animal genetic resources and construction of banks to hand these on next generations. METHOD A1 R&D Activities and Distribution of Data The Main Work Package 1 (WPI): The Preparation of Studying Material This project comprises to exsitu in vitro preservation methods. This WPI consists of assurance of living materials and identification of the breeds to be conserved in context of the project. Based on reports of national and international organizations and population records, the species and the breeds to be included in conservation studies were determined. Together with the onset of this project, it will be ensured that the genetic variation within populations chosen to be conserved will represent the genetic diversity of the breed. For each livestock species, 25 male and 25 female individuals will be chosen for the population. However, due to possible problems during the study, 12 male and 12 female individuals will also be selected as back up. Thus, in total each population will have 74 individuals. During formations of those populations, non related individuals will be selected, only 13 animals will be bought in accordance with the flock's population size. Data (diseases about the region, vaccinations, sheltering and feeding) of the flock from which studied animals are bought will systematically be recorded to standard files. Location data will also be recorded by using GPS devices. 54 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The Main Work Package 2 (WP2): Technological Development about Preservation of Live Material (normal and clone embryo, egg cell, somatic cell, embryonic cell) In order to develop and ameliorate the technologies of live material preservation techniques, WP2 consists of several sub work packages. These sub packages employ techniques like tissue cryopreservation, using of alternative cell types and alternative auxiliary reproduction techniques, as well as embryo and gamete cryopreservation. Hence, in the context of WP2 while genetic sources of defined animals are protected by using routine technologies, development of some new technologies which would be oriented in future usages are planed. The Main Work Package 3 (WP3): Preservation of Genetic Resources This work package consists of cryopreservation in order to protection of genetic resource of identified animals. Those resources are genomic DNA, somatic cell, tissue, embryo, germ cell. Procedures taking part in the work package are going to be specified according to methods defined by international sources and international organizations such as FAO. The research staffs working on this package have sufficient experiences in these fields. At the same time, the researches of technology development group are going to ameliorate the accuracy of the procedures. For cryopreservation, 25 female and 25 male animals from each breed are going to be employed. However, due to difficulties in sample collection processes, the number of animals would be less than 25. For this reason, 24 backup individuals for sheep, goat, cattle and water buffalo species are going to be assigned in case of the possible problems. From each breed 300 dose sperm and 300 embryos should be cryopreserved. The ex situ and in vitro protected samples of those species and breeds will be kept in gene banks constructed in LHMAE/TAGEM and GMBE. The Main Work Package 4 (WP4): Characterization of breeds A comprehensive sample collection will be planned in the context of the proposed project. However, in genetic diversity and phylogenetic studies, since establishment of the necessary infrastructure and acquiring enough number of qualified staff will take remarkable time, most frequently used two molecular methods (microsatellite markers and mtDNA sequencing) are going to be employed. The Main Work Package 5 (WP5): Distribution and Standardization of Data WP5 consists of protocol standardization, distribution of data by constructing a database and a web page, getting in touch with several national and international organizations. Moreover, WP5 includes arrangement of seminars, congresses and media declarations to represent the project. A2 Educational Activities In the context of the project; (i), short and long term courses project's staff, and (i) short term courses for other researchers are going to be arranged. EXPECTED OUTCOME AND IMPACT: Changing environmental conditions (dramatic increase in human population, global warming, irregular settlement, environmental pollution) negatively and inexorably affect to the world fauna and flora. Even though the importance of sustainability of biodiversity is vital; regarding the animal resources only as food material can make someone realize the urgency and severity of the topic. In all over the world, there is an increasing tendency among livestock breeders for inbreeding and artificial selection to improve the productivity. These are called as "culture" breeds having high productivity traits, but, their resistance to harsh environmental conditions and diseases were not taken into account during selective breeding. Those negative factors seriously threaten the future of lots of species and breeds. On the other hand, animal breeds still having genetic variations, are In Vitro Conservation And Preliminary Molecular Identification Of Some Turkish Domestic Animal Genetic Resourcesi 55 insurances of the future since those might be regarded as gene resources. Turkey is an affluent country for this purpose. However, if we do not conserve our natural richness, they will eventually be lost. Within the context of TUBITAK Vision2023 Scientific and Technological Prevision Project, the establishment of a central bank or an institute with affiliated banks for conservation and construction of an intra national network which will provide data and material flow were especially considered as priority areas. In addition, "Biodiversity Conservation Program" within the area of "Biotechnology and Genetic Technologies" was listed among the priority action topics by the Turkish Academy of Sciences (TUBA)' Molecular Life Sciences and Technology Prevision Project (20032023). Besides, the importance of the topic was also mentioned in the First Commission Report of the Second Agriculture Council (2004). To provide an urgent solution to this concern the proposed project was prepared. The owner of the project is Turkish Ministry of Agriculture and Rural Affairs. The project is directed by TUBITAK GEBI. Furthermore, there are 10 Turkish universities and TAGEM. The aims of the proposed project are; • Construction of DNA, cell, tissue, embryo and sperm banks for animals facing extinction. • Characterization of entire animal species within the context of the project. • The implementation of new scientific technologies and developments on animal biotechnology and animal genetics, into the researches carried out in Turkey and the ameliorations of extant technologies. Furthermore, educating qualified staffs on those fields. • Gathering and distribution data. • Coupling infrastructures and human resources for a specific purpose. The project comprises 13 sheep, 6 cattle, 5 goat, Anatolian water buffalo and 5 horse breeds. The study populations are going to be formed by staff of Ministry of Agriculture and Rural Affairs and then they are going to be held in the farms of universities taking part in the project. While genetic characterization will be done, necessary materials will be provided for the embryo, sperm and cell banks. As a part of the project, one of the gene banks is going to be established within Genetic Engineering and Biotechnology Institute of TUBITAK's Marmara Research Center and the other is going to be established within Lalahan Livestock Central Research Institute. Cryopreserved DNA samples, sperms, cells and embryos from 1500 different individuals are going to be kept in those gene banks. Besides, by means of constructed database and designed web page, data are going to be gathered and distributed. The most important result of this project is animal gene banks since it will be a pioneer in Turkey in conservation of most of native animal gene resources. Two different gene banks are going to be established in conformity with FAO proposals. Studied DNA samples and stored tissues and cells of conserved animal species as part of this project will also be sole resource both in Turkey and in the world. In genetic diversity and phylogentic studies, highly used molecular marker types (microsatellite markers and mtDNA sequencing) are going to be used. For the first time a remarkable number of breeds are going to be genetically characterized in such extensive ways. Besides, generated data will contribute to registration of studied breeds. Different cryopreservation conditions (DNA, somatic cell, germ cell, embryo) are going to be used at the same time. In Turkey, on that field this project is most comprehensive and well attended project with 2 governmental organizations and 10 universities. By means of combining infrastructures and knowledge and gathering different dispersed researches, unnecessary expenditures would be prevented. In addition to that, present inactive infrastructures would be reused and performing similar projects in the same field would also be 56 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) prevented. Owing to constructed databases, knowledge would easily be reached. Furthermore, these databases will also be open to new additions and developments. In Turkey the number of qualified researchers is remarkably low and insufficient comparing to the other developed countries. Organizations taking part in the project are going to both train their own staff in advanced new technologies and grow new researchers especially in animal genetics and reproduction biotechnology areas. Thus, the funds otherwise allocated for researchers' education in abroad are going to be utilized within the country in context of the project. Because the project is highly comprehensive, the duration was determined as 4,5 years and budget of the project is : 4 000 000 Euro. PROGRESSIVE REPORT Two cryobanks were established containing DNA, cells, sperm, embryos from 1431 individual of 29 breeds of 4 livestock species. In a frame of the Project, development of embryo and tissue cryobiology methods and nuclear transfer studies were carried out. All working groups developed and implemented standart embryo ans sperm freezing protocols. Also cell culture and freezing related studies were completed and appropriate protocols were determined. All breeds except Anatolian water buffalo were genetically characterized by mtDNA sequencing and microsatellite markers. During the project, till now 3 PhD, 5 Master thesis were completed, and 6 scientific papers were published, 28 presentations in national, 19 presentations in international congresss were presented and 8 progressive reports were submitted. All information about the project can be obtained from the web page of the project www.turkhaygen.gov.tr. USING CELL BANKS FOR CLONING First time in the world, Anatolian Grey cattle was also cloned by using somatic cells cropreserved in Animal Gene Bank. Five cloned cattle were still very health and they are 13‐19 months old. All are Turkish grey cattle clones. Efe from cryopresed cell in the bank of a 4 years old bull, the first outcome of the Cloning of Anatolian Native Cattle Breeds Project, which aims to serve conservation studies of Anatolian native breeds; is the first Anatolian cloned calf both in Turkey and in the world. Ece, Ecem, Nilufer and Kiraz from cryopresed cells in the bank of a 5 years old cow are also the first female cloned calves in Turkey. This important result announced in Turkey and in several national and international congresses. The scientific paper of the study was accepted for publication in Reproduction, Fertility and Development. REFERENCES Aller J.F., Rebuffi G.E., Cancino A.K., Alberio R.H. Successful transfer of vitrified Ilama (Lama glama) embryos. Anim Reprod Sci. 2002 Sep 16; 73 (12): 1217. Arat S. ve ark. Bovine cloning using adult donor cells treated with roscovitine. Biol Reprod Supplement . 2001; 1;173. Arat, S. ve ark. Cold storage of tissue as source for donor cells does not reduce the in vitro development of bovine embryos following nuclear transfer. Reprod Fertility Dev 2004; 16(1,2):135. Arat, S. ve ark. Gene expression and invitro development of interspecies nuclear transfer embryos. Mol Reprod Dev. 2003; 66:334342. Arat, S., Rzucidlo S.J., Gibbons, J., Miyoshi, K., Stice, SL. Production of transgenic bovine embryos by transfer of transfected granulosa cells into enucleated oocytes. Mol Reprod Dev 2001; 60: 2026. Bruford M. W. and Townsend S.J. Case studies in the genetics of animal domestication: sheep. In: Zeder M., DeckerWalters D., Bradley D., Smith B.D. (eds.): Documenting Domestication: New Genetic and Archaeological Paradigms, 2004; California University Press. In Vitro Conservation And Preliminary Molecular Identification Of Some Turkish Domestic Animal Genetic Resourcesi 57 Bruford M. W., Bradley D .G. and Luikart G. DNA markers reveal the complexity of livestock domestication. Nature Genetics 2003; 4: 212. Maudet, A. BejaPereira, E. Zeyh, H. Nagash, A. Kence, D. Ozut,M.P. BijuDuval, S. Boolormaa, D. W. Coltman, P. Taberlett and G. Luikart. A standard set of polymorphic microsatellites for threatened mountain ungulates (Caprini, Artiodactyla). Molecular Ecology Notes 2004; 4 , 4955. Chen DY. ve ark. Interspecies implantation and mitochondria fate of pandarabbit cloned embryos. Biol Reprod 2002; 67: 637642. Conservation on Biological Diversity (www.biodiv.org/chm/conv/default.htm). Dobrinsky JR. Advancements in cryopreservation of domestic animal embryos. Theriogenology. 2002 Jan 1; 57 (1): 285302. Dobrinsky JR. Cryopreservation of swine embryos: a chilly past with a vitrifying future. Theriogenology. 2001 Nov 1; 56 (8): 133344. Ertugrul M., Dellal G., Elmaci C., Akin A.O., Karaca O., Altin T. ve Cemal D. Hayvansal Gen Kaynaklarinin Koruma ve Kullanimi. 2005. TMMOB Ziraat Muhendisleri Odasi, Turkiye Ziraat Muhendisligi VI. Teknik Kongresi, I. Cilt 275290. Geijsen N., Horoschak M., Kim K., Gribnau J., Eggan K. ve Daley GQ. Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 2004; 427:148154. Hall, S.S.G., Livestock biodiversity: genetic resources for the farming of the future. Blackwell Publishing Company, 2004. Bagi s H. Sagirkaya H,, Odaman H,. Andras D. Vitrification of pronuclear stage mouse embryos on SSV versus in cryotube comparision of the effect of ecuilibration time and different sugers in the vitrification solution. Mol Reprod Dev 2004; 67:186192. Hiemstra S.J. Guidelines for the constitution of national cryopreservation programmes for farm animals (FAO). 2003 Soysal I.. Turkiye Yerli Hayvan Genetik Kaynaklari mi z, 2004, Tekirdag Ziraat Fakultesi Japanese Ministry of Agriculture, Forestry and Fisheries ( http://bank.dna.affrc.go.jp ). Kitiyanant Y. ve ark. Somatic cell cloning in buffalo: effect of interspecies cytoplasmic recipients and activation procedures. Cloning Stem Cell 2001; 3:97104. Koban E. Genetic Diversity of native and crossbreed sheep breeds in Anatolia. PhD Thesis, Orta Dogu Teknik Universitesi, 2004, Ankara, Turkiye. LachamKaplan O.In vivo and in vitro differentiation of male germ cells in the mouse Reproduction. 2004 Aug;128(2):14752. Leibo SP, Songsasen N. Cryopreservation of gametes and embryos of nondomestic species. Theriogenology. 2002 Jan 1; 57 (1):30326. Lenstra, J.A. ve ark. Evolutionary and demographic history of sheep and goats suggested by nuclear, mtDNA and Ychromosome markers. Symposium: The role of biotechnology in Turin, Italy 57 March 2005. Loftus R. T., Ertugrul O., Harba A. H., ElBarody M. A. A., MacHugh D. E., Park S. D. E. and Bradley D. G. (1999). A microsatellite survey of cattle from a centre of origin the Near East. Molecular Ecology 1998; 8: 38. Loi P. ve ark. Genetic rescue of an endangered mammal by crossspecies nuclear transfer using postmortem somatic cells. Nature Biotech 2001; 19:962964. Loi P ve ark. Nuclei of nonviable ovine somatic cells develop into lamps after nuclear transplantation. Biol Reprod 2002; 67: 126132. Mariante Ada S, Egito AA. Animal genetic resources in Brazil: result of five centuries of natural selection. Theriogenology. 2002 Jan 1; 57 (1): 22335. Matsas D, Huntress V, Levine H, Ayres S, Amini J, Duby R, Borden P, Saperstein G, Overstrom E. Preservation of heritage livestock breeds:integrated program to cryopreserve germplasm from Tennessee myotonic goats. Reprod Fertil Dev. 2004; 17(1,2).195. Millennium Seed Bank ( www.rbgkew.org.uk/seedbank/msb.html ) Oskam A., Burrell A., Temel T., van Berkum S., Longworth, N. ve Vilchez, I.M. Turkey in the European Union, Consequences for Agriculture, Food, Rural Areas and Structural Policy. Rural Areas and Structural Policy. Final Report. Wageningen University, 2004. 58 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Piltti K, Lindeberg H, Aalto J, Korhonen H. Live cubs born after transfer of OPS vitrified warmed embryos in the farmed European polecat ( Mustela putorius ). Theriogenology. 2004 Apr 1; 61 (5): 81120. ReistMarti S.B., Simianer H., Gibson J., Hanotte O. ve Rege J.E.O. Weitzman's approach and conservartion of breed diversity: an application to African cattle breeds. Conservation Biology 2003; 17(5):12991311. Ryder O.A., ve ark. DNA banks for endangered animal. Science 2001; 288 (5464):275. Wakayama, S. Kishigami, N. Van Thuan, H. Ohta, T. Hikichi, E. Mizutani, R. Yanagimachi, and T. Wakayama. From The Cover: Propagation of an infertile hermaphrodite mouse lacking germ cells by using nuclear transfer and embryonic stem cell technology. PNAS, January 4, 2005; 102 (1): 29 33. Shivaji S, Kholkute SD, Verma SK, Gaur A, Umapathy G, Singh A, Sontakke S, Shailaja K, Reddy A, Monika S, Sivaram V, Jyotsna B, Bala S, Ahmed MS, Bala A, Chandrashekar BV, Gupta S, Prakash S, Singh L. Conservation of wild animals by assisted reproduction and molecular marker technology. Indian J Exp Biol 2003; 41(7):710723. Stachecki JJ, Cohen J. An overview of oocyte cryopreservation. Reprod Biomed Online. 2004 Aug; 9 (2): 15263. Toyooka Y, Tsunekawa N, Akasu R ve Noce T. Embryonic stem cells can form germ cells in vitro. PNAS 2003; 100:11457‐11462. Troy C. S., MacHugh D. E., Bailey J. F., Magee D. A., Loftus R. T., Cunningham P., Chamberlain A. T., Sykes B. C. ve Bradley D. G. Genetic evidence for neareastern origins of domestic cattle. Nature 2001; 410: 10881091. Wildlife Conservation and Monitoring Centre ( www.wcmc.org.uk ). Zwaka T. P. ve Thomson J. A. A germ cell origin of embryonic stem cells? Development January 15, 2005; 132(2): 227 233. SUSTAINABLE BREEDING, FARMING AND UTILISATION OF AUTOCHTHONOUS CATTLE, SHEEP AND GOAT BREEDS IN SERBIA V. BOGDANOVIC*1, P. PERISIC1, R. DJEDOVIC1, S. STOJANOVIC2 1 Institute of Animal Sciences, Faculty of Agriculture, University of Belgrade, Serbia Ministry of Agriculture, Trade, Forestry and Water Management, Division for Rural Development, Belgrade, Serbia * Corresponding author: vlbogd@agrif.bg.ac.rs 2 Abstract In difference to the breeding and farming strategy for high productive, exotic breeds, the breeding and farming strategy for autochthonous livestock breeds should, in optimal way, combine genetic improvement and sustainable development and utilisation of animal population. The aim of this paper is to present the most important traits of some local cattle, sheep and goat breeds in Serbia, along with some characteristics of breeding programmes designed for them as well as ways for their sustainable farming and utilisation. It should be pointed out that similar autochthonous cattle, sheep and goat breeds are spread out not only in Serbia but also in almost all Western Balkan and Southern‐East European countries. Like any other local, autochthonous breed of domestic animals, these breeds of cattle, sheep and goat are characterised by relatively low production level. However, although autochthonous breeds of cattle, sheep and goat cannot be compared in intensive production with high productive breeds, they could be important in low‐input production systems, as well as in specific types of production (for example organic or traditional livestock production systems). Besides that, the breeding of autochthonous breeds and strains of cattle, sheep and goat could also be interesting for the farmers who are directed to some additional forms of making profit in agriculture such as agro‐tourism. Finally, improving and utilization of local breeds should always be related to the region in which this breed is being grown what always add some extra value to products obtained from these breeds. Key words: animal genetic resources, breeding strategy, farming of autochthonous breeds, utilisation of autochthonous breeds Introduction Cattle, sheep and goat raising have a very long tradition in Serbia. By the Second World War the livestock production was mostly based on raising local, autochthonous breeds, but after the war the raising of exotic, high productive breeds along with the crossbreeding of local with imported breeds was being forced. A result of this process was an irretrievable loss of genetic diversity of local breeds and their assimilation into transitional and/or improved types. However, recently there has again been seen a growing interest among breeders for raising the local, autochthonous breeds of cattle, sheep and goats. In difference to the breeding and farming strategy for high productive breeds, the breeding and farming strategy for autochthonous livestock breeds should, in optimal way, combine genetic improvement and sustainable development and utilisation of population (Notter, 1999). This is extremely important since one of the greatest dangers for small populations of local breeds is increased level of in‐breeding among animals. Besides, the local breeds should have some definite, specific traits in order to be as more attractive as possible. The aim of this paper is to present the most important traits of some local cattle, sheep and goat breeds in Serbia, along with some characteristics of breeding programmes designed for them as well as ways for their sustainable farming and utilisation. 60 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Autochtonous cattle, sheep and goat breeds in serbia Thanks to the similar natural, zootechnical and agronomical conditions similar local breeds of cattle, sheep and goats have been developed in Serbia as in the wider region of Western Balkan. It's not seldom in this geographical area to find cattle, sheep or goat breeds that are basically the same and which differ only in one or several traits. The largest population of autochthonous sheep breed in Serbia is a so‐called zackel sheep (local name is “Pramenka” and it derives from the form and the type of the fleece of this breed: the word “Pramen” in all South Slavic languages means “a lock of wool or hair”). The characteristic of this breed is that there are many strains inside the breed which are mutually more or less different in number and traits. It should be stated that a zackel sheep is still widely spread in almost all regions of entire ex‐Yugoslavia. Besides that, more or less similar breeds of sheep can be found in almost all countries of South‐Eastern Europe, and especially in Balkans region (Romania, Bulgaria, Greece, Albania, etc.). A domestic zackel sheep, according to its origin, belongs to a primitive breed type. It is the triple‐purpose sheep and therefore used for producing milk, meat and wool. In the same way as other primitive breeds, the production traits in zackel sheep are poorly expressed. However, its good quality is manifested primarily in its modesty in regard to the conditions of nutrition, husbandry and care, as well as to the resistance to external environmental conditions. This breed of sheep has a medium large body, covered with coarse wool of mostly white, and more rarely darker color. The head is narrow and long, the rams are horned while the ewes are mostly hornless. In regard to body dimensions the dominant is the length while the width is somewhat less demonstrated. A domestic zackel sheep is a late maturing breed of sheep. It attains its sexual maturity in the age of 16 to18 months, the growing being completed when they are 3 or 4 years old. Body weight in adult female animals depending on the strains ranges between 40‐60 kg, and in rams 65‐80 (100) kg. Milk yield of this breed varies considerably from strain to strain with an average being about 100‐120 kg in lactation lasting about 160 days. In Serbia there are several strains of zackel sheep, such as svrljig, krivovir, lipa, pirot, sjenica and vlashko‐vitoroga. Beside Serbia, this breed of sheep is also present in wider region of Western Balkan, such as dubian, privorian, kupres and herzegovian (in Bosnia and Herzegovina), istrian, lika, island sheep (pag, rab, krk, cres) and dalmatinian (in Croatia), karakachanian, sharplaninian and ovchepolian (in Macedonia), piva, ljaba, bardoka and zeta’s yellow face (in Montenegro) etc. The most represented local breed of goat in Serbia is a Balkan goat which can also be found in almost all South‐East European countries. A Balkan goat is a native, low productive breed as well. Like in all primitive breeds, productive and reproductive traits are poorly demonstrated in Balkan goat, but it is highly resistant to environmental factors, as well as to harsh conditions of nutrition and raising. It is primarily raised for milk production, while the production of kid meat is of secondary importance. In lactation lasting about 210 days an average milk yield in Balkan goat is 360‐380 kg, while a body weight of adult female animals is about 50‐65 kg. Among the cattle breeds, the most widespread local breeds in Serbia are busa and podolian. After WWII busa cattle was systematic crossed with differed exotic breeds such as Simmental, Hereford, Montafon and Tyrol grey. Unfortunately, these crossbreedings were carried out without serious breeding programme and consequently without beneficiaries. Busa is also spread out not only in Serbia but also in all the countries of Western Balkan, with similar morphological characteristics and production. The color of the animal can be grey, yellow, red or black. The live weight of adult animal is about 400 kg (males) and 200‐300 kg (females). It is late maturated well‐ adapted durable animal in harsh conditions, disease resistant and can survive the winter period with small amount of grain. It is used for milk and meat production, but also as draught animal. Podolian breed cattle belongs to a group of gray, long‐horn cattle, with large body size, good strength and robustness and are intended primarily for work. The average values for height at Sustainable Breeding, Farming And Utilisation Of Autochthonous Cattle, Sheep And Goat Breeds In Serbia 61 withers and hip of full grown cows are about 125 cm and 128 cm, respectively. Same dimensions for 3 years old bulls are about 124 and 128 cm. Body weight of cows is between 422 and 560 kg, and bulls from 650 to 900 kg. The podolian cattle are very important as a resource of genes for disease resistance, robustness and other important traits that are not characterized by exotic breeds. In addition, podolian cattle may have significance for low‐input or traditional beef production systems. Breeding strategy for autochtonous cattle, sheep and goat breeds in Serbia Theoretically observed, the breeding goal represents the aimed genetic improvement of certain traits realised in successive generations of animals which accomplish the desired production within the future, but expected economic, social and agro‐ecological production conditions. As in the commercial breeding programmes, the aim of the selection within one closed population is the increase of the average level of the genetic value for a certain traits (Montironi et al., 2006, Serradilla and Ugarte, 2006). Beside the improvement of the economically important traits, the breeding programmes in the small populations first of all must provide the increase of the effective size of the population with the aim to limit and decrease inbreeding, as well as the decrease of the variance in the size of the family. This is mainly achieved with the “circular breeding plans”. This breeding scheme starts from the equal number of base animals (male and female) which are not kin related, and in each herd replacement the sire is being replaced with one of the sons, and dam with one of the daughters. By maintaining or increasing the effective size of the population it is possible to perform the selection of the economic important traits. Rates of improvement that are possible to achieve in some important economic traits although modest (typically of 0.5 to 2% of the mean per annum), can result in cumulative changes over the long term. Having in mind that the selection pressure on the autochthonous cattle, sheep and goat breeds in Serbia has not been extremely expressed, it is real to expect that the present traits variability provides a relatively good base for aiming the populations in the desired way. In addition, the shortage of the generation interval by the change of the presence of certain age categories in the sense of presence of younger animals and the animals that are the production peak, comparing the older animal, can additionally impact on the genetic improvement of the traits. On the other hand, when the population gets near or reaches the selection limits, either it was caused by the decrease of the effective size or performing the strong selection, it is necessary to intervene in the sense of migration of genes among different herd within a certain population, or, even, among different breeds. But, the migration of genes between breeds can cause in great sense the loss of a certain part of the characteristic genetic variability, so crossbreeding should be avoid within the populations of autochthonous livestock breeds or strains. If it is, still, necessary to perform the crossbreeding, it is desirable to choose the most similar breed so that the genetic identity of the breed which is being refreshed or improved can be saved as much as possible. Important factors which often effect on the realisation of the breeding programmes in small and/or closed populations of domestic animals are the lack of the necessary infrastructure for performing the control of the productivity, nucleus herds (if there are any) are very small parts of the whole population, the lack of reliable pedigree information, as well as the difficult assessment of the genetic value of the breeding animals. In addition, it is necessary to have in mind that one of the characteristics of the autochthonous cattle, sheep and goat breeds or strains is their excellent adaptability to the local zootechnical and ecological conditions, but at the same time the small productivity. By the improvement of the feed conditions, the husbandry and care and at the same time, by performing the strong selection of the parental couples it is possible to improve certain traits, first of all those which reflect in average or high coefficients of heritability such as the traits of milk production, beef and growth traits or carcass traits. 62 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Breeding goals for autochthonous breeds of cattle, sheep and goats in Serbia need to combine several demands. First of all, selection process should be performed on those traits that are economically significant and which contribute to the improvement of certain production. On the other hand, it is important to maintain a constant population size large enough to carry out breeding programme (Bogdanovic et al, 2006; Bogdanovic et al, 2007). At the moment there are a small number of breeders' associations that primarily raise autochthonous livestock breeds which greatly hinders the implementation of efficient and sustainable breeding programme. However, breeding programmes for certain breeds of cattle and sheep are implemented or are planned to be carried out in Serbia. A major approach in defining the aims for local breeds of cattle, sheep and goats in Serbia has been to use, in optimal way, a genetic potential of breed and/or strain in real production and breeding conditions. For a domestic zackel sheep two breeding programmes have been defined, for the lamb production and for the milk production. Both aims should also be regarded as the aims for combined direction of production, since breeders expect to realize profit on the basis of milk production and also on the basis of selling lambs, and vice versa. Besides these primary aims, each of the strains of domestic zackel sheep has certain characteristics that influenced the breeding programmes making them to be specific in certain way. The breeding programme for Balkan goat is primarily directed towards milk production, the production of kid meat being of secondary interest, since yet there are no breeders who would raise the goats for meat primarily. A previous research on milk yield in Balkan goat raised in low‐input husbandry systems (Bogdanovic et al., 2010) leads to a conclusion that there is enough variability included in these traits for a selection to be successfully performed on these traits. For both zackel sheep and Balkan goat family breeding scheme is proposed in order to avoid increasing in coefficient of kinship. According to FAO criteria busa and podolian cattle belong to seriously endangered livestock breeds. Number of pure‐bred busa and podolian cattle in Serbia is very small and do not exceed a couple of hundreds. Breeding objectives and strategy are focusing on sustainable improvement of milk and beef traits and avoiding inbreeding problems. Milk production is of primary importance for busa cattle while beef production traits and robustness are the most important for podolian. Farming and utilisation of autochthonous cattle, sheep and goat breeds in Serbia In many rural areas not only of Serbia but other European countries as well, a livestock production, and especially ruminant production represents one of the main driving force of local economy and development (Georgoudis et al., 2006). Taking into consideration that it is quite likely for the products of Serbia obtained in conventional livestock production to be hardly competitive on European food market for a long time, one of the possibilities for Serbian food products to be more represented on the markets of European countries is the production of local, autochthonous products with Protected Designation of Origin or Protected Geographical Indication (various kinds of autochthonous cheeses or meat products). The small and medium farms have the most important role for the conservation of the autochthonous cattle, sheep and goat breeds, rural environment and landscape, and most are linked to dairy and meat production. They usually rely only on marginal resources such as mountain summer pasture, fallow arable lands as well as marginal pastures in winter and they are economically weak. The economic efficiency of the farms is hard to assess because they are mostly semi subsistent or subsistent. Also, the autochthonous cattle, sheep and goat breeds play a major role in low‐input, traditional and organic production systems. Many imported or exotic breeds are not fully adapted to the local husbandry systems and environment. The adaptation is achieved after many generations have been exposed to such aspects as altitude grazing, poor forages, basic housing and management systems and even extends perhaps to local parasites. Sustainable Breeding, Farming And Utilisation Of Autochthonous Cattle, Sheep And Goat Breeds In Serbia 63 In all cases the existing autochthonous breeds have been developed over long periods of history to become fully adapted to the local Serbian conditions. Some sheep breeds can trace their origins to migrations dating back to Roman times (Drăgănescu, 2007) as can native cattle breeds or goat. Serbia’s native cattle, sheep and goat are recognized by many international institutions (and the EU) as adapted indigenous breeds and that they are accepted as a necessary part of specific agro‐ ecosystems. Where natural selection has acted very strongly for the adaptation of breed to the utilisation system, the breed type, the historic objective of genetic improvement programs can be seen evidently connected to the production system and to environmental constraints. The same breed (for example zackel sheep or busa cattle) has been recommended to different livestock production systems (low‐input, traditional or organic) from the same geographical climate and distinct strains have been developed and it is only now being realized that this is a centuries old system of animal management for applied ecology. Cattle, sheep and goat farming contribute substantially to the maintenance of Serbian biodiversity. These autochthonous livestock breeds retain important part of genetic diversity, although this is now under pressure and thought must be given to their maintenance in locally adapted breeds and strains in the best possible ways, i.e. by sound husbandry and utilization. By avoidance of destocking and under grazing it may be still possible to overcome serious negative effects of loss in botanical diversity in hilly or mountain and other sensitive pastures. Autochthonous cattle, sheep and goat breeds such as the various strains of zackel sheep play an important role in the sustainable use of Serbian marginal grassland systems. Each autochthonous breeds observed in Serbia have developed to be flexible to suit local needs and conditions. This leads to the conclusion that autochthonous cattle, sheep and goats should not be compared to other modern livestock enterprises in terms of economic factors only. They do not fit well into the intensive, industrialized, high‐input mass‐production systems aimed at producing food at the lowest possible cost. It should be noted that keeping and raising of autochthonous cattle, sheep and goat breeds should be sustainable and economically efficient. A good way for it is making chain from autochthonous breeds to autochthonous food products. Wide diffusion of production systems, very different working conditions and processing tradition caused diversity and great number of traditional meat and dairy products. There are two major groups of traditional dairy products in Serbia: cheese and so‐called “kajmak” or “skorup”. The most distinguished traditional dairy products are produced from ewe’s milk or cow’s milk, but today there are also made of mixed or goat milk . Cheese is the most important product group and the brain cheeses are predominant. Very popular cheeses are also so‐called “plastic curd”, hard and whey cheese. On the other hand, kajmak is a specific, fat‐rich autochthonous dairy product, very tasty, spreadable product and is very often used as a butter substitute. On the other side, meat products are mainly produced from beef or lamb/sheep. These include dry ham, different type of dried or smoked sausages etc. Although autochthonous breeds of cattle, sheep and goat cannot be compared in intensive production with high productive breeds, they could be important in low‐input livestock production systems, as well as in specific types of production (for example organic or traditional livestock production). Besides that, the breeding of autochthonous breeds and strains of cattle, sheep and goat could also be interesting for the farmers who are directed to some additional forms of making profit in agriculture such as agro‐tourism. Finally, improving and utilization of local breeds should always be related to the region in which this breed is being grown what always add some extra value to products obtained from these breeds. 64 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Conclusions According to the researches that have been carried out, it could be concluded that the autochthonous cattle, sheep and goat breeds in Serbia have a good biological base not only for the genetic improvement but also for sustainable farming and utilisation. Improving the relevant production and reproduction traits can effect the improvement of the efficiency of the production which would results with the higher economic sustainability on the farm. Besides this, the breeding, keeping and utilisation of the autochthonous cattle, sheep and goat breeds can be interesting for those farms which are determined not only for low‐input livestock production systems but also for some other additional forms of operating such as, among others, the agro tourism. There are numerous positive examples from the countries in which the agro tourism is well developed that the breeding of the autochthonous livestock breeds is exceptionally well fit into this kind of tourism. REFERENCES BOGDANOVIC , V., PERISIC, P., DJEDOVIC, R., POPOVIC, Z., MIJIC, P., BABAN, M., ANTUNOVIC B. (2010) Characteristics of dairy production traits of Balkan goats raised under “low‐input” production systems. Mljekarstvo (Dairy), 60 (1), 30‐36. BOGDANOVIC, V., DJEDOVIC, R., PERISIC, P. (2007) Breeding objectives and strategy for autochthonous cattle breeds in Serbia. 58th Annual Meeting of the EAAP, Dublin, Ireland, Book of Abstracts No. 13, 360. BOGDANOVIC, V., DJEDOVIC, R., PERISIC, P. (2006) Breeding goals for autochthonous strains of sheep in Serbia. Proceedings of the 8th World Congress on Genetics Applied in Livestock Production (ISBN: 85‐ 60088‐01‐6), 13‐18 August, 2006, Belo Horizonte, Brasil, 01 CD ROM. DRĂGĂNESCU, C. (2007) A note on Balkan sheep breeds origin and their taxonomy. Archiva Zootechnica, 10, 1‐ 12. GEORGOUDIS, A., LIGDA, Ch., ÔARAYREH, J. AL (2006) Genetic charcterization of local genetic resources and its use for sustainable management. In: Animal products from the Mediterranean area (EAAP publication No. 119). J.M.C. Ramalho Ribeiro, A.E.M. Horta, C. Mosconi & A. Rosati (editors). Wageningen Academic Publishers, The Netherlands, 137‐144. MONTIRONI, A., STELLA, A., GANDINI, G. (2006) Comparative analysis of selection schemes in small cattle population. 57th Annual Meeting of the EAAP, Antalya, Turkey, 17‐20.09.2006. Book of abstracts No. 12, 26. NOTTER, D. R. (1999) The importance of genetic diversity in livestock populations of the future. Journal of Animal Science, 77, 61‐69. SERRADILLA, J.M., UGARTE, E. (2006) Emerging genetic programs for small dairy ruminants. Proceedings of the 8th World Congress on Genetics Applied in Livestock Production (ISBN: 85‐60088‐01‐6), 13‐18 August, 2006, Belo Horizonte, Brasil, 01 CD ROM. HONAMLI GOAT: RISING STAR OF THE TAURUS MOUNTAINS Bekir GÖK, Ahmet Hamdi AKTAŞ, Şükrü DURSUN Orta Anadolu Bahri Dağdaş Tarımsal Araştırma Enstitüsü, Konya ABSTRACT This study was conducted with a 200 Honamli goat flock protected as a native animal genetic resource kept in breeder conditions in Seydişehir Township of Konya Province in 2010. The live weights, reproductive performance and body measurements of goats were measured. The body measurements, survival rate at weaning and live weights of kids were monitored as well. The lambing rate of the goats was 91.8%, twining rate 24.7%, triplets lambing rate 0.6% and litter size was 1.26. The height at withers was 90.4 cm, body length was 89.8 cm for female goats. The average live weight of 28 female goats and 10 male goats was 73.4 and 88.9 kg, respectively. The birth weight of 25 male and 14 female kids was 4.9 and 4.3 kg. Their weight at weaning for male and female was 25.1 and 19.5 kg, respectively. The survival ability rate of kids at weaning was 93.3%. As a result, it was noted that the genetic capacity of Honamli goats for live weight gain and development were very high. Thus it is high likely that well planned and cautious long term improvement studies on Honamli goats will pay off. Key Words: Honamli Goat, Reproductive Performance, Body Measurements, Live Weights and Survival Ability Rate ÖZET Bu çalışma, Yerli Gen Kaynaklarının Korunması Projesi kapsamında, Konya İli Seydişehir İlçesinde, 200 başlık bir Honamlı sürüsü üzerinde 2010 yılında yürütülmüştür. Çalışmada keçilerin döl verim özellikleri, keçi ve oğlakların canlı ağırlıkları ile vücut ölçüleri ve oğlakların sütten kesime kadarki yaşama güçleri incelenmiştir. Araştırmada keçilerin doğum oranı %91.8, ikiz doğum oranı %24.7, üçüz doğum oranı %0.6 ve doğuran keçi başına doğan kuzu sayısı ise 1.26 olarak tespit edilmiştir. Ergin keçilerde cidago yüksekliği 90.4 cm, vücut uzunluğu 89.8 cm olmuştur. Ergin canlı ağırlıklar 28 baş dişide 73.4 kg, 10 baş erkekte ise 88.9 kg olarak bulunmuştur. 25 baş erkek oğlağın doğum ve sütten kesim ağırlığı sırasıyla 4.9 kg ve 25.1 kg, 14 baş dişininki ise 4.3 kg ve 19.5 kg, oğlakların sütten kesim kadarki yaşama güçleri ise %93.3 olarak tespit edilmiştir. Sonuç olarak Honamlı keçilerinin canlı ağırlık kazancı ve büyüme özellikleri yönünden genetik kapasitelerinin oldukça yüksek olduğu söylenebilir. Bu nedenle iyi bir planlama ve uzun süreli bilinçli bir ıslah çalışması ile bu özellikler yönünde büyük ilerlemeler sağlanabilir. Anahtar Kelimeler: Honamlı Keçisi, Döl Verimi Özellikleri, Vücut Ölçüsü ve Yaşama Gücü Oranı INTRODUCTION Natural and economic conditions, agricultural structure and traditions of Turkey are commonly suitable for sheep and goat farming and convenient to hold an important place in the country agriculture (Anonymous, 2001). For sustainability of using forests, goat farming should be in forest, but these issues still not understand. However, improvements are going to this direction in the world. To keep control under vegetation of forests in the most of developed countries, due to lack of a sufficient number wild herbivores deteriorating of natural areas and goats utilized to control over‐developed flora (Akbağ, 2010). 66 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Goat is a farm animal that is marked to the Anatolian culture. Raised by the nomad’s tribe Honamli which has a part of Anatolian culture, and they have been preserved until today by this nomad tribe which is the same name of this goat defining characteristics of the Honamli goat breeds in this area, and also the data of Honamli breeds identification, protection and determination of rural area will provide significant contributions to the scientific world. Total number of goat in Turkey is 5.593.560 head and approximately 90% of the hair goat (Anonymous, 2009). Konya has an important potential of small ruminants with 1.380.442 sheep and 113.667 goats (Anonymous, 2011). However, these breeds’ yields are low. Hair goats are mostly grown in the mountainous terrain and its environs, virtually at no cost. Although knowing the presence of goat Honamli, the morphological and physiological characteristics of this breed are unclear scientifically. Determination of some morphological and physiological characteristics and the natural living space data obtained from the native gene sources Honamli goat breeds is important to reveal. Honamli is combined productive goat. Priority order is meat, milk and hair. The body is mostly black. A pure bred goats Honamli forehead and feet are white or brown and body is black in the region of Antalya. Sometimes grizzled color goat can be seen. Horns in the male curled around its axis is a well‐developed than the females, ear tips down backwards and forwards in an arc around longer. The breed is heavy build with a thin and long body structure. The tail is like a tuft appearance and longer than that of hair goat. The ears are small and thick. One of the purity characters of breeds’ is distance of between horns of his forehead. This distance should be 2 fingers (2 cm). The most remarkable feature of the structure is also an arched nose. Although the hair goats spread over the Turkey, the number of goats declining on dry steppe pastures in Central Anatolia, but they are increasing coastal strips and in particular on the forests and bush areas. Because extensive leaf branch in the forest and grassland areas is benefit for the goat hair. Hair yields are 400‐500 g for female, 900‐1000 g for the bucks. Average milk yield can be raise up to 50‐60 kg, 120‐130 kg under a good feeding and maintenance conditions, and lactation period may be 7‐8 months. Milk fat is also 4 to 4.5%. Meats are usually consumed enjoyable by the public which in the goat grown region. Live weight ranged between 35‐55 kg and carcass yield can be up to 51.5%, related with slaughtering condition (Sönmez, 1975; Şengonca, 1974; Tuncel ve Yener, 1983 ve Yarkın, 1965). Female goat’ withers height, heart girth and body length, average milk yield, average adult female and male goat weights were reported as 69.3 cm, 78.7 cm, 67.7 cm, 98 kg, 40‐65 kg, 45‐90 kg, respectively (Anonymous, 2004). Morphologic measurements such as body weight, wither height, heart girth, rump height and body length for adult male and female Anatolian Hair Goat were reported as 64.0 kg, 50.2 kg; 81.8 cm, 73.1 cm; 98.8 cm, 88.2 cm; 81.8 cm, 73.5 cm; 81.7 cm, 74.2 cm, respectively (Cam et al., 2010). Sengonca et al. (1970), has done a study of the aiming goat breeding that between Malta and Saanen goats are crossbreed in Ege University Faculty of Agriculture. Results are showed that Malta x Hair and Saanen x Hair crossbred (F1) animal breast shapes are suitable for mountainous areas and shrubbery. This study conducted under the good care and feeding conditions and in terms of gender, and kid number the average birth weight ranged between 2.570 to 2.960 kg for Malta hybrids, 2.422‐ 3.127 kg for Saanen hybrids. At the same order the average weaning weights are also ranged between 14.00 to 20.44 kg and 16.07‐19.63 kg respectively. Malta x Hair goat (F1) and Saanen x Hair Goat (F1) hybrids in first lactation milk yield were 310 ‐ 404 kg, and lactation periods, 279.8 ‐ 298.5 days respectively. The average number of kids at first and second lambing were determined as 1.33 ‐ 2.11 for Malta crossbreds, and 1.41 ‐ 1.71 for Saanen crossbreds respectively in this study. In addition, they reported survival rate up to weaning of Saanen x Hair Goat (F1) as 94.1%. Honamli Goat: Rising Star Of The Taurus Mountains 67 Sönmez (1976) reported that in his study with Hair and Saanen x Hair Goat (F1) crossbred kids; birth weight values of hair goats has found as the lowest (2.50 kg) in single females, the highest in twin boys as 3.02 kg; Saanen x Hair (F1) hybrids, the lowest value for the birth weight in single females as 2.88 kg, the highest value in twin boys as 3.20 kg; At three months weaned hair goat kids of weaning weight was the lowest in twin females as 11.33 kg, the highest in twin boys as 12.54 kg and in the Saanen x Hair Goat (F1) crossbred kids the lowest value in twin females as 10.98 kg and the highest in twin males 14.68 kg. The daily live‐weight gain of Hair goat kids during the milk intake period was the lowest in twin females as 0,102 kg, the highest in male twin boys as 0,113 kg, Saanen x Hair Goat (F1) hybrids, the lowest in twin females as 0,093 kg, the highest in male twin boys as 0.144 kg. Özcan (1977), reported in his study, Saanen x Hair Goat (F1) crossbreds birth weight was 3.60 kg; for at the 2. month weaned hybrids (F1) withers height, body length and heart girth values were 52.70 cm (min. 45, max. 54.5), 52.80 cm (min. 41, max. 56) and 56.30 cm (min. 54, max. 60.0) respectively. At the 1th age of females withers height, body length and heart girth the values were 65.0 cm (min. 59, max. 71), 66.6 cm (min. 64, max. 70) and 78.3 cm (min. 73, max. 84) respectively. Güney et al. (1990), reported that in their study with the German Friesian Goat x Hair Goat (G1) hybrids daily live‐weight gain was 0,202 kg, feed efficiency value as 3.60 kg. Çam et al. (2003) reported that the average Hair goat milk yield was found 93.8±1.37 kg, after measuring goat milk yield at the local conditions in a private enterprise in Bafra district of Samsun Province. Şengonca et al. (2003), informed that in their study at the keeper conditions, Pure Hair Goats and Saanen x Hair Goat (F1) hybrids birth weight were 2.63 and 3.70 kg; weaning weight 12.12 and 14.68 kg; average daily milk yield 0.56 and 1.83 kg respectively. Lactation length 143.7 and 201.5 days, and lactation milk yield averaged 80.47 and 201.77 kg. Survival ability rate up to weaning age was 76.61% and 95.76% respectively. Average daily milk yield, lactation length and lactation milk yield were affected by herd, year and age. Tuncel and Bayındır (1983), reported that Hair Goat and Saanen x Hair Goat hybrids (F1) survival ability rate up to weaning age were 88.00% and 85.20% respectively. Şimşek and Bayraktar (2006) informed that in their study Hair goat and Saanen x Hair Goat hybrids (F1) birth weight values were 2.77 and 2.95 kg; weaning weight values as, 16.05 and 14:14 kg; daily live weight gain during the milk intake period as 0,147 and 0,124 kg; survival rate as %82.50 and %90.62 respectively. Pure and crossbred female goat’s survival rate at the first age as 76.47% and 81.25% were found respectively. They have reported that deaths of kids concentrated mainly in the first 0‐5 days, and due to deaths increase particularly at a time when the twin born kids when harsh weather conditions. In this study also examined, and Saanen x Hair Goat Hair goat hybrids (F1) for withers height were found as 38.20 and 39.41 cm at 1. month, respectively; the body length as 35.67 and 35.58 cm, chest circumference as 44.65 and 45.53 cm; the same order at 3. in months (weaning age), withers height was 45.17 and 45.33 cm; body length as 43.06 and 43.42 cm; heart girth 53.53 and 55.03 cm. Same characteristics at the 1 of age, withers height was 59.42 and 69.95 cm, body length as 60.15 and 60.54 cm, and chest circumference 73.26 and 73.55 cm, respectively. Şimşek et al. (2007) reported that in their study with Saanen x Hair Goat (F1) and (G1) hybrid genotypes at least squares means for birth weights was 2.18 and 2.82 kg, respectively; weaning weight was 14.07 and 15.62 kg; daily live weight gain during milk intake was 0,131 and 0,141 kg, respectively. The survival rate values of genotypes at the weaning age were 86.20 and 81.25%, respectively. At the birth time, withers height was 27.56 and 29.13 cm; body length as 24.11 and 25.78 cm; chest circumference 31.70 and 34.62 cm respectively. The same order at 3 in months (weaning age), withers height was 45.18 and 47.81 cm; body length as 43.46 and 46.44 cm; chest girth as 54.14 and 54.98 cm respectively. 68 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) MATERIALS and METHODS This study has begun in 2005, under the Ministry of Agriculture and Rural Affairs, General Directorate of Agricultural Research (GDAR) implemented by the "Animal Genetic Resources‐Site Protection Project". This project was carried out by Bahri Dağdaş International Agricultural Research Institute with 200 head protected Honamli goat flock in Gökçehüyük village of Seydişehir district of Konya Province. Protection goat flock composition was 184 head female goat and 16 head is male goat. Keeper herd size was 350 head, but 200 head goat protected of all. For this study, 194 heads female goats, 10 heads male and 39 head kid material were used. In this project, Honamli goats feeding are based on pasture except the snowy winter period. The time of the close to birth in the snowy winter months, goats feeding was based on straw and dry grass with a small amount of grain‐supported like a intensive feeding. Goats grazed on the pasture after birth in April. Kids grazed separately after weaning age. In this study, survival ability rate of kids at the weaning age, mature body weights and Honamli goats reproductive performance of the offspring born in 2010 and body measurements of adult Honamli goats, the mean body weight in different periods of kids and body measurements up to weaning age of Honamli kids were determined. RESULTS and DISCUSSION Reproductive Performance of Honamli Goats Reproductive performance of Honamli goats has given on the table 1. As can be seen the lambing rate, 91.8%, the twinning lambing rate, 24.7%, the triplets lambing rate 0.6% while the litter size was 1.26 on table 1. Table 1. Reproductive Performance of Honamli Goats Goat Goat Number Number of Lambing Twinnin Number on Number of Triplets Rate g Rate Fecundity of lambing Twinning Lambing Lambing 194 178 44 1 91.8 24.7 Triplets Rate 0.6 Number Litter Fecundity of Lamb Size Rate 224 1.26 1.15 Survival Ability rate of Honamli Kids at Weaning Survival ability rate of Honamli Kids at weaning time has also given on table 2. After examining on table 2, the value of survival rate of Honamli kids at weaning was found 93.3%. This value is higher than the values acquired of Tuncel and Bayındır (1983), with Hair Goat and Saanen x Hair goat (F1) hybrids values that 88.0% and 85.2%, respectively. Our obtained value are close to Şengonca et al. (1970)’s value (94.12%) of survival ability rate at weaning with Saanen x Hair Goat (F1) hybrids. Table 2. Survival Ability Rate of Honamli Kids at Weaning (90. Days) Number of Live Kids at Lambing Number of Dead Kids up to 30. Days Number of Dead Kids Between 30 ‐ 60 Days Number of dead kids between 60 ‐ 90 days Number of Dead Kids up to Weaning Number of Living Kids at Weaning Survival Ability Rate at Weaning, % 224 12 3 0 15 209 93.3 Honamli Goat: Rising Star Of The Taurus Mountains 69 Live Weight and Body Measurements of Adult Honamli Goats Average live weight and body sizes of different ages of Honamli adult goats have given table 3. Live weight, withers height and body length values of adult Honamli goats with average age 4.7 years were found 73.4 kg, 90.4 cm, 89.8 cm, respectively (Table 3). The same values of billy goat’s average age 3.1 years were found 88.9 kg, 96 cm, 98.3 cm, respectively. Table 3. Average Live Weights of Honamli Goats and Body Measurements, cm ( x ± s x ) Sex n Average Age Live Weight, kg Wither Height Rump Height Body Length Heart Girth Goat 28 4.7 73.4±1.80 90.4±0.60 88.4±0.55 89.8±0.50 95.1±1.00 Billy Goat 10 3.1 88.9±6.10 96.0±1.84 94.4±1.09 98.3±2.56 100.4±3.11 Nose n Tail Length Goat 28 20.7±0.28 24.6±0.27 3.3±0.15 44.5±0.48 11.4±0.13 Billy Goat 10 23.6±0.95 25.1±0.50 3.21±0.28 45.1±1.08 14.5±0.50 Sex Length Distance Among Horns Left Front Shinbone Neck Length Average Live Weights of Kids in Different Periods Average live weights (LW) of Honamli kids in different periods have given table 4. In the study, average LW of new born male kids was 4.7 kg and females 4.3 kg. Average LW for male and females at 30, 60 and at 90th days were found 10.9, 9.6; 16.6, 15.2 and 25.1, 19.5 kg, respectively. These values are higher than Sengonca et al. (2003)’s findings which birth weights as, 2.63 and 3.70 kg, weaning weight, 12.12 and 14.68 kg respectively obtained from the keeper conditions with Pure Hair goats and Saanen x Hair Goat (F1) hybrids. Our values obtained in this study are higher than Sönmez (1976)’s values which they obtained Hair goat and Saanen x Hair (F1) crossbred kids and Şimşek et al. (2007)’s values which they obtained Saanen x Hair Goat (F1) and (G1) crossbred genotypes. Şimşek et al. (2007) has obtained in their study with hybrid genotypes (Saanen x Hair Goat (F1) and (G1), least squares means for birth weight, 2.18 and 2.82 kg; weaning weight as 14.07 and 15.62 kg respectively, However, these values are lower than that values of found by the Honamli. Table 4. Average Live Weights of Honamli Kids at Various Periods, kg ( x ± s x ) Sex n Birth 30th day 60th day 90th day Male 25 4.7±0.16 10.9±0.36 16.6±0.36 25.1±0.76 Female 14 4.3±0.15 9.6±0.47 15.2±0.47 19.5±1.04 70 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 5. Body Measurements of Honamli Kids, cm ( x ± s x ) Traits n Withers Height Rump Height Body Length Heart Girth Height from Ground 30. days Male 25 49.4±0.57 50.7±0.64 51.4±0.60 49.4±0.47 32.6±0.40 Female 14 47.9±0.51 48.7±0.49 49.9±0.40 48.1±0.88 32.2±0.59 Male 25 56.0±0.31 56.6±0.30 57.4±0.26 55.0±0.30 33.3±0.23 Female 14 54.9±0.50 55.6±0.45 56.4±0.43 54.1±0.47 33.4±0.34 Male 25 65.9±0.67 65.4±0.60 66.7±0.61 66.2±0.62 37.0±0.49 Female 14 61.8±0.97 61.4±0.94 62.8±0.98 62.6±0.66 33.9±0.93 60. days 90. days Traits n Tail Length Nose Length Distance Among Horns Neck Length Left Front Shinbone 30. days Male 25 14.1±0.23 16.0±0.26 3.4±0.15 21.5±0.31 7.1±0.15 Female 14 12.8±0.31 14.8±0.18 3.0±0.23 21.4±0.39 6.9±0.19 Male 25 16.0±0.23 16.6±0.20 3.0±0.15 25.4±0.29 7.7±0.14 Female 14 15.6±0.31 16.1±0.34 2.7±0.21 25.6±0.44 7.7±0.17 Male 25 19.2±0.33 18.8±0.25 2.5±0.17 26.5±0.27 8.5±0.14 Female 14 17.4±0.46 18.4±0.45 3.2±0.18 26.7±0.38 8.7±0.18 60. days 90. days Body measurements of Honamli kids up to weaning time have given table 4. In this study, the mean number of 30th day kids withers height, body length, body length, chest circumference as 48.8, 50.9, 48.9 cm; 60th day kids, 55.6, 57.0, 54.7 cm; 90th day kids, 64.4, 65.3, 64.3 cm respectively were calculated. These values are higher than Şimşek and Bayraktar (2006)’s values which they obtained Hair goats and Saanen x Hair Goat (F1) hybrids. Because they have reported results in their study at in 3rd months (weaning time), as withers height 45.17 and 45.33 cm, body length as 43.06 and 43.42 cm and chest circumference as 53.53 and 55.03 cm respectively; at the 1st of age, withers height as 59.42 and 69.95 cm, body length 60.15 and 60.54 cm, chest circumference 73.26 and 73.55 cm. Şimşek et al. (2007) has obtained in their study with hybrid genotypes (Saanen x Hair Goat (F1) and (G1), withers height as 45.18 and 47.81 cm, body length 43.46 and 46.44 cm in, chest circumference 54.14 and 54.98 cm respectively. However, these values are lower than those values of found by the Honamli. The implementing planned, deliberate and long‐term breeding programs can access more advanced levels in terms of the rapid growth to important indigenous breed of Honamli in that region. Because this study was conducted in 2010 and showed that Honamli goats have in terms of the genetic capacity of the higher level rapid growth and live weight gain than those Hair goats reported in the literature. Improvement in terms of growth characteristic of this breed should be continued for many years until the desired level. For this purpose, Ministry of Agriculture has added Honamli Goat breeding project in 2011 to “small ruminants breeding project in the hands of the people covered by 5 years. The project is covered by 6000 head female goat and 300 head of goat billy goat. To increase Honamli Goat: Rising Star Of The Taurus Mountains 71 the efficiency of breeding project should be continued even more than a few terms after the first 5‐ year period. Yield characteristics values of obtained in this study were higher than Hair goats. In addition, the people live in the region is increasing interest for this breed day by day. Both protection of Honamli goats have perfect adapted to Taurus Mountains and increase revenue of breeders will be possible to supply billy goat to growers in the region and as well as breeding and to use the hybrid of the method. So the weak Turkish goat husbandry will shine like a star with Honamli goat keeping again. REFERENCES Akbağ H., I., Baytekin H. 2010. Günahları Keçiye Yükledik ! Ulusal Keçicilik Kongresi, 24–26 Haziran Çanakkale, s. 426 ‐430. Anonymous, 2001. Hayvancılık özel ihtisas komisyonu raporu. Sekizinci 5 Yıllık Kalkınma Planı, Yayın No: DPT 2574‐ÖİK 587, Ankara 2001. Anonymous, 2004. Yerli Hayvan Irk ve Hatlarının Tescili Hakkında Tebliğ. http://www.gidahatti.com/mevzuat/tarim%20mevzuat/tuzuk/yerlihayvanvehatlarinintescilihakkindateb ligde.pdf. Anonymous, 2009. “Agricultural Data” http:/www.fao.org/faostat/2009. Anonymous, 2011. Konya İli Damızlık Koyun Keçi Yetiştiricileri Birliği 2011 Yılı Verileri, Cam, M.A., and M. Oflaz and E. Soydan 2010. Possibilities of Using Morphometrics Characteristics as a Tool for Body Weights Prediction in Turkish Hair Goat (Kilkeci).Asian Journal of Animal and Veterinary Advances, 2010: 1‐7. Çam, M.A., Oflaz, M., Eser, M., Selçuk, E., 2003. Ekstansif Şartlarda Yetiştirilen Kıl Keçilerinin Bazı Verim Özelliklerinin Tespiti. Ondokuz Mayıs Üniversitesi, Ziraat Fakültesi Dergisi, 2003, 18(2): 38‐42. E., Yener, M. 1983. Keçi Yetiştirme Ank. Üniv. Zir. Fak. Tek. No : 97 Ankara. Güney, O., Pekel, E., Biçer, O., 1990. Alman Alaca ve Yerli Kıl Keçi Irkları Arasındaki Melezlemelerden Elde Edilen Birinci Geriye Melez Erkek Oğlakların Besi Gücü ve Karkas Özellikleri. Doğa Veteriner ve Hayvancılık Dergisi 1990;14: 352‐362 Özcan, L. 1977, Çukurova Üniversitesi Ziraat Fakültesinde Yetiştirilen Kilis ve Kıl Keçilerinin Islahında Saanen ve (G1) Genotipinden Yararlanma Olanakları. Çukurova Üniversitesi Ziraat Fakültesi Yayınları:122, Bilimsel İnceleme ve Araştırma Tezleri: 19, Kemal Matbaası, Adana 1977 Sönmez, R., 1975. Özel Zootekni Ege Üniv. Zir. Fak. Yay. No : 141 Bornova, İzmir. Sönmez, R. 1976 Melezleme Yolu ile Kıl Keçilerinin Süt Keçisine Çevirme Olanakları. Ege Üniversitesi Ziraat Fakültesi Yayınları. No: 226. Ege Üniversitesi Matbaası, Bornova, İzmir. Şengonca, M., 1974. Keçi Yetiştirme. Ege Üniversitesi, Ziraat Fakültesi Yayınları, Ders Kitabı, No: 222, Bornova, İzmir. Şengonca, M., Sönmez, R., Alpbaz, A.G., 1970. E.Ü. Ziraat Fakültesinde yetiştirilen Saanen x Kıl ve Malta x Kıl (G1) melezlerinin çeşitli özellikleri ve verimleri üzerinde mukayeseli bir araştırma. Ege Üniversitesi Ziraat Fakültesi Dergisi 1970; 7: 69‐90. Şengonca, M., Taşkın, T., Koşum, N., 2003. Saanen x Kıl Keçi Melezlerinin ve Saf Kıl Keçilerinin Kimi Verim Özelliklerinin Belirlenmesi Üzerine Eş Zamanlı Bir Araştırma. Turk J. Vet. Anim. Sci. 27: 1319‐1325. Tubitak. Şimşek, Ü.G., Bayraktar, M., 2006. Kıl Keçisi ve Saanen x Kıl Keçisi (F1) Melezlerine ait Büyüme ve Yaşama Gücü Özelliklerinin Araştırılması. Fırat Üniversitesi Sağlık Bilimleri Dergisi (Veteriner) 2006: 20 (3): 221‐238. Şimşek, Ü., G., Bayraktar, M., Gürses, M., 2006. Çiftlik Koşullarında Kıl Keçilerine ait Bazı Verim Özelliklerinin Araştırılması. Fırat Üniversitesi Sağlık Bilimleri Dergisi (Veteriner) 20 (3),221‐227. 72 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Şimşek, Ü., G., Bayraktar, M., Gürses, M., 2007 Saanen x Kıl Keçisi (F1) ve (G1) Melezlerinde Büyüme ve Yaşama Gücü Özelliklerinin Araştırılması. Fırat Üniversitesi Sağlık Bilimleri Dergisi (Veteriner) 2007: 21 (1): 21 – 26. Tuncel, E. ve Ş.Bayındır. 1983. Türkiye'de Keçilerin Genetik Islahı, Avrupa Zootekni Federasyonu Uluslararası Akdeniz Bölgesi Koyun ve Keçi Üretimi Sempozyumu (Çağrılı Tebliğ) 17‐21 Ekim 1983, Ankara. Tuncel, E., Yener, M. 1983. Keçi Yetiştirme Ank. Üniv. Zir. Fak. Tek. No: 97 Ankara. Tuncel, Şengonca, M., 1974. Keçi Yetiştirme. Ege Üniversitesi, Ziraat Fakültesi Yayınları, Ders Kitabı, No: 222, Bornova, İzmir. Yarkın, İ. 1965. Keçi‐Deve‐Domuz Yetiştirmesi. Ank. Üniv. Zir. Fak. Yay. No: 243 Ankara. THE CONSERVATION AND UTILIZTION OF THE GENETICALLY DIVERSE, NATIVE ICELANDIC LIVESTOCK BREEDS, WITH REFERENCE TO SELFSUFFICIENCY AND NATIONAL FOOD SECURITY Ó.R. DÝRMUNDSSON The Farmers Association of Iceland, Bændahöllin, Hagatorg, IS‐107 Reykjavík, Iceland ord@bondi.is ABSTRACT The native livestock breeds of Iceland, all of Nordic origin, have played an important role, both in the self‐sufficiency and the national food security of Iceland, ever since the Settlement over 1100 years ago. This applies especially to sheep, cattle and horses and to a lesser extent to goats and poultry. Although breed populations have fluctuated over time, with the lowest numbers recorded in the late 18th century largely due to the consequences of a major volcanic eruption in 1783, the present populations of sheep, cattle and horses are sustainable as production breeds, showing steady genetic progress in modern breed evaluation programmes, including BLUP evaluation, and all the sheep, dairy cattle and horse products are derived from these native breeds at a self‐sufficiency rate of over 100%. The native Iceland Goat Breed is endangered and the native Iceland Poultry population is small, however, both breeds growing in numbers in recent years. Utilization will continue to support the conservation of all the native Icelandic breeds, not least due to strong traditions and loyality expressed by both the farming community and the general public. Amongst other contributory factors are product quality, food safety and food security. Keywords: Conservation, Food security, Iceland, Livestock breeds, Utilization. Introduction Iceland is a good example of a country where conservation of heritage breeds of Nordic origin is strongly supported by utilization. They are all well known for their great genetic diversity (Aðalsteinsson, 1981, 1993; Eythorsdóttir, 1993; Icelandic Livestock Breeds, 2009) and the Icelandic breeds of dairy cattle, sheep and horses, the only breeds of these species in the country, have been involved in genetic selection programmes for several decades (Árnason and Jónmundsson, 2007; Eythórsdóttir, 2009; Jónmundsson et al., 2007; Kristjánsson, 2007). Generally, good results have been achieved in terms of genetic gain and productive performance, yet maintaining much diversity. FOOD SECURITY Iceland, being a northerly Atlantic island bordering on the Arctic Circle, has always emphasized selfsufficiency of food production and a high level of food security. In particular in times of wars, natural disasters such as volcanic eruptions, disease epidemics and in economic crisis situations such as those experienced in the autumn of 2008, Icelanders at large, value highly the contribution of farmers and fishermen to their national food security. Sufficient fish, meat, milk and eggs and over 50% of the vegetables consumed by the population of nearly 320.000 + large numbers of tourists, are home produced, and fish is exported on a large scale as well as sheep meat and a few other agricultural products (Icelandic Agricultural Statistics, 2009). However, Iceland is dependent on imports of several foods, namely most of the grain, sugar, fruit, and vegetables to a certain extent. There is a potential to grow more crop products in the country with its a grassland‐based livestock sector except for pigs and poultry which depend on grain imports. Thus barley growing is increasing, 74 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) outdoor vegetables such as potatoes, turnips, carrots and cabbages, can be grown on a larger scale, and in geothermally heated greenhouses the production of high quality crops such as tomatoes, cucumbers and peppers can be increased substantially provided the competition with imported produce is not too severe. Novel crops such, as apples, are being considered if the climate gets warmer. What matters most is fair trade and comparable price levels. Since several cost items are externalized on the global market, particularly of products subjected to long distance transport, and, that the market does not appreciate fully the quality and safety of local, home produced commodities, Icelandic agriculture has to cope with several handicaps in spite of substantial state support which in fact is similar to that given in most other European countries. Food security should certainly be amongst the fundamental items on the agenda during the ongoing process of European Union membership negotiations between Iceland and the EU. The important link between local production and consumption, on one hand, and, food security and stability, on the other hand, must be fully appreciated in the global context of sustainable development. The Icelandic livestock sector certainly fits well into that scenario (Dýrmundsson, 2006; 2011). Conservation based on utilization The native livestock breed populations have fluctuated substantially over time, mainly due to natural disasters, disease epidemics and marketing problems, as indicated above. By far the lowest numbers (bottlenecks), since the first livestock census in 1703, were recorded for horses and sheep in 1784 due to the devastating consequences of a major volcanic eruption in 1783, and for cattle in 1871 during a very cold period in the history of Iceland (Table 1). However, as shown in Table 2 the present breeding populations of the native dairy cattle, horses and sheep are sustainable as production breeds. Most of the animals are individually recorded and they are included in modern breed evaluation programmes, including BLUP evaluation. All the breeds are showing steady genetic progress and so far inbreeding has not been a problem (Árnason and Jónmundsson, 2007; Jónsson et al., 2007; Jónmundsson et al. 2007; Kristjánsson, 2007). This shows that within ‐ breed selection, without any introduction of foreign breeds, can be effective provided the populations are large enough and reliable breeding records, based on individual indentification and recording as well as controlled mating, are available. However, the small, endangered goat population is highly inbred and steps are being taken to provent a further decline (Adalsteinsson et al., 1994; Dýrmundsson, 2005; Baldursdóttir, 2010; Sveinsdóttir and Dýrmundsson, 1994). Information on all animal genetic resources in Iceland have been entered into the EFABISnet (The European Farm Animal Biodiversity Information System), including animal cryo records on the CryoWEB (www.efabis.bondi.is). Table 1: Fluctuations in the population sizes of the native breeds (totals of winterfed animals) Breeds Iceland Cattle Iceland Sheep Iceland Horse Iceland Goat Iceland Poultry 1703 (first census) Lowest numbers Highest numbers 2010 36.000 19.000 75.000 74.000 (1871) (1990) 50.000 896.000 (1784) (1977) 8.700 79.000 (1784) (1994) 100 3000 (1960) (1930) n.a n.a 280.000 27.000 820 n.a. 480.000 77.000 729 3000 The Conservation And Utiliztion Of The Genetically Diverse, Native Icelandic Livestock Breeds, With Reference To Selfsufficiency And National Food Security 75 Table 2: Breeds and numbers of breeding livestock in Iceland 2008 Species Breeds Numbers Origin 43.000 native Cattle (dairy) Iceland Cattle importe Cattle (beef) Galloway 1.500* d Aberdeen Angus importe Limousin d importe d Sheep Iceland Sheep 480.000 native (incl. some 1300 Leadersheep) Horses Iceland Horse 44.000 native Goats Iceland Goat 720 native Pigs Landrace importe Yorkshire 3.800 d Duroc importe d importe d Poultry Iceland Poultry 3.000 native Industrial egg 220.000 importe and meat d breeds Mink Fur breeds 37.000 importe d Fox Fur breeds 5 importe d Rabbits Fur, wool and 200 importe meat breeds d FARMERS‘ LOYALITY AND PROTECTION For centuries the farmers of Iceland, have been the guardians of the native livestock breeds. At present the 4.000 farmers, maily livestock keepers, are responsible for the high level of food security in all types of animal products, namely 100% or more in meat, milk and eggs, as indicated above. Agricultural scientists and veterinarians have also contributed in many ways to this development and the breeding societies, supervised on a national basis by the Farmers Association of Iceland, have been actively involved. Amongst crucial factors are longstanding individual recording and breed improvement through genetic selection within each breed, linked with improved feeding and better health control. Moreover, research, advisory work and teaching of animal management skills by the Agricultaral University of Iceland, the Farmers Association of Iceland and other agricultural bodies have also contributed in many ways. However, and bearing in mind the many threats facing animal genetic resources (Pilling, 2010; Rege and Gibson, 2003), there are three main reasons for the strong status of the native, Icelandic, grassland ‐ based breeds today: 1. Strong traditions and loyality, appreciation of their diversity, robustness, versatility and adaptation to local conditions, product quality and sense of cultural heritage – expressed by both the farming community and the general public. 76 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 2. The geographical isolation of the country as an island ensuring as such the absence of several livestock diseases known or even common overseas, even in neighbouring European countries, such as BSE, foot ‐ and – mouth disease, foot rot and liver fluke disease. 3. Strict official import regulations and control applying to all animals and animal products since past experience has shown that Icelandic livestock breeds are susceptible to imported diseases foreign to their immune systems. IMPACT OF GLOBALIZATION The genetic erosion taking place in the world has been of great concern over a number of years. Iceland refers, in its legislation on the conservation and utilization of genetic resources, (Reglugerð, 2005), to the Convention on Biological Diversity (CBD) from 1992 and participates in international cooperation in this field. The Global Plan of Action for Animal Genetic Resources, (AnGR), spear‐ headed by the Food and Agriculture Organization of the United Nations (FAO), is making good progress (Hoffmann and Scherf 2010) and the global livestock sector is being monitored and reported on in considerable detail (The State of Food and Agricultere, 2009). This will hopingly lead to a more critical analysis of the impact of globalization on biodiversity paying special attention to factors such as climate change, peak oil, food prices, food safety, and last but not least, food security. In the process of looking forward we should also reflect upon historical evidence. For clarification I quote two sources: In a recent study of the geographic location, distribution and purebred population size of North European short – tailed breeds of sheep Dýrmundsson and Niznikowski (2010) found that almost 60% of the total population belonged to one of the 34 breeds, namely the Iceland Sheep, mainly kept in Iceland and the only breed of sheep there. Most of the populations have been declining in numbers and it is of concern how small some of them have become, even endangered. Thus it is clear that due to the reasons listed above the Iceland Sheep has benefitted from protection, including the unique leadersheep (Dýrmundsson, 2002) while most of the other breeds have been eroding away due to economic‐, social‐ or other global impacts. In the European Union (EU) efforts are being made to give financial support to keeping endangered breeds, including several of the North Europe short – tails (Council Regulation, 2005; Commission Regulation, 2006). My second reference is more of a political nature, namely from the works of Professor John Hodges, a universally known animal scientist, who has highlighted some of the problems facing world agriculture in a well balanced and clear way (Hodges, 2005a). In discussing the direct links between globalization and capitalism and their effects on the environment, including genetic resources and sustainability, he has, for example, pointed out that – “The threats come from the ideology of capitalism which is a superb system for creating new wealth but which lacks any inbuilt mechanism to avoid excess and abuse by those who own capital” (Hodges, 2005b). Certainly food for thought when pondering over threats to AnGR. CONCLUSIONS In the letter of invitation to this RBI 8th Global Conference on Animal Genetic Resources a challenging statement was made, calling for an answer, namely: “Sustainable conservation of the livestock breeds’ diversity for the future: Impact of globalization of animal breeding and the loss of farm animal genetic diversity – a conflict”? My answer is yes because there are clearly links between globalization and its driving force, capitalism, on one hand, and the erosion taking place locally and globally in farm animal genetic diversity, on the other hand. Consequently, this implies a permanent threat to AnGR and, at least in the long ‐ term, a serious threat to both local and global food security. Given the assumption that The Conservation And Utiliztion Of The Genetically Diverse, Native Icelandic Livestock Breeds, With Reference To Selfsufficiency And National Food Security 77 sustainable use of AnGR, for food and other agricultural production, is the best strategy for maintaining their diversity, namely conservation by utilization, one wonders: 1) To what extent and how are can current ideologies, such as the dominating capitalism, drive a transition towards more sustainable patterns of production and consumption? 2) How are global economic problems, the threat of climate change and declining oil reserves going to affect the conservation of AnGR? 3) Can animal breeders and scientists cooperate with economists and social scientists in finding ways and means of reducing or eliminating conflicts between the conservation of biodiversity and human activities aimed at enhancing economic growth? 4) To what extent can NEOCLASSICAL ECONOMICS (growth economies at any cost) be replaced by ECOLOGICAL ECONOMICS (sustainable, green, economic growth) thus reducing or stopping AnGR erosion both locally and globally? Looking at the situation in the context of Icelandic reality there is a strong will by the farming sector (Varnarlínur, 2011) to continue the conservation of their grassland ‐ based livestock breeds by utilization and, at the same time, to maintain a maximum possible level of food security. This will certainly be an important issue in the ongoing membership negotiations between Iceland and the EU. Moreover, the strict import regulations and control applied successfully in Iceland in the livestock sector seem to be in conflict with the EU open market, free ‐ trade policy. Thus the links between the conservation of native livestock breeds, self‐sufficiency and national food security will be debated in months and years ahead, both in rural and urban communities in the marginal Iceland. REFERENCES Adalsteinsson, S. (1981). Origin and conservation of farm animal populations in Iceland. Z. Tierzüchtg. Züchtgsbiol. 98, 258‐264. Aðalsteinsson, S. (1993). Husdyrene I menneskenes tjeneste I Norden. Husdyr I Norden, Vår arv – vårt ansvar. Landbruksforlaget, Oslo, 8‐23. Adalsteinsson, S., Dýrmundsson, Ó.R., Bjarnadóttir, S. and Eythórsdóttir, E. (1994). Búvísindi, Icel. Agr. Sci. 8, 99‐105. Árnason, Th. and Jónmundsson, J.V. (2007). Kynbótamat afurðaeiginleika íslenskra áa. Fjölrit LbhÍ nr. 14, 21‐32. Baldursdóttir, K.B. (2010). Genetic variation within the Icelandic goat breed. Assessment using population data and DNA analysis. MS‐thesis, Agricultural University of Iceland, 52 pp. Council Regulation (EC) No 1698/2005. Commission Regulation (EC) No 1974/2006. Dýrmundsson, Ó.R. (2002). Leadersheep: the unique strain of Iceland sheep. Animal Genetic Resources Information, No. 32, 45‐48. Dýrmundsson, Ó.R. (2005). The Iceland goat: past and present. Animal Genetic Resources Information, No. 36, 53‐59. Dýrmundsson, Ó.R. (2006). Sustainability of sheep and goat production in North European countries – From the Arctic to the Alps. Small Ruminant Research 62 (3), 151‐157. Dýrmundsson, Ó.R. (2011). Sjálfbær þróun – landbúnaður á Íslandi í sátt við náttúruna. Náttúruvernd og skipulag. Vorráðstefna Náttúruverndarsamtaka Austurlands (NAUST). Hótel Framtíð, Djúpavogi, laugardag 4. júní 2011. Fjölrit 5 bls. Dýrmundsson, Ó.R. and Niznikowski, R. (2010). North European short‐tailed breeds of sheep: a review. Animal 4 (8), 1275‐1282. Eythórsdóttir, E. (1993). Bevaringsarbejdet i Island. Husdyr i Norden, Vår arv‐vårt ansvar. Landbruksforlaget, Oslo, 127‐132. 78 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Eythórsdóttir, E. (2009). The origon and genetic diversity of the native Icelandic livestock breeds. ERFP Workshop, Reykjavík, Iceland, 30 Apríl 2009. 20 pp. Hodges, J (2005a). Cheap food and feeding the world sustainably. Livest. Prod. Sci. 92 (1), 1‐16. Hodges, J. (2005b). Sustainable agriculture and food are at risk. Livest. Prod. Sci. 98, 225‐230. Hoffmann, I and Scherf, B. (2010). Implementation of the Global Plan of Action for Animal Genetic Resources. Animal Genetic Resources 47, 1‐10. Icelandic Agricultural Statistics (2009). The Farmers Association of Iceland. 28 pp. Icelandic Livestock Breeds (2009). The Farmers Association of Iceland in cooperation with the Agricultural Genetic Resources Committee and the Nordic Gene Bank for Domestic Animals. 20 pp (ISBN 9979 – 885‐ 02). Jónmundsson, J.V., Kristjánsson, Th. and Benjamínsson, B.H. (2007). Erfðaframlag þekktra kynbótagripa í íslenska kúastofninum á síðari hluta 20. aldar. Fjölrit LbhÍ nr. 14, 21.‐32. Jónsson, M.B., Jónmundsson, J.V. and Kristjánsson, Th. (2007). Ræktunarstarf í litlum erfðahópum. Fjölrit LbhÍ nr. 14, 33‐46. Kristjánsson, Th. (2007). Erfðafjölbreytileiki íslenskra hrossastofnsins – og verndun hans. Fjölrit LbhÍ nr. 14, 95‐ 102. Pilling, D. (2010). Threats to animal genetic resources for food and agriculture – approaches to recording, description, classification and analysis. Animal Genetic Resources 47, 11‐22. Rege, J.E.O. and Gibson, J.P. (2003). Animal genetic resources and economic development: Issues in relation to economic evaluation. Ecological Economics 45 (3), 319‐320. Reglugerð um varðveislu og nýtingu erfðaauðlinda í landbúnaði, nr. 151/2005. 2 pp. Sveinsdóttir, H.E. and Dýrmundsson, Ó.R. (1994). The Icelandic goat breed. Búvísindi, Icel. Agric. Sci. 8, 93‐97. The State of Food and Agriculture. Livestock in the balance (2009). Food and Agricultural Organization of the United Nations, Rome. 166 pp. Varnarlínur Bændasamtaka Íslands vegna aðildarumsóknar Íslands að ESB (2011). Bændasamtök Íslands. 22 pp. THE PRESENT STUDIES on ANIMAL GENETIC RESOURCES in BANDIRMA SHEEP RESEARCH STATION Mesut YILDIRIR*, Tamer SEZENLER, İsmail ERDOĞAN, M. Akif YÜKSEL, Deniz SOYSAL1 1 Bandırma Sheep Research Station. 10200 Bandirma, Turkey * Corresponding author: mesutyildirir@hotmail.com Abstract Turkey has great potential of animal genetic resources. The conservation and sustainability of farm animal genetic diversity in Turkey is essantial for sustainable animal production, rural devolepment and food security. General Directorate of Agricultural Research (GDAR) have conducted programs on the conservation of Animal Genetic Resources (AnGR) since 1992 and the project of ‘Conservation of Domestic Animal Genetic Resources’ started in 1995 in the several institutions. Bandırma Sheep Research Station (BSRS) has taken over all responsibility at 6 breeds level in in‐situ and ex‐situ conservation program. In the BSRS, conservation and characterisation program have been carried out in four sheep (Gökçeada, Sakız, Kıvırcık and Çine Çaparı), Turkish Grey Cattle and Anatolian Water Buffalo breeds. The present studies on AnGR in BSRS have been reviewed. These studies have been analysed by using some experimental results including different applications and founds in literature. The activities on conservation, characterisation and sustainability of AnGR in BSRS and needs and challenges were assessed in the context of Farm Animal Genetic Resources. Keywords: Conservation, Sakız, Çine Çaparı, Kıvırcık, Gökçeada, Anatolian Grey Cattle, Anatolian Water Buffalo Introduction Turkey has a great potential of animal production and animal genetic resources. Therefore, this important resources must be conserved. But the livestock inventory data show that the number of the animals have decreased since the early 1980s and the number of breeds at risk. In the last few decades, farm animal genetic diversity has rapidly declined, mainly due to economic change and devolopment. Many keepers of traditional breeds abandon keeping of their animals, due to a variety of factors including one‐sided information, and pressure to adopt improved breeds and standardized production and breeding systems, changing market demands, loss of grazing grounds and access to water, animal health regulations, and changing lifestyles (Anonymus, 2009). Provide the ability of the adaptation, maintain genetic diversity to meet the needs of future utilization and preserve cultural and historical values are the main reasons for conserving farm animal genetic diversity (Karaca ve ark. 1999; Anonymus, 2004). The conservation and sustainability of farm animal genetic diversity in Turkey is essantial for sustainable animal production, rural devolepment and food security. Large, and possibly expanding, parts of the globe can be used for food production only by livestock that are adapted to local conditions. This includes the 41 percent of the earth’s land surface (Anonymus, 2009). Livestock sector is characterized by small‐scale farms and native breeds in Turkey. Small ruminants in Turkey are well adapted to the rangelands and marginal lands of Anatolia and contribute to the livelihood of vulnerable and resource‐poor farmers living under extremely difficult conditions in the semi‐arid areas and highlands of the country (Uzunöz and Akçay, 2009). These species convert natural vegetation into valuable products such as meat, milk, wool, skins and manure (Gürsoy, 2006). With their long tradition of animal breeding and daily intimate interaction with their herds, livestock‐ 80 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) keeping communities have accumulated detailed knowledge on their animals, their needs and their surroundings and, according to Perezgrovas et al., 1995 this knowledge is an extremely useful resource for breed documentation as well as breeding and conservation decisions (Anonymus, 2009). The awaraness on conserving of the AnGR originated in the 1960s and leads by European Association for Animal Production (EAAP) and Food and Agricultural Organization (FAO). (Anonymus, 2004). FAO's study of preservation of farm animal genetic sources are based on the primary guidelines for development of national farm animal genetic resources management plan and Turkey is the member of Convention of Biological Diversity (CBD). Turkey has enacted laws and regulations about sustainable production and conservation of AnGR. Animal Breeding Law (4631) has been enacted on 21 March 2001. The other important laws are Animal Protection (5199) and Agriculture (5488) (Soysal ve ark. 2007). General Directorate of Agricultural Research (GDAR) is responsible to coordinate and manage to services and duties related with AnGR. It is supposed that coordinate the researches, university institutions and NGO studies related with frame work in the country. GDAR have conducted programs on the conservation of AnGR since 1992 and the project of ‘Conservation of Animal Genetic Resources’ started in 1995 collaborate with Ankara University Faculty of Agriculture, Department of Zootechni and conservation efforts to protect for the most endangered breeds in ex‐situ flocks began in 1995 by GDAR in the several institutions (Ertuğrul ve ark. 2009). GDAR publicate a regulation for Conversation of National Domestic Animal Genetic Resources in 2003. As a result of this regulation set up a National Comittee of Conservation of Animal Genetic Resources. Thereafter the in‐situ conservation project has been started in 2005 and the second part of the project of ‘Conservation and Sustainable Utilization of Domestic Animal Genetic Resources’ has been started in 2011(Akın, 2011). In this context, 11 sheep (Kıvırcık, Sakız, Gökçeada, Karagül, Herik, Hemşin, Çine Çaparı, Dağlıç, Tuj, Norduz and Karakaçan), 7 goat (Ankara, Kilis, Honamlı, Abaza, Gürcü, Kaçkar and Halep), 6 cattle (Anatolian Black; Turkish Grey; Eastern Red; Kilis; Southern Yellow/Red; Zavot) and Anatolian Water Bufalo breeds being conserved in situ conservation method that is the maintenance and development of live populations of animals in their adaptive environment. The activities on conservation, characterisation and survivability of AnGR in BSRS and needs and challenges were assessed in the context of Farm Animal Genetic Resources. These studies have been analysed by using some experimental results including different applications and founds in literature. Status of Farm Animal Genetic Resources Management Activity in BSRS: BSRS is one of the research Stations dedicated to livestock research and development in Turkey. It was established in 1935. The Station is spread over an area of 2030 hektares. Administrative control of the Institute is currently under GDAR. The Station has played an active role in the conservation and sustainable utilization of AnGR for two decades. In‐situ conservation activities, the conservation of animals in their natural habitats, which has been undertaken since 2005, and is continuing within the ongoing national project. Ex‐situ conservation is the preservation of animal diversity outside their natural habitats. These conservation activities have been undertaken since 1996, and is continuing within the ongoing national project. BSRS has taken over all responsibility at 6 breed level in in‐situ and ex‐situ conservation program. In addition to, Gökçeada, Sakız and Kıvırcık and Çine Çaparı sheep breeds, Turkish Grey Cattle and Anatolian Water Buffalo breeds have been conducted in ex‐situ and insitu conservation project. Table 1 shows the recent population estimates (Cerit et all., 2003, Konyalı et all., 2004, Soysal et all., 2010, FAO, 2009) and number of heads in‐situ and ex‐situ conservation flocks. The number of animals in the conservation flocks will be incresed in 2011. The Present Studies On Animal Genetic Resources İn Bandırma Sheep Research Station 81 Table 1. The status of the breeds, population estimates, in‐situ and ex‐situ flocks in BSRS Population estimates Number of animals (ex‐ situ) Number of animals (in‐situ) >100.000 279 200 34.000 77 200 <1.000 100 113 Adapted to poor pasture, suitable marginal lands <200 ‐ 54 Anatolian Water Buffalo Suited to marginal lands 86.297 89 80 Turkish Grey Cattle Suited to marginal lands 2.000 135 100 Breed Important fetures Kıvırcık sheep Meat quality Gökçeada sheep Adapted to marginal lands Sakız sheep Prolific, milk production ÇineÇaparı sheep Sheep Conservation: Among the Turkish sheep breeds, Kıvırcık, Gökçeada and Sakız breeds is considered important for its productive characteristics. These breeds are raised in the western coastal and northern – western regions of the country. Kıvırcık is well known for meat quality, while Sakız is noted for high milk yield, early sexual maturity and high prolificacy rate. Gökçeada sheep breeds located in Gökçeada, Çanakkale and Northwest Anatolia. This sheep is raising in extensive contition at Gökçeada Island (Ceyhan et all., 2007). In the last 15 to 20 years, the pure number of Çine Çapari sheep which is a regional native fat‐ tailed sheep breed of Aydin region, have very declined due to backcrossing of breed with rams of Kıvırcık and prolific Sakız breeds. Consequently, this process were put them in danger of extinction. They are well adapted to mountain regions. Efforts for establishing a conservation flock at Adnan Menderes University were started in 1996 for conservation of this endangered breed and definition of its some characterisitics (Karaca et al., 1999). The physiological reactions of Kıvırcık sheep in Bandırma environment conditions were investigated. According to results obtained for Kıvırcık sheep showed that the breed were able to develop adaptation suitable mechanisms in Bandırma environment conditions (Ceyhan et al, 2006). Estrus were monitored in Kıvırcık, Gökçeada and Sakız ewes throughout year, Kıvırcık ewes showed estrus activity 225 days while Sakız and Gökçeada ewes 222 and 167 days respectively (Sezenler et al., 2009). The study conducted to compare of sexual behaviour of the ewes. Sakız ewes were found sitatistically different from Kıvırcık and Gökçeada ewes for sexual beahviour (Yüksel et al., 2011). Number of lambs at birth per ewe were found for Kıvırcık; 1.32, 1.36, Gökçeada;1.19, 1.36; Sakız; 1.6, 1.9 and Çine Çaparı 1.0 for in‐situ and ex‐situ flocks respectively in 2010 in BSRS. Table 2 summarize the least squares means for live body weight and linear body measurements in Kıvırcık, Gökçeada and Sakız ewes. 82 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Factors Investigated LW WH BL CD CG Table 2. Least square means and standard errors for body weight (kg) and linear body measurements (cm) for Kıvırcık, Gökçeada and Sakız ewes Gökçeada (n=60) Sakız (n=59) Kıvırcık (n=228) Mean SE Mean SE Mean SE b c 0.51 34.59 1.00 53.69 1.01a 47.20 b b 65.69 0.18 65.46 0.36 72.33 0.36a a b 0.25 59.90 0.48 69.81 0.49a 68.90 b c 0.15 26.43 0.30 30.84 0.30a 29.65 b c 0.52 79.46 1.01 96.86 1.02a 85.41 a,b,c: The differences between the means of groups marked by various letters in the same rows are significant (P< 0.001) Turkish Grey Cattle: Turkish Grey was widespread in Western Anotolia and Marmara regions previously, as a source of farm animal genetic resources remain only in marginal areas of the Enez and Ipsala districts of the Thrace region in Turkey. Due to pressure of crossbreeding, the number of native breeds are rapidly decreasing. These trends have led to the use of intensive crossbreeding of native breeds with exotic imported western breeds (Soysal and Kök, 2006). Unfortunately there is no data based on official inventory studies. The number of Grey cattle population is estimated 2000 head only (Soysal et all., 2010). Ex‐situ invivo conservation studies of Turkish Grey began in Bandırma BSRS in 1995. After ten years in 2005, a flock with pure Turkish Grey Cattles in Çandır Village (Enez/Edirne) was determinated as in‐situ conservation. At the same year the cryoconservation began with TÜRKHAYGEN‐1 project. The Grey cattle have big horns’ and usually a grey colour. Their body size is relatively large. The live weight vary from 300‐350 kg and milk production can reach up to 1000 kg (Soysal et all., 2010). It has a gray coat that is darker in males and lighter‐colored in females, with blank apical pigmentation. Calves are brown‐colored at birth and then at around three months they turn to the characteristic color of the breed. The horns are long and have typical half‐moon shape in the males, whereas the females have lyre‐shaped horns. At the Research Statition studies continue to determine the fattening performance, carcass characteristics and meat quality of Turkish Grey cattle and some reproductive characteristics. It is known that measuring of animal much difficult and getting more time and also results of measuring by traditional tools suspiciously many times. Image Processing Technology and Digital Image Analysis for determination of body measurements were used on Anatolian Waterbuffalo and Turkish Grey cattle breeds in BSRS. The results of the study show that high correlations, laser pointer method can be use for evaluation body measurements of the cattles and waterbuffalos (Sezenler et all., 2009). Anatolian Water Buffalo: Anatolian Water buffalo ex‐situ conservation flock was established in 1996 in Kocatepe Agricultural Research Institute in Afyon and transferred to BSRS in 2004. In‐situ conservation project began in Balıkesir in 2005 and is continuing within the ongoing national project. Anatolian water buffalo has been the most important animal production material in Turkey for centuries for their milk, meat and truck power. It is more common along the coast of Black Sea and also found in Eastern Anatolia (Soysal et all., 2010). According to 1974 FAO statistics, at that time there were one million buffalo head in Turkey. From 1984 to 1997, there has been a decrease in the buffalo breeding population of 65% and the reason for this decrease in water buffaloes has been the preferences for cattle over buffalo in the Ege and Marmara regions, where a large number of buffaloes were found in Turkey (Borghese, 2011). Because of the economic and social conditions the number of AWB very declined in last two decades. The number of buffaloes, which was 429.000 in 1990, decreased to 86.297 in 2009 (FAO., 2009). The Present Studies On Animal Genetic Resources İn Bandırma Sheep Research Station 83 Buffalo is bred in certain regions and especially extensively and characterised mainly well adapted their local condition. In Turkey water buffalo meat is especially used for making sausage, which is a very popular typical product in Turkey, prepared with buffalo meat, beef and mutton spiced especially with garlic. Water buffaloes were very popular especially for their milk fat cream traditionally suits for famous Turkish dessert. The percentage of creamy structured milk fat content was about to 13%. This figures not stands for milk fat content. Creamy structured called ‘kaymak’ in Turkish products from buffalo milk has other constituent additionally to the milk fat (Soysal et all., 2005). According the data obtained from Anatolian water buffalo herds BSRS the highest fat ratio was found at the first lactation as 8.70±0.09. Analyses results showed that Anatolan water buffalo milk contained 4.90±0.23% protein, 8.31±0.29% fat, 17.40±0.36% total dry ingredients and 4.01±0.08% lactose. The overall average milk yield was 798.47 ±17.56 kg per lactation with an average lactation length of 207.40 ± 2.71 days in BSRS. In conclusion, the activities of conservation AnGR in‐situ and ex‐situ level has gained important result. The present study highlighted the importance of the project of ‘Conservation and Sustainable Utilization of Domestic Animal Genetic Resources’. The most important factor in the conservation is sustainable utilization. There is little experience in sustainable conservation programs. Research opportunities in the field of animal genetic resources are plenty. Perhaps the biggest gap in knowledge is in the area of animal breeding for local populations in harsh environments (Cardellino and Boyazoğlu, 2009). Researchs are required to understand the socio‐economic, infrastructural, technical and formal constraints that limit their establishment and operation. It is clear that the depletion of genetic resources is a consequence of economic change and development. Therefore, there is an inevitable conflict between the desire to conserve the present variety of genetic resources and the need to concentrate increasingly on a narrow range of genotypes in the interests of more efficient production (Cunningham, 1992). Effective conservation requires to understand all stages of the production. Economic, social, cultural, environmental, political, issues should be take into account. In‐situ conservation is considered the most appropriate way of conserving biodiversity and sustainable utilization. In addition, to achieve sustainable management of the described genetic resources, the production of these breeds should be valorized by taking into account their value as reservoirs of unique diversity, as suggested by Taberlet et al., (2008). Acknowledgements The authors are grateful to General Directoriate of Agricultural Research for financial and research assistance. REFERENCES Akın, O. (2011). Conservation and Sustainable Utilization of Domestic Animal Genetic Resources. Program Evaluation Group Metings. Antalya. P:135‐140. Anonymus, (2004). Commıssıon on genetıc resources for food and agrıculture. Working group on anımal genetıc resources for food and agrıculture. Third session, Rome, 31 March–2April 2004. Anonymous, (2009). Contrıbutıons of smallholder farmers and pastoralısts to the development, use and conservatıon of anımal genetıc resources. FAO‐Commıssıon on genetıc resources for food and agrıculture Intergovernmental technıcal workıng group on anımal genetıc resources for food and agrıculture. Fifth Session Rome http://www.fao.org Cardellino, R.A. and Boyazoglu, J. (2009). Research opportunities in the field of animal genetic resources. Livestock Science 120: 166–173 Cerit, H., Altınel, A., Avanus, K., Elmaz, O., Karayel, E., Temelli, R. and Kirişçi, E. (2003). Polimorphisim evaluation of various genomic loci in Kıvırcık sheep breed of Turkey. The 11th International Symposium 84 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) of the World Association of Veterinary Labaratory Diagnosticans and OIE Seminar on Biotechnology, November 9‐13 2003. Ceyhan, A., Kaptan, C., Ada, M., Erdoğan, İ. and Taluğ, A.M. (2006). The physiological reactions in Bandırma environment conditions of Kıvırcık, German Blackheaded Mutton, (GBH x Kivircik ) F1 and (GBH x F1 ) B1 Ewe. Ankara Üniversitesi Tarım Bilimleri Dergisi. 12 (2): 113‐120. Ceyhan, A., Erdoğan, İ. and Sezenler, T., (2007). Some Production Characteristics of Kıvırcık, Gokceada and Sakız Breeds of Sheep Conserved as Gene Resources. Journal of Tekirdag Agricultural Faculty. 4(2):211‐ 218. Cunningham, E.P. (1992). Animal genetic resources:The perspective for developing countries. in: Afrıcan Animal Genetıc Resources: theır characterisatıon, conservatıon and utılısatıon proceedings of the research planning Workshop Held at ILCA, Addis Ababa, Ethiopia 19‐21 February 1992. Ertuğrul, M., Dellal, G., Soysal, İ., Elmacı, C., Akın, O., Arat, S., Barıtçı, İ., Pehlivan,E. and Yılmaz O. (2009). Türkiye Yerli Koyun Irklarının Korunması. U.Ü. Z.F. Dergisi 23(2)97‐119 FAOSTAT. (2009). http://faostat.fao.org Gursoy, O., (2006). Economics and profitability of sheep and goat production in Turkey under new support regimes and market conditions. Small Ruminant Research, 62: 181‐191. Karaca, O., Çetiner, S. and Cemal, İ. (1999) Çine Çaparı Koyunların Kimi Özellikleri ve Genetik Kaynak Olarak Korunması Olanakları Uluslararası Hayvancılık’99 Kongresi, 21‐24 Eylül 1999, İzmir Konyalı, A., Daş, G., Savaş, T. and Yurtman, İ.Y. (2004). Imbros Sheep Raising in Gökçeada: A potential for organic animal production? 1st International Congress on Organic Animal Production and Food Safety, 28 April‐1 May 2004, Kusadasi, Izmir, Turkey Sezenler, T., Yaman, Y., Küçükkebapçı, M., Yüksel, A.M. and Erdoğan, İ. (2009). Determining some reproductive characteristics of Kıvırcık, Gökçeada and Sakız sheep breeds. Program Evaluation Group Metings. Antalya. P:388‐401. Soysal, M.İ., Tuna, Y.T. and Gürcan, E.K. (2005). An Investigation on the water buffalo breeding in Danamandira village of Silivri District of Istanbul province of Turkey. Journal of Tekirdag Agricultural Faculty 2 (1). Soysal, M.İ. and Kök.S. (2006). Survival of Gray cattle resisting extention a case study of characterisitcs and sustainability of traditional system of native grey cattle breed”, Mediteranean livestock production uncertanities and opportunities, Zaragoza, Spain. Soysal, M.I., Gürcan, E.K., Tuna, Y.T., Özkan, E. and Çobanoğlu Ö. (2007)Yerli Hayvan Genetik Kaynakları Koruma Süreci ve Hayvancılık Teknolojileri Fikri Mülkiyet Hakları Kapsamına Girer mi? 5. Ulusal Zootekni Bilim Kongresi 05‐08 Eylül 2007 Van Soysal, M.İ., Gürcan, E.K., Özkan, E. and Genç, S. (2010). Sustainable conservation of native animal genetic resources in Turkey. İn: Native Animal Genetic Resources of Turkey. Tekirdağ. Taberlet P., Valentini A., Rezael H. R., Naderi S., Pompanon F., Negrini R. and Ajmone‐Marsan P. (2008). Are cattle, sheep, and goats endangered species? Mol. Ecol. 17:275–284.pmid:17927711 Uzunoz, M. and Akcay, Y. (2009). Profitability analysis of sheep farming in Turkey: a Case study. Journal of Applied Sciences Research 5(7): 815‐819. Yüksel, M.A., Sezenler, T. and Yıldırır, M. (2011). Determining Some Sexual Behaviours of Native Sheep Breeds in Mating Period. 7th Zootechnic Congress, Adana, Turkey. USE OF MOLECULAR INFORMATION FOR THE CHARACTERIZATION AND CONSERVATION OF FARM ANIMAL GENETIC RESOURCES: RESULTS OF LARGE SCALE INTERNATIONAL PROJECTS AND PERSPECTIVES OFFERED BY NEW TECHNOLOGIES P. AJMONE‐MARSAN Institute of Zootechnics and BioDNA Research Centre, Faculty of Agriculture, Università Cattolica del S. Cuore, Piacenza, Italy. Abstract In the last fifteen years, the European Community and other Institutions, as FAO and IAEA, have funded a number of international projects on the investigation of Farm Animal Genetic Resources (FAnGR) biodiversity at the continental scale. These projects have identified domestication sites and ancient migration routes, investigated geographic patterns of genetic diversity and identified hot spots of diversity and distinctiveness, in some case integrating genetics, socio‐ economic and environmental information in Geographic Information System (GIS) based representations. Most of these projects have used “traditional” low throughput molecular markers, as microsatellites and AFLPs. Now we are in the genomic era: whole genome sequences of all farm animal species are or will soon be available. This has marked a quantum leap in the amount of information known on genome polymorphisms and has stimulated the development of high‐ throughput marker technologies. Nowadays hundred of thousand molecular markers can be genotyped at low cost. Soon whole genome or whole exome sequencing of FAnGR will become affordable. Gigabytes of genomic information need proper tools, skills and hardware for management and analysis but will shed new light on the origin of biodiversity, on neutral and functional portions of the genome and will permit a more efficient management of diversity and selection programs. Keywords: molecular markers, genomics, biodiversity, conservation Introduction Biodiversity forms the basis of life on earth. The Convention on Biological Diversity, adopted at the United Nations Conference on Environment and Development held in Rio de Janeiro in 1992, states that the contracting Parties are conscious of the intrinsic value of biological diversity and conscious also of the importance of biological diversity for evolution and for maintaining life sustaining systems of the biosphere. The Parties affirm that the conservation of biological diversity is a common concern of humankind and that they are aware that conservation and sustainable use of biological diversity is of critical importance for meeting the food, health and other needs of the growing world population. Indeed maintaining diversity in farm animal species is important for future breeding options in a time of very rapid change and of uncertainty (human population growth, agriculture environmental impact, climate change, market needs, consumer behaviour, etc.). The ability of a species to evolve and rapidly adapt to new conditions is related to the genetic diversity it possesses. A highly uniform species may be very well adapted to its specific ecological niche, but unable to survive when conditions change (e.g. Ross‐Gillespie et al., 2007). The same is true at the population level. In accordance, in farm animal species both within and between population/breed diversity are key factors for ensuring the ability of a species to adapt to rapid change. However, the diversity in FAnGr is rapidly decreasing, with a number of breeds becoming extinct or at risk at a very 86 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) fast pace. During the last century, the European livestock sector has undergone striking changes as large‐scale production expanded. The formulation of the modern breed concept during mid‐1800s and its application to breeding and husbandry practices led to the formation of well‐defined breeds, exposed to intense anthropogenic selection. The progress of livestock management practices, the introduction of artificial insemination and embryo transfer, the improvements in feed technology and the use of vaccines and therapeutics against endemic diseases have fostered the diffusion of industrial breeding. This led farmers to progressively substitute the less productive, locally adapted, autochthonous breeds with highly productive cosmopolitan breeds and to progressively abandon agriculture in marginal areas (Taberlet et al. 2008). Therefore a significant number of cattle, sheep, and goat breeds already disappeared and many are presently endangered (FAO, 2007). The same process is now progressively taking place in Africa and Asia. According to the Food and Agriculture Organization of the United Nations (FAO, 2007), a total of 1491 breeds worldwide (i.e. 20%) are classified as being either critically endangered, critical‐maintained, endangered, or endangered‐ maintained. The highest number of breeds at risk is recorded in cattle (210 out of 1311) followed by horses (181 out of 786). In sheep and goats the numbers of threatened breeds are 84 out of 618 and 179 out of 1409 respectively. Cattle is also the species with the highest number of breeds reported as extinct (209), followed by sheep (180), pig (140), horse (87) and goats (19). The rate of extinction is also of great concern as it increased rapidly, from 1.21 breeds/year in the last century to 6.9 breeds/year in the last ten years (FAO, 2007). Fifteen years of FAnGR diversity research projects The understanding of how farm animal biodiversity originated, evolved, distributed across geography, agro‐ecological zones, socio‐economic and husbandry systems and how it is presently subdivided between and within populations and breeds is important for optimising conservation and exploitation programs (Groeneveld et al., 2010, Ajmone Marsan et al., 2010). Accordingly funding agencies have recently supported a number of research projects at the national, regional or continental scale. In particular, in the last fifteen years the European Union has funded a number of proposals on the characterization and conservation of FAnGR, also exploiting molecular genetics tools. These have produced a large amount of data, identified domestication sites and ancient migration routes, investigated geographic patterns of genetic diversity, identified hot spots of diversity and distinctiveness, in some case integrating genetics, socio‐economic and environmental information in Geographic Information System (GIS) based representations. Some of them are briefly described below. More information can be retrieved from the European Union website “http://cordis.europa.eu”. - “Genebanks and the conservation of farm animal genetic resources” (BIO4‐CT96‐0197), was funded in 1996 and started building the theoretical frame for modelling breed prioritization decisions in FAnGR crio‐conservation plans. - “Development, optimisation and validation of molecular techniques for the measurement of genetic diversity in domestic ungulates” (BIOTECH2‐BIO4961189), was funded in 1996 and focussed on cattle, sheep and goats. The project identified a common set of microsatellite markers for the investigation of diversity in domestic ungulates and has produced a dataset of molecular data in the three species investigated (http://139.222.64.94). - “Farm animals: a permanent inventory of European farm animal genetic resources and of activities on characterisation, conservation and utilisation of those resources” (http://www.eaap.org/content/RESGEN.HTM) was one of the first projects on animals financed by the EU RESGEN Action in 1997. Its main objective was to establish and update a comprehensive inventory of farm animal genetic resources in Europe. The main result of the project was the connection between the FAO “Domestic Animal Diversity Information System – DAD‐IS” and the EAAP “Animal Genetics Dat Bank – AGDB” databases. Use of Molecular Information for the Characterization and Conservation of Farm Animal Genetic Resources: Results of Large Scale International Projects and Perspectives Offered by New Technologies 87 - “Towards a strategy for the conservation of the genetic diversity of European cattle ‐ RESGEN” (PL98‐118) was financed by the EU RESGEN Action in 1998. The project has characterised 64 European bovine breeds with molecular markers (microsatellites and AFLPs) shedding light on the genetic structure of European cattle. - Characterisation of genetic variation in the European pig to facilitate the maintenance and exploitation of biodiversity” (BIO4980188) and “Pigs: European genebanking project for pig genetic resources” (GENRES CT95 No 12) focused on swine diversity. These projects characterised many local European pig populations collecting production performances, phenotypic traits and product quality data. In addition biological material was gathered to create a swine germplasm collection for criobanking. - “Characterisation of genetic variation in the European pig to facilitate the maintenance and exploitation of biodiversity ‐ PIGBIODIV” (http://www.projects.roslin.ac.uk/pigbiodiv/site_index.html) characterised local European pig breeds and commercial lines by genotyping them with 27 microsatellite and AFLP molecular markers. - “Development of Strategy and Application of Molecular Tools to Assess Biodiversity in Chicken Genetic Resources ‐ AVIANDIV” (http://aviandiv.tzv.fal.de/) sampled more than 50 avian population and genotyped them with microsatellite markers. The project investigated the partitioning of diversity within and between local breeds, comparing also commercial lines and the wild ancestor of domestic chicken (Gallus gallus). - “Rabbits: inventory, characterisation, evaluation, conservation and utilisation of European rabbit genetic resources” (Genres CT95 No 60; http://ec.europa.eu/comm/agriculture/res/gen/60a.htm) has collected demographic and genetic information on European rabbit (Oryctolagus cuniculus) genetic resources, a species domesticated in West Europe. - “Digital DNA markers for chip applications in farm animals ‐ FARMCHIP” (BIO4980285) was not specifically dedicated to the investigation of biodiversity but demonstrated the use of SNPs (Single Nucelotide Polymorphisms), a marker class that in the following years has marked a quantum leap in high throughput genotyping. - “Sustainable conservation of animal genetic resources in marginal rural areas: integrating socio‐economic and geostatistical approaches –ECONOGENE” molecular genetics, (www.econogene.eu) investigated sheep and goat diversity using a multidisciplinary approach involving a large Consortium of experts in genetics, husbandry, socio‐economics and GIS‐Science. Econogene has set a number of protocols, from sampling strategies to data collection and methods for integrating molecular and environmental data in conservation, that have become standard methods in following studies. - “Heritage Sheep” (AGRI GENRES 040; http://www.heritagesheep.eu) is a recent project that aimed at establishing an European program for the conservation of local breeds, well adapted to produce in specific environments and tightly linked to local communities. This to grant the survival of Heritage Sheep Breeds, support local rural economy through the valuation of typical products and avoid the abandonment and erosion of marginal rural areas. - “Towards self‐sustainable European, Regional Cattle breeds ‐ EURECA” (012 AGRI GEN RES 870/2004; http://137.224.129.202/eureca/) has defined guidelines to support regional cattle conservation in situ and ex situ programs, collected information on available crioconserved genetic resources and disseminated conservation issues towards decision makers and the general public. - “European livestock breeds ark and rescue net – ELBARN” (AGRI GEN RES action 066; www.elbarn.net) has fostered the networking of European cryobanks and created a database to 13 species containing information on 505 European breeds belonging (www.elbarn.net/elbarn/Breeds/tabid/123/Default.aspx). - “EFABIS ‐ A European Farm Animal Biodiversity Information System” (QLRT‐2001‐00026; http://efabis‐devel.tzv.fal.de ) has created an integrated informatic platform and database for the monitoring of FAnGR in different European Countries. 88 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) - “GLOBALDIV ‐ A global view of livestock biodiversity and conservation” (GRI GEN RES 067; www.globaldiv.eu) had as objective to disseminate current advanced and integrated methodologies for the characterization, evaluation prioritization and conservation of livestock genetic resources. Globaldiv constructed a network of a large number of experienced scientists, 35 in Europe and beyond (Asia, Africa, South America), and involved International Agencies (ILRI, FAO, EAAP, WAAP) that collaborated in the analysis of the present critical situation of FAnGR and in reviewing technologies and socio‐economic measures to indicate new and better ways to sustainable conservation of diversity with limited resources. - “Next generation methods to preserve farm animal biodiversity by optimizing present and future breeding options _NEXTGEN” (EU FP7 Collaborative project‐ grant agreement n° 244356; www.nextgen.eu) is still on going and aims at investigating domestication, adaptation and disease resistance by whole genome sequencing and high throughput genotyping. In addition NextGen aims at evaluating freeze drying techniques for the conservation of cells and gametes from FAnGR. New technologies and new options Progress in technology has fostered the whole genome sequencing of an increasing number of organisms, comprising mammalian model species important for human health, agriculture and “flag species” for wildlife conservation (The Bovine Genome Sequencing and Analysis Consortium, 2009; Archibald et al., 2010; International Sheep Genomics Consortium, 2010; Li et al., 2010; Rubin et al., 2010;). Whole genome sequencing and the following re‐sequencing HapMap projects have discovered millions of genomic DNA variations, including point mutations (Single Nucleotide Polymorphisms ‐ SNPs), insertions, deletions, and segmental duplications (e.g. The Bovine Genome Sequencing and Analysis Consortium et al., 2009). Marker panels comprising many thousand to more than a million validated SNPs have been developed from these efforts. SNP chips are currently available for human, bovine, ovine, porcine, canine and equine species. These tools and a dramatic reduction of genotyping cost are now permitting the genome‐wide screening of large populations. The availability of dense marker panels throughout the genome marked a paradigm shift in the way livestock populations are investigated and analysed, either for studying the population genetic structure (McKay et al., 2008), searching for QTL controlling complex traits (Kolbehdari et al., 2008), performing genome‐wide marker‐enhanced selection of young animals (VanRaden et al., 2009; Hayes et al., 2009) and searching for patterns of recent and past selection (Luikart et al., 2003; MacEachern et al., 2009), among others. In this paper I will mainly focus on the detection of selection signatures in the genome, neglecting many other interesting applications of genome analysis as fine QTL mapping, Genome Wide Association Studies, Genomic relationships, Genomic Selection, etc. This because the identification of the functional portion of the genome may impact conservation decisions. The detection of selection signatures Genomic regions under selection have a relevant importance both in conservation and in disentangling the genetic basis of complex traits. In conservation they mark loci under selection, hence having a functional role, and complement information collected from neutral genomic regions (Bonin et al., 2007). In addition, they permit to investigate the genetic control of traits extremely difficult, costly or even impossible to measure in experimental conditions. Among these are adaptation to extreme climates, low quality feed and resistance to diseases. These traits are calling more and more attention, since they are directly linked to the sustainability of livestock husbandry in a time of rapid and unpredictable climate change. Positive directional selection rapidly fixes advantageous alleles in a population. If fixation is rapid, relative to the rate of recombination, neutral alleles around the selected site can ‘hitchhike’ to Use of Molecular Information for the Characterization and Conservation of Farm Animal Genetic Resources: Results of Large Scale International Projects and Perspectives Offered by New Technologies 89 fixation, causing a loss of genetic diversity and the persistence of a long haplotype block around the selected locus. In a population these features can be a signature of recent directional selection. Also, rapid fixation of new alleles under selection increases the divergence between selected and non‐ selected (or divergently selected) populations in the region around the locus, compared to other genomic regions. In contrast, balancing selection actively maintains diversity in a population for longer than expected under neutral genetic drift. Hence, regions under selection can be detected by comparing the distribution of allele frequencies at marker loci within or between populations (or groups of populations), and by investigating patterns of linkage disequilibrium along the genome, in search for outlier markers and haplotypes, under the assumption that selection hits specific genomic regions (the selected locus and linked genetic markers), while drift and inbreeding influence the entire genome. A number of methods have been developed for the identification of selection signatures (reviewed in Oleksyk et al., 2010). They are based on i) modelling population genetics parameters under the assumption of neutral evolution, ii) scanning the parameters in sliding windows along the genome, to decrease the signal noise of single marker information, on the base of marker data and iii) use statistical methods to identify sliding windows and regions significantly departing from neutral behaviour. Given the earlier availability of SNP markers, genome wide selection signatures have been mostly searched in humans, using both sequence and genome wide marker data (Oleksyk et al., 2010). In farm animals, they have been investigated in the course of Hapmap and resequencing projects. In cattle, the comparison of pairwise Fst values between 19 breeds (14 taurine, 3 indicine and 2 crossbreds) analysed with more than 37,000 SNPs, detected signals of both directional (high Fst) and balancing (low Fst) selection. Some of the highest and lowest values were found in genes associated with behaviour, immune system and feed efficiency (The Bovine HapMap Consortium, 2009). Using the same dataset, Stella et al. (2010) found 699 candidate signatures for dairy production by contrasting allele frequencies in dairy vs. all breeds. Instances were observed where genes from the same general family were at the centre of the significant region on more than one chromosome. In particular, potassium channel genes were associated to regions on BTA14, BTA16, and BTA25; integrin genes on BTA18 and BTA19; and arginine/serine‐rich splicing factors on BTA20 and BTA23. Other studies investigated specific breeds (e.g. Flori et al., 2009) or specific genomic regions (e.g. BTA6 in Norwegian Red; Hayes et al., 2008). In chicken, whole genome resequencing of wild and domestic animals identified 58 genomic regions under selection containing genes likely involved in the domestication process. One of the most interesting signatures was found in domestic chickens at the locus for thyroid stimulating hormone receptor (TSHR), which has a pivotal role in metabolic regulation and photoperiod control of reproduction. In this species many of the regions identified included genes associated with growth, appetite and metabolic regulation (Rubin et al., 2010). Hence modern approaches permit to scan the genome in search for selection sweeps that can be detected independently on any phenotype and with a higher sensitivity, compared to genome wide marker‐trait association studies (GWAS). GWAS turned out to be rather inefficient in identifying loci having minor effect or low minor allele frequency. Paradigmatic examples of these limitations are found in humans, where genome wide scans identified hundreds of genetic variants associated to complex diseases that all together explain only a small proportion of the genetic variance of the traits investigated (Manolio et al., 2009). Inferring the cause of sweeps and identifying the genes under selection is still a difficult task, and needs proper experimental design, particularly when studying complex traits. An interesting approach has recently been proposed by Gautier et al. (2009). These authors used a system biology strategy to identify the physiological functions controlled by the genomic regions involved in adaptive genetic divergence in West African cattle. By contrasting genome wide scans of 9 cattle 90 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) breeds, they identified 53 selective sweeps using a Bayesian method. The genes closest to the peaks of signature were found and submitted to functional and network analyses. Results indicate that three main physiological functions were targeted by selection: immune response, nervous system and hair and skin development. This approach is presently limited by the difficulty in identifying the right genes to include in system biology analyses, since the precision with which selection signatures are localised is relatively low, and by the present incomplete knowledge of gene functions. These limitations may be partially overcome by methods recently designed that use a composite of multiple signals to detect selection signatures, greatly increasing the resolution of detection (Grossman et al., 2010). A different approach to identify genomic regions associated to environmental variables is based on the combined use of genomics and GIScience. GIScience permits to depict, explore and compare variables according to their geographic coordinates. Recently a Spatial Analsysis Method (SAM) based on GIScience has been developed to assess the level of association between molecular markers and environmental parameters (Joost et al., 2007). SAM is based on the spatial coincidence concept to connect genetic information with geo‐environmental data. Logistic regression is used to provide a measure of the association between the frequency of molecular markers and the environmental parameters at sampling sites. Interestingly, in sheep the DYMS1 microsatellite marker, previously shown to be involved in parasite resistance (Buitkamp et al., 1996) was found to be associated to the number of wet days, an environmental variable greatly influencing parasite load. Few other interesting examples of the application of SAM recently appeared in the literature (Pariset et al., 2009; Parisod and Joost, 2010). The interest in this method stems from its independency on population genetics models and complementarity to the population genomics methods previously described (Pariset et al., 2009). Indeed, SAM appears to be more sensitive compared to Fst‐based approaches and able to link significant genomic regions to specific environmental variables, rather than identifying signatures caused by selection forces not easy to identify. Perspectives The cost of DNA sequencing has recently decreased by orders of magnitude. This trend will likely continue and open the door for very affordable whole genome sequencing. As a consequence, the amount of genomic information is expected to grow exponentially. Research focus is now shifting from the sequencing of a single individual to hundreds or even thousands of individuals. The “1000 genome project” in humans (www.1000genomes.org), and the “Genome 10K project” (genome10k.soe.ucsc.edu), targeting the whole genome sequencing of 10,000 vertebrate species are paradigmatic examples of the present trend. Sequencing will extend our knowledge on SNP variation, discovering rare alleles and alleles confined to particular breeds or geographic areas, and on other polymorphisms that have the potential to affect animal phenotypes, as insertions, deletions and Copy Number Variations (CNVs) (e.g. Beckman et al., 2007). Sequencing will be applied also to identify patterns of methylation along the genome (Lister, 2009) and to detect gene expression levels and alternative splicing in different tissues, developmental and environmental conditions, hence permitting the investigation of genome functioning in a given environment. It is expected that these new tools will facilitate the identification and understanding of variation underpinning important traits, including phenotypes relevant for adaptation and sustainable exploitation. With regard to conservation, whole‐genome sequencing will also provide more objective indications of uniqueness than any marker panel and avoid the ascertainment bias presently affecting SNP panels developed from a few breeds not fully representing the genetic variation existing within a species. In addition, adaptive variation will be included in prioritization protocols in order to ensure conservation of unique adaptive variants, thus optimizing conservation efforts both in vivo and in vitro. Use of Molecular Information for the Characterization and Conservation of Farm Animal Genetic Resources: Results of Large Scale International Projects and Perspectives Offered by New Technologies 91 It is also envisaged that breeding and selection will be more and more guided by molecular analysis. Models are to be developed and customised to populations with different genetic structure (small vs. large breeds) and to different purposes (e.g. genetic improvement, control of inbreeding, maintenance of diversity). We are facing a challenging and stimulating time. Tools for molecular characterization of livestock breeds have increased faster than our capacity to process and understand this information. Storing, organizing, analyzing, and exploitation will be the future challenge for researchers and will more than ever benefit from networking and integration of expertise in different disciplines. Under this circumstances, any loss of biodiversity before characterization risks to turn into a loss of invaluable opportunities for both science and agriculture. REFERENCES Archibald AL, Bolund L, Churcher C, Fredholm M, Groenen MA, Harlizius B, Lee KT, Milan D, Rogers J, Rothschild MF, Uenishi H, Wang J, Schook LB; Swine Genome Sequencing Consortium (2010). Pig genome sequence ‐ analysis and publication strategy. BMC Genomics, 11: 438. Ajmone‐Marsan P, GLOBALDIV Consortium (2010). A global view of livestock biodiversity and conservation – GLOBALDIV. Anim Genet Suppl 1:1‐5. Beckmann JS, Estivill X, Antonarakis SE (2007). Copy number variants and genetic traits: closer to the resolution of phenotypic to genotypic variability. Nat Rev Genet, 8:639‐646. Bonin A, Nicole F, Pompanon F, Miaud C, Taberlet P (2007). Population adaptive index: a new method to help measure intraspecific genetic diversity and prioritize populations for conservation. Conserv Biol, 21:697‐708. Buitkamp J, Filmether P, Stear MJ, Epplen JT (1996) Class I and class II major histocompatibility complex alleles are associated with faecal egg counts following natural, predominantly Ostertagia circumcincta infection. Parasitology Research, 82:693–696.FAO (2007). The State of the World’s Animal Genetic Resources for Food and Agriculture. FAO, Rome. Flori L, Fritz S, Jaffrèzic F, Boussaha M, Gut I, Heath S, Foulley JL and Gautier M (2009). The Genome Response to Artificial Selection: A Case Study in Dairy Cattle. Plos ONE 4, e6595. Gautier M, Flori L, Riebler A, Jaffrézic F, Laloé D, Gut I, Moazami‐Goudarzi K, Foulley JL (2009). A whole genome Bayesian scan for adaptive genetic divergence in West African cattle. BMC Genomics, 10:550. Groeneveld LF, Lenstra JA, Eding H, Toro MA, Scherf B, Pilling D, Negrini R, Finlay EK, Jianlin H, Groeneveld E, Weigend S, GLOBALDIV Consortium (2010). Genetic diversity in farm animals – a review. Anim Genet Suppl 1:6‐31. Grossman SR, Shylakhter I, Karlsson EK, Byrne EH, Morales S, Frieden G, Hostetter E, Angelino E, Garber M, Zuk O, Lander ES, Schaffner SF, Sabeti PC (2010). A composite of multiple signals distinguishes causal variants in regions of positive selection. Science, 327:883‐886. Hayes BJ, Lien S, Nilsen H, Olsen HG, Berg P, Maceachern S, Potter S, Meuwissen THE (2008). The origin of selection signatures on bovine chromosome 6. Animal Genetics, 39:105–111. Hayes BJ, Bowman PJ, Chamberlain AJ, Goddard ME (2009). Invited review: Genomic selection in dairy cattle: progress and challenges. J Dairy Sci 92:433‐443. International Sheep Genomics Consortium, Archibald AL, Cockett NE, Dalrymple BP, Faraut T, Kijas JW, Maddox JF, McEwan JC, Hutton Oddy V, Raadsma HW, Wade C, Wang J, Wang W, Xun X (2010). The sheep genome reference sequence: a work in progress. Anim Genet., 41:449‐453. Joost S., Bonin A., Bruford M.W., Despres L., Conord C., Erhardt G. &Taberlet P. (2007). A spatial analysis method (SAM) to detect candidate loci for selection: towards a landscape genomics 92 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) approach to adaptation. Molecular Ecology 16, 3955–3969. Joost S, Colli L, Baret PV, Garcia JF, Boettcher PJ, Tixier‐Boichard M, Ajmone‐Marsan P; GLOBALDIV Consortium (2010). Integrating geo‐referenced multiscale and multidisciplinary data for the management of biodiversity in livestock genetic resources. Anim Genet, 41 Suppl 1:47‐63. Kolbehdari D, Wang Z, Grant JR, Murdoch B, Prasad A, Xiu Z, Marques E, Stothard P, Moore SS (2008). A whole‐genome scan to map quantitative trait loci for conformation and functional traits in Canadian Holstein bulls. J Dairy Sci, 91:2844‐2856. Li R, Fan W, Tian G, Zhu H, He L, Cai J, Huang Q, Cai Q, Li B, Bai Y, Zhang Z, Zhang Y, Wang W, Li J, Wei F, Li H, Jian M, Li J, Zhang Z, Nielsen R, Li D, Gu W, Yang Z, Xuan Z, Ryder OA, Leung FC, Zhou Y, Cao J, Sun X, Fu Y, Fang X, Guo X, Wang B, Hou R, Shen F, Mu B, Ni P, Lin R, Qian W, Wang G, Yu C, Nie W, Wang J, Wu Z, Liang H, Min J, Wu Q, Cheng S, Ruan J, Wang M, Shi Z, Wen M, Liu B, Ren X, Zheng H, Dong D, Cook K, Shan G, Zhang H, Kosiol C, Xie X, Lu Z, Zheng H, Li Y, Steiner CC, Lam TT, Lin S, Zhang Q, Li G, Tian J, Gong T, Liu H, Zhang D, Fang L, Ye C, Zhang J, Hu W, Xu A, Ren Y, Zhang G, Bruford MW, Li Q, Ma L, Guo Y, An N, Hu Y, Zheng Y, Shi Y, Li Z, Liu Q, Chen Y, Zhao J, Qu N, Zhao S, Tian F, Wang X, Wang H, Xu L, Liu X, Vinar T, Wang Y, Lam TW, Yiu SM, Liu S, Zhang H, Li D, Huang Y, Wang X, Yang G, Jiang Z, Wang J, Qin N, Li L, Li J, Bolund L, Kristiansen K, Wong GK (2010). The sequence and de novo assembly of the giant panda genome. Nature. 463:311‐317. Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, Tonti‐Filippini J, Nery JR, Lee L, Ye Z, Ngo QM, Edsall L, Antosiewicz‐Bourget J, Stewart R, Ruotti V, Millar AH, Thomson JA, Ren B, Ecker JR (2009). Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462:315‐322. Luikart GH, England P, Tallmon DA, Jordan S, Taberlet P (2003). The power and promise of population genomics: from genotyping to genome‐typing. Nature Rev Genet 4:981–994. Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, McCarthy MI, Ramos EM, Cardon LR, Chakravarti A, Cho JH, Guttmacher AE, Kong A, Kruglyak L, Mardis E, Rotimi CN, Slatkin M, Valle D, Whittemore AS, Boehnke M, Clark AG, Eichler EE, Gibson G, Haines JL, Mackay TF, McCarroll SA, Visscher PM (2009). Finding the missing heritability of complex diseases. Nature, 461:747‐753. MacEachern S, Hayes B, McEwan J, Goddard M (2009). An examination of positive selection and changing effective population size in Angus and Holstein cattle populations (Bos taurus) using a high density SNP genotyping platform and the contribution of ancient polymorphism to genomic diversity in Domestic cattle. BMC Genomics, 10:181. McKay SD, Schnabel RD, Murdoch BM, Matukumalli LK, Aerts J, Coppieters W, Crews D, Dias Neto E, Gill CA, Gao C, Mannen H, Wang Z, Van Tassell CP, Williams JL, Taylor JF, Moore SS (2008). An assessment of population structure in eight breeds of cattle using a whole genome SNP panel. BMC Genet, 9:37. Oleksyk TK, Smith MW, O'Brien SJ (2010). Genome‐wide scans for footprints of natural selection. Philos Trans R Soc Lond B Biol Sci, 365:185‐205. Pariset L, Joost S, Ajmone Marsan P, Valentini A, Econogene Consortium (2009). Landscape genomics and biased FST approaches reveal single nucleotide polymorphisms under selection in goat breeds of North‐East Mediterranean. BMC Genet. 10:7. Parisod C, Joost S (2010). Divergent selection in trailing‐ versus leading‐edge populations of Biscutellalaevigata. Ann Bot, 105:655‐660. Porter V. 2007. Cattle, a handbook to the breeds of the world. Marlborough, UK: Crowood Press. Ross‐Gillespie A, O'Riain MJ, Keller LF (2007). Viral epizootic reveals inbreeding depression in a habitually inbreeding mammal. Evolution, 61:2268‐2273. Use of Molecular Information for the Characterization and Conservation of Farm Animal Genetic Resources: Results of Large Scale International Projects and Perspectives Offered by New Technologies 93 Rubin CJ, Zody MC, Eriksson J, Meadows JR, Sherwood E, Webster MT, Jiang L, Ingman M, Sharpe T, Ka S, Hallböök F, Besnier F, Carlborg O, Bed'hom B, Tixier‐Boichard M, Jensen P, Siegel P, Lindblad‐Toh K, Andersson L (2010). Whole‐genome resequencing reveals loci under selection during chicken domestication. Nature, 464:587‐591. Stella A, Ajmone‐Marsan P, Lazzari B, Boettcher P (2010). Identification of Selection Signatures in Cattle Breeds Selected for Dairy Production. Genetics, 185:1451–1461. Taberlet P, Valentini A, Rezaei HR, Naderi S, Pompanon F, Negrini R, Ajmone‐Marsan P (2008). Are cattle, sheep and goats endangered species? Molecular Ecology, 17:275‐284. The Bovine Hapmap Consortium, Gibbs RA, Taylor JF, Van Tassell CP, Barendse W, Eversole KA, Gill CA, Green RD, Hamernik DL, Kappes SM, Lien S, Matukumalli LK, McEwan JC, Nazareth LV, Schnabel RD, Weinstock GM, Wheeler DA, Ajmone‐Marsan P, Boettcher PJ, Caetano AR, Garcia JF, Hanotte O, Mariani P, Skow LC, Sonstegard TS, Williams JL, Diallo B, Hailemariam L, Martinez ML, Morris CA, Silva LO, Spelman RJ, Mulatu W, Zhao K, Abbey CA, Agaba M, Araujo FR, Bunch RJ, Burton J, Gorni C, Olivier H, Harrison BE, Luff B, Machado MA, Mwakaya J, Plastow G, Sim W, Smith T, Thomas MB, Valentini A, Williams P, Womack J, Woolliams JA, Liu Y, Qin X, Worley KC, Gao C, Jiang H, Moore SS, Ren Y, Song XZ, Bustamante CD, Hernandez RD, Muzny DM, Patil S, San Lucas A, Fu Q, Kent MP, Vega R, Matukumalli A, McWilliam S, Sclep G, Bryc K, Choi J, Gao H, Grefenstette JJ, Murdoch B, Stella A, Villa‐Angulo R, Wright M, Aerts J, Jann O, Negrini R, Goddard ME, Hayes BJ, Bradley DG, Barbosa da Silva M, Lau LP, Liu GE, Lynn DJ, Panzitta F, Dodds KG. (2009). Genome‐wide survey of SNP variation uncovers the genetic structure of cattle breeds. Science, 324:528‐532. The Bovine Genome Sequencing and Analysis Consortium, Elsik CG, Tellam RL, Worley KC, Gibbs RA, Muzny DM, Weinstock GM, Adelson DL, Eichler EE, Elnitski L, Guigó R, Hamernik DL, Kappes SM, Lewin HA, Lynn DJ, Nicholas FW, Reymond A, Rijnkels M, Skow LC, Zdobnov EM, Schook L, Womack J, Alioto T, Antonarakis SE, Astashyn A, Chapple CE, Chen HC, Chrast J, Câmara F, Ermolaeva O, Henrichsen CN, Hlavina W, Kapustin Y, Kiryutin B, Kitts P, Kokocinski F, Landrum M, Maglott D, Pruitt K, Sapojnikov V, Searle SM, Solovyev V, Souvorov A, Ucla C, Wyss C, Anzola JM, Gerlach D, Elhaik E, Graur D, Reese JT, Edgar RC, McEwan JC, Payne GM, Raison JM, Junier T, Kriventseva EV, Eyras E, Plass M, Donthu R, Larkin DM, Reecy J, Yang MQ, Chen L, Cheng Z, Chitko‐McKown CG, Liu GE, Matukumalli LK, Song J, Zhu B, Bradley DG, Brinkman FS, Lau LP, Whiteside MD, Walker A, Wheeler TT, Casey T, German JB, Lemay DG, Maqbool NJ, Molenaar AJ, Seo S, Stothard P, Baldwin CL, Baxter R, Brinkmeyer‐Langford CL, Brown WC, Childers CP, Connelley T, Ellis SA, Fritz K, Glass EJ, Herzig CT, Iivanainen A, Lahmers KK, Bennett AK, Dickens CM, Gilbert JG, Hagen DE, Salih H, Aerts J, Caetano AR, Dalrymple B, Garcia JF, Gill CA, Hiendleder SG, Memili E, Spurlock D, Williams JL, Alexander L, Brownstein MJ, Guan L, Holt RA, Jones SJ, Marra MA, Moore R, Moore SS, Roberts A, Taniguchi M, Waterman RC, Chacko J, Chandrabose MM, Cree A, Dao MD, Dinh HH, Gabisi RA, Hines S, Hume J, Jhangiani SN, Joshi V, Kovar CL, Lewis LR, Liu YS, Lopez J, Morgan MB, Nguyen NB, Okwuonu GO, Ruiz SJ, Santibanez J, Wright RA, Buhay C, Ding Y, Dugan‐Rocha S, Herdandez J, Holder M, Sabo A, Egan A, Goodell J, Wilczek‐Boney K, Fowler GR, Hitchens ME, Lozado RJ, Moen C, Steffen D, Warren JT, Zhang J, Chiu R, Schein JE, Durbin KJ, Havlak P, Jiang H, Liu Y, Qin X, Ren Y, Shen Y, Song H, Bell SN, Davis C, Johnson AJ, Lee S, Nazareth LV, Patel BM, Pu LL, Vattathil S, Williams RL Jr, Curry S, Hamilton C, Sodergren E, Wheeler DA, Barris W, Bennett GL, Eggen A, Green RD, Harhay GP, Hobbs M, Jann O, Keele JW, Kent MP, Lien S, McKay SD, McWilliam S, Ratnakumar A, Schnabel RD, Smith T, Snelling WM, Sonstegard TS, Stone RT, Sugimoto Y, Takasuga A, Taylor JF, Van Tassell CP, Macneil MD, Abatepaulo AR, Abbey CA, Ahola V, Almeida IG, Amadio AF, Anatriello E, Bahadue SM, Biase FH, Boldt CR, Carroll JA, Carvalho WA, Cervelatti EP, Chacko E, Chapin JE, Cheng Y, Choi J, Colley AJ, de Campos TA, De Donato M, Santos IK, de Oliveira CJ, Deobald H, Devinoy E, Donohue KE, Dovc P, Eberlein A, Fitzsimmons CJ, Franzin AM, Garcia GR, Genini S, Gladney CJ, 94 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Grant JR, Greaser ML, Green JA, Hadsell DL, Hakimov HA, Halgren R, Harrow JL, Hart EA, Hastings N, Hernandez M, Hu ZL, Ingham A, Iso‐Touru T, Jamis C, Jensen K, Kapetis D, Kerr T, Khalil SS, Khatib H, Kolbehdari D, Kumar CG, Kumar D, Leach R, Lee JC, Li C, Logan KM, Malinverni R, Marques E, Martin WF, Martins NF, Maruyama SR, Mazza R, McLean KL, Medrano JF, Moreno BT, Moré DD, Muntean CT, Nandakumar HP, Nogueira MF, Olsaker I, Pant SD, Panzitta F, Pastor RC, Poli MA, Poslusny N, Rachagani S, Ranganathan S, Razpet A, Riggs PK, Rincon G, Rodriguez‐Osorio N, Rodriguez‐Zas SL, Romero NE, Rosenwald A, Sando L, Schmutz SM, Shen L, Sherman L, Southey BR, Lutzow YS, Sweedler JV, Tammen I, Telugu BP, Urbanski JM, Utsunomiya YT, Verschoor CP, Waardenberg AJ, Wang Z, Ward R, Weikard R, Welsh TH Jr, White SN, Wilming LG, Wunderlich KR, Yang J, Zhao FQ (2009). The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science, 324:522‐528. VanRaden PM, Van Tassell CP, Wiggans GR, Sonstegard TS, Schnabel RD, Taylor JF, Schenkel FS (2009). Invited review: reliability of genomic predictions for North American Holstein bulls. J Dairy Sci, 92:16‐24. GENETIC DIVERSITY OF FIVE INDIGENOUS GOAT POPULATION OF NEPAL N. A. Gorkhali1, Han Jianlian2 and B.S. Shrestha1 1 Animal Breeding Division, NARC and 2 Chinese Academy of Agricultural Sciences The project allowed an in‐depth study of the genetic diversity of indigenous goat breeds of Nepal in relation to different lineages derived earlier. The main goal of the present study is to characterize the domestic goat at mtDNA diversity. The mitochondrial hypervariable region I (HVI) with 625bp in 75 individuals belonging to five Nepalese goat populations from different geographic regions were sequenced and analyzed. Seventy haplotypes were identified in the studied samples. The haplotype diversity and nucleotide diversity are 0.984±0.005 and 0.02625±0.036 respectively. Phylogenetic analyses revealed that there were three mtDNA lineages (A, B and D) identified in Nepalese goat, in which lineage A is predominant, followed by lineage B and lineage D is at low frequency. Those results show the multiple maternal origins of domestic goats. There was no significant geographical structuring in Nepalese goat populations as the result of the extensive transportation of goats from one place to another. Moreover, it was presumed that Nepalese goat breeds are more influenced by Indian goat but out of 76 sequenced samples, only 8 shared the same haplotype. This shows that Nepalese goats are having own uniqueness. Keywords: Capra hircus, mt DNA, lineages 1. Introduction The goat Capra hircus is an important livestock species in Nepal. Since it can be sold in any time, it is popularly known as the living bank; moreover Live ATM as it is very easy to sell goat due to its acceptance by all communities. Archaeological evidence indicates that the goat was one of the first animals to be domesticated in the Fertile Crescent region around 10,000 years ago (Porter 1996; Pringle 1998; Zeder and Hesse, 2000). Some studies have suggested that second domestication was in Pakistan for cashmere breeds (Meadow, 1996; Porter, 1996). It has been suggested that at least two wild species of the genus Capra have contributed to the gene pool of domestic goats (Clutton‐ Brock, 1981), supported by molecular data (Mannen et al., 2001). Mitochondrial DNA (mtDNA) contains highly informative polymorphic sites and its simple maternal inheritance without recombination makes it useful for the population studies in many organisms (Luikart et al, 2001). Luikart et al (2001) carried out a worldwide survey of domestic goat mtDNA diversity and identified seven different lineages (haplogroups). Lineage A was the most diverse and widely distributed across all continents. Lineage B was predominantly found in eastern and southern Asia, including China, Mongolia, Laos, Malaysia, Pakistan, and India; also in Spain. Lineage C was found in low frequencies in China, Mongolia, Switzerland, Spain, Slovenia, Pakistan, and India. Divergence times for these three lineages were estimated as more than 200,000 years ago among the five lineages, suggesting multiple maternal origins. Lineage D was rare, only in Pakistani, Indian and Chinese local goats. Lineage E was very rare, only found in India. Naderi et al (2007) also reported Lineage F and Lineage G, each having high haplotype diversity. Only 8‐10% of the mtDNA variation among continents or geographical regions due to extensive intercontinental transportation and movement within the regions and countries of goats (Luikart et al., 2001; Sultana et al., 2003; Joshi et al., 2004; Azor et al., 2005; Chen et al., 2006). Nepal is a developing country with good population of indigenous goat. Four known indigenous goat breeds were identified and characterized in phenotypic and chromosomal level (Neopane et al, 2005). Terai goat is well adapted to topography and climate of Terai region. Similarly 96 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Khari goat is well adapted to hill region throughout the country. This breed is mainly producing meat and well known for its prolificacy. Chyangra and Sinhal are for the high hills. Although neighbouring countries mainly in China, Pakistan and India are way ahead on phylogenetic study (Yan‐Ping Wu et al, 2009; Sulnata et al., 2003; Joshi et al., 2003), researchers in the country have paid a little attention to the genetic diversity of their own goat indigenous resources. The main objective of this study was to examine genetic diversity and phylogeography of five different Nepalese goats populations based on the analysis of mtDNA D‐loop hypervariable region. 2. Material and Methods 2.1. Population sampling Seventy five blood samples of five representative goat populations were collected. According to biochemical study (B.S. Kunwar et al, 2000), three distinct groups of Khari from East, West and Central hill region of Nepal were described. Therefore, samples were taken from three groups from Khari, one from Sinhal and one from Terai breed. Samples were collected from the goats which seemed true to type with the phenotypic characteristics. The individuals were unrelated genetically based on the information from the owners and also were cross‐checked with neighbors. The details of breeds, geographic regions and sample sizes were given in Table 1. Total genomic DNA was extracted from blood following the instructions of the manufacturer (TIANamp Blood DNA kit from Tiangen Biotech (Beijing) Co., Ltd.). 2.2. DNA amplification and sequencing Mitochondrial HVRI of goats was amplified using the primers: forward 5’ CATTACACCGCTCGCCTAC 3’ and reverse 5’ GGGCTGATTAGTCATTAGT 3’ (Wu, Y.P. et al, 2009). PCR amplification was carried out in 50 ul reaction mixtures including each primer (1ul of a 10 umol/L solution), dNTPs (4 ul of a 2.5 mmol/L solution), 5 ul of 10X buffer and 1.5 ul of 5U/ul Taq DNA polymerase (Tiangen Biotech, Beijing, China). The PCR conditions were an initial denaturing step at 95oC for 5 minutes followed by 35 amplification cycles (94oC for 30s, 56.2oC for 30s and 72oC for 30s) and a final extension at 72oC for 10 min in a Programmable Thermal Controller. All the PCR products were sequenced by Genomics.com.cn. 2.3. Analysis of sequence data Six‐hundred and twenty‐five base pairs from HVRI region of five different populations of Nepalese goats were edited using Chromas version 2.23. These sequences were aligned along with 22 reference sequences recommended by Naderi et al. (2007) using ClustalX program. The NJ tree was constructed using the program Mega 3.0 (Kumara et al, 2004). The MJ network was drawn using the program Network 4.2 (Bandelt et al, 1999). 3. Results 3.1. Sequence variation Seventy five mtDNA HVI sequences belonging to five different Nepalese goat populations were examined. Comparison of these sequences revealed 45 different haplotypes. Number of haplotypes found in each group ranged from 6 to 15 depending on the difference in number of samples and the diversity ranging from 0.89 to 0.971. Nucleotide diversity values ranged from 0.0153 to 0.03195 (Table 1). The analysis of Haplotype diversity and Nucleotide diversity showed that NGKB was least variable group and NGKI was high diverse group. Genetic diversity of five indigenous goat population of Nepal 97 Table 1: Breed names, geographic regions and sample sizes and Haplotype diversity and Nucleotide diversity Breed Abbr. Geographic distribution No. of samples No. of Haplotypes Haplotype diversity (±S.E.) Nucleotide diversity (±S.E.) Khari Bandipur NGKB Central Development Hill Region 20 14 0.947±0.034 0.03195±0.027 Khari Salyan NGKS Far West Dev. Hill Region 14 10 0.945±0.045 0.01769±0.022 Khari Ilam NGKI Eastern Dev. Hill Region 14 8 0.890±0.06 0.0153±0.021 Sinhal NGS Central Development Alpine Region 8 6 0.893±0.111 0.02926±0.022 Terai NGT Western Terai Region 19 15 0.971±0.027 0.02543±0.024 75 47 0.984±0.005 0.02625±0.036 Total 3.2 Phylogenetic analysis A neighbour‐joining phylogeny was constructed for the Chinese goats and 22 reference sequences. In the tree three different clusters (A, B and D) were present. Lineage A was predominant and followed by Lineage B. Lineage D represents only one sample. Lineages A and B was found in all breeds. Only one sample of Khari belonged to Lineage D. Lineage B Lineage A Lineage D Figure1. Median joining (MJ) network showing genetic relationships among Nepalese goat haplotypes for mtDNA HVR1. 3.4 Comparison with goat sequences from neighbor countries Presuming the possibility of the interference in the indigenous goat from the goats of neighboring countries, Nepalese goat sequences were compared with Indian, Pakistani and Chinese (Tibet) goats. Only a few Nepalese goat sequences shared with others. These showed the probable uniqueness in the Nepalese goat (Table 2). 98 RBI 8th Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2 Comparison of Nepalese goat with goat from neighbor countries Country Shared sequences Samples shared India 8 out of 75 6 Terai (12, 4, 26, 18, 19, 21) and 2 Khari Salyan (48, 37) Pakistan 1 out of 75 Khari Salyan (37) China (Tibet) 2 out of 75 Terai (4) and Khari Salyan (37) 4. Discussion The mitochondrial DNA D‐loop region is very polymorphic as reported by many authors (Chen et al, 2005; Keyser‐tracqui et al, 2005). Nepalese goat mtDNA sequences showed notable diversity. Forty‐five haptotypes were identified in 75 samples. The wide variablity Nepalese goat mtDNA sequences maybe caused by the multiple origin of the population, in accordance with the results of other authors (Liu et al, 2006; Chen et al, 2005) studying different goat populations. Some haplotypes were shared by individuals of different breeds from different geographical regions. These results suggested that there was no correspondence between the geographical regions of origin and among the breeds. The weak phylogeographic structure could be explained by the frequent human movement from one place to other. The goat is known to be the most adaptive species in the new environment may be the reason for multiple origin of the breed. Thus gene flow or gene exchange occurred among different populations (When et al, 2004). However, since there were few samples of Nepalese goat sequences shared with foreign goat sequence, it seems that there is uniqueness in the Nepalese population which needs to be studied in detail. 5. Acknowledgement This work was funded by “IFAR fellowship” of World Bank through International Livestock Research Institute (ILRI) and logistic facilities were provided by Joint Lab of ILRI and CAAS (JL‐ILRI‐ CAAS) at Beijing, China. This fellowship was a great opportunity to undertake this study (an initiation of molecular work in Nepal) with international institutions. 6. REFERENCES Kunwar, B.S., M. Kharel and S.P. Neopane, 2000. Haemoglobin and transferrin polymorphism in Nepalese hill goats. Proc. 4th National Anim. Sci. Conv, 141‐151. Bandelt, H., foster, P., Rohl, A., 1999. Median Joining Networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16:37‐48 Chen SY, Su YH, Wu SF, Sha T, Zhang YP, 2005. Mitochondrial diversity and phylogeographic structure of Chinese Domestic Goats. Molecular Phylogenetic and Evolution 37, 804‐814 Clutton‐Brock, J., 1999. A natural history of domestication animals. Cambridge University Press. Joshi, MB, Rout PK, Mandal AK, Tyler‐Smith C, Singh L, Tangaraj K. 2004. Phylogeography an origin of Indian Domestic Goats. Molecular Biology and Evolution 21, 454‐463 Keyser‐tracqui, C., Blandin‐Frappin, P, Francfort, HP, Ricaut, FX, Lepetz, S 2005. Mitochondrial DNA analysis of horses recovered from a frozen tomb (Berel site, Kazakhstan 3rd Century BC). Animal Genetic 36:203‐209 Kumara, S, Tamura, K., Nei, M., 2004. MEGA3: Intergrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150‐160 Liu RY, Yang GS, Lei, CZ, 2006. The genetic diversity of mtDNA D‐loop and the origin of Chinese goats. Acta Genetica Sinica 33, 420‐428 Genetic diversity of five indigenous goat population of Nepal 99 Luikart, G., Gielly, L., Excoffier, L., Vigne, J.D., Bouvet, J., Taberlet, P., 2001. Multiple maternal origin and weak phyleographic structure in domestic goats. In: Proceeding of the national academy of sciences of the United States of America, Vol. 98, pp. 5927‐5932. Mannen, H., Y. Nagata, and S. Tsuji, 2001. Mitochondrial DNA revealed that domestic goat (Capra hircus) are genetically affected by two sub‐species of Bezoar (Capra aegagurus). J. Biochem., Genet. 39145‐154 Meadow, A. 1996. Animal domestication in the Middle East: a revised view from the earning margin. Pp. 295‐ 320 in G. Possehl, ed. Harappan civilization. Oxford and IBH, New Delhi. Naderi S, Rezaei H R, Taberlet, P., Zundel, S, Rafat SA, Naghash, HR, El‐Barody MA, Ertugrul, O, Pompanon F, 2007. Large‐scale mitochondrial DNA analysis of the domestic goat reveals six haplogroups with high diversity. PLoS ONE 2, e1012. Neopane SP, Gorkhali, NA and Pokhrel, PK, 2005. Indigenous goat breeds of Nepal. Published by Animal Breeding Division, Nepal Agricultural Research Council, Pp 15. Porter V, Tebbit J. 1996. Goats of the world. Farming Press Limited, Ipswich. Pringle H. 1998. Neolithic Agriculture: Reading the science of ancient animals domestication. Science 282, 1448. Sultana, S, Mannen H, Tsuji, S. 2003. Mitochondrial DNA diversity of Pakistani goats. Animal Genetics 34, 417‐ 421. Wen, B, Li H, Lu D, Song, X., Zhang, f., He, Y., Li, F., Gao, Y., Mao, X., Zhang, L., Qian J., Tan J., Gin, J., Huang, W., Deka, R., Su B, Chakrawarty R., Jin, L., 2004. Gentic evidence supports demic diffusion of Han culture. Nature 431, 302‐305 Zeder, M. A., Hesse, B., 2000. The initial domestication of goats (Capra hircus) in the Zagros mountain 10,000 years ago. Science 287, 2254‐2257 GENETIC DIVERSITY OF TURKISH NATIVE SHEEP IN CONSERVATION STUDIES İnci TOGAN1*, Sevgin DEMİRCİ1, S. Can AÇAN1, Evren KOBAN BAŞTANLAR2, Hande ACAR1, Eren YÜNCÜ1, Cihan AYANOĞLU1, Arif PARMAKSIZ3 1 2 Department of Biology, Middle East Technical University, Ankara, Turkey Genetic Engineering and Biotechnology Institute, TUBITAK Marmara Research Center, Kocaeli, Turkey 3 Department of Biology, University of Harran, Şanlıurfa, Turkey * Corresponding author: togan@metu.edu.tr Abstract Genetic diversity within and among 13 sheep breeds which are mostly native breeds of Turkey were investigated using mtDNA haplogroups determined by ND2 SSCP and 20 microsatellite loci. With regard to mtDNA data, five previously identified mitochondrial haplogroups (A‐E) were observed among the samples (n=627); Haplogroup B was dominant (64%) in over‐all. Microsattelites were used for model‐based clustering analysis which indicated that breeds are highly admixed. Sakız seemed to be the most distinct breed of all. Both mtDNA haplogroups and microsattelites were employed for calculating pairwise FST values of the breeds to construct synthetic maps of Turkey. These maps suggested that there is a gradient of diversification between the breeds in the direction of northeast‐southwest of Turkey. Conservation of İvesi, Karayaka and Kıvırcık surrounding the edges of the gradient seemed to be appropriate to capture the total genetic diversity of Turkish sheep breeds. Available data on‐Y chromosome haplotypes and preliminary data on enJSRV retrotypes also contributed to the understanding of presence of different genetic groups of sheep which must further be taken to account in conservation studies. Keywords: Domestic sheep, mtDNA, microsatellite, enJSRV retrotypes, conservation Introduction New realizations in relation to signatures of transition from hunting to herding indicated that earliest archaeological evidences of sheep domestication are in the region that stretches from central Anatolia to northern Zagros Mountains (for review see Zeder, 2008). After the first mass migration of the primitive sheep breeds from the center of domestication it is believed that the second mass migration of sheep then specialized in “secondary” product took place, possibly from the southwest Asia to Europe (Chessa et al., 2009). Anatolia in parallel to rise and fall of various civilizations such as the Hattians, the Hittites, the Phrygians, the Lydians, the Urartians, the Medes, the Romans, the Byzantians, the Seljuk Turks and the Ottomans was subjected to numerous human migrations, possibly accompanied by their livestock, from multiple regions. Furthermore, sheep breeds are not isolated and ram transfer between the breeds is quite common in Turkey. Hence, the genetic landscape formed after the early days of sheep domestication might have been made more complex. With respect to maternal lineages, fıve haplogroups (A‐E) were identified in global scale and these were all present in Turkish sheep breeds (for instance see Meadows et al., 2007; Meadows et al., 2011). Studies using microsattelite loci indicated that Turkish breeds have relatively high genetic diversity (Uzun et al., 2006; Gutiérez‐Gil et al., 2006) together with those from Near East (Lawson‐ Handley et al., 2007; Peter et al., 2007) and they are little differentiated from each other compared to the European sheep (Lawson‐Handley et al., 2007; Peter et al., 2007). For the Turkish breeds, Y chromosome based haplotypes (Meadows et al., 2008; Oner et al., 2010) and enJSRV retrotypes (Chessa et al., 2009) were also reported. Yet, information from all these different markers were not considered together for the Turkish breeds. th 102 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Purpose of the study is to contribute to the understanding of genetic landscape of the Turkish sheep and thereby help in priority setting for conservation of Turkish sheep breeds. In the present study, genetic diversity of Turkish breeds was examined mainly by mtDNA haplogroups and microsattelite loci. Results were considered together with the available information from the literature. Materials and Methods Samples Among the 11 registered, pure native sheep breeds 10 of them (Akkaraman, Morkaraman, Kıvırcık, Karayaka, İvesi, Gökçeada, Dağlıç, Sakız, Çine Çaparı, Norduz), a native but not registered one (Hemşin), a transported but living under native environment without isolation Karagül, a hybrid of native breeds Herik, altogether 13 breeds (http://www.sheep101.info/breeds.html) were sampled (n= 627) by the Ministry of Food, Agriculture and Animal Husbundary. Sampling sites are shown on Figure 1. Figure 1. Sampling sites for the Turkish sheep breeds. In order to obtain mtDNA haplogroup diversity of the breeds, hundred mtDNA CR sequences of Turkish sheep were obtained. They were aligned together with those representing different haplogroups given by Meadows et al. (2007). Length of the aligned sequences was 521 bp long. Thereby, sequenced individuals were identified with respect to their mtDNA haplogroups. Part of mtDNA ND2 region (Guo et al., 2005) of individuals now with the identified haplogroups were amplified and subjected to SSCP analysis. Observed patterns were used to identify haplogroups of further 527 individuals by SSCP. E and C haplogroups could not be differentiated by SSCP therefore all of those were sequenced and their haplogroups were identified. FST values between the breeds were calculated by Arlequin package program (Excoffier et al., 2006). Individuals are also examined based on 20 microsatellite loci which were all among the recommended ones by Food and Agriculture Organizations of the United Nations. List of loci and the method of genotyping will be sent if requested. Alleles of 20 microsatellite loci were determined. Occurrences of null alleles were tested using freeNA software (Chapuis and Estoup, 2007). Linkage disequilibrium estimations were (for each breed and total sample) done on all loci with FSTAT V.2.9.3 package program (Goudet, 2001; http://www.unil.ch/izea/softwares/fstat.html). Pairwise FST (a measure of genetic diversity between the populations) values were estimated using GENETIX Software v.4.05 (Belkhir, et al., 1996‐2004; http:// univ‐montp2.fr/~genetix). Deviations from Hardy‐ Weinberg equilibrium were assessed by permutation tests. Results were subjected to Bonferroni correction. The population structure and the level of admixture in the sheep breeds were analyzed Genetic Diversity Of Turkish Native Sheep In Conservation Studies 103 by using STRUCTURE v2.2.3 (Pritchard et al., 2000). For different K (assumed number of clusters), similarity between results of individual runs were calculated by CLUMPP (Jakobsson et al., 2007) METAPOP (Pérez‐Figueroa et al., 2008) was used to to evaluate contributions of the breeds to the total genetic variability observed from all sheep. Pairwise FST values between the breeds were used and ArcGIS program (http://www.esri.com/software/arcgis/extensions/spatialanalyst/index.html) was employed to obtain synthetic maps of Turkey composed of Turkish breeds evaluated by first mtDNA haplogroups then microsattelites loci. Some individuals (n= 60) from Dağlıç, Sakız, Kıvırcık were recently started to be examined for polymorphic endogenous retrovirus sites as was explained in Chessa et al.’s (2009) paper. Results and Discussion All mtDNA haplogroups (A‐E) observed in domestic sheep were present in 627 sheep sample of the present study as would be expected for the large number of sheep from the center of domestication. All microsattelite loci exhibited null alleles below the threshold value (0.2) used by Lawson‐ Handley et al. (2007) in domestic sheep. They were all in Hardy‐Weinberg and linkage equilibrium. Only MAF 214 had null alleles in many of the breeds. Therefore it was excluded from the analysis. Results of Structure analysis for two different K (K=2, K=13) values with their similarity values are shown in Figure 2. K=2 has the highest similarity between the runs. It divides peripheral or relatively local breeds from the central/ major breeds except Gökçeada inhabiting an island (300 km2 and 37 km away from the Aegean cost). It can clearly be seen from Figure 2 that all breeds are admixed in various degrees in terms of microsattelites. Sakız seemed to be the least admixed; out of 13 assumed clusters (K=13) 80.27 percent of the Sakız was represented by one cluster. Dağlıç, Herik and Norduz were the most admixed ones. Only 25% of Dağlıç was represented by one cluster and the rest by other clusters with smaller percentages. Figure 2. Population structure obtained by STRUCTURE analysis. Each individual is represented by a thin bar. Each color represents a cluster and number of clusters are given by K. H’ is the similarity coefficient between the runs. Breed names are Sakız (SKZ), Karagül (KGL), Hemşin (HEM), Çine Çaparı (CIC), Norduz (NOR), Herik (HER), Dağlıç (DAG), Morkaraman (MOR), Kıvırcık (KIV), Karayaka (KRY), İvesi (IVE), Gökçeada (GKÇ), Akkaraman (AKK). Meta‐population analysis indicated that Sakız contributes the most (9.34%) to between group diversity. However, it has moderate contribution to the total genetic diversity of the Turkish breeds (7.7% and it ranks the 9th). Karayaka, Kıvırcık, İvesi and Dağlıç are the breeds with highest within breed genetic diversities. If one breed is going to be conserved Karayaka can be the one. If both within and between genetic diversities are going to be conserved and if two breeds are going to be conserved it can be Kıvırcık‐ İvesi pair. For the three breeds, it can be proposed that Karayaka‐ th 104 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Kıvırcık –İvesi must be conserved. These three breeds seemed to capture total genetic diversity of the Turkish breeds. If between genetic diversity is weighted by 2 (Bennewitz, Meuwissen, 2005) or 5 (Piyasatian and Kinghorn, 2003) times more than the within group breeds İvesi is the one on the top of the list. All in the above analysis it is assumed that breeds can be represented by the samples of the present study. Since breeds are highly admixed synthetic maps of Turkey by using both mtDNA haplogroups and microsattelites were constructed and given in Figure 3. These maps suggested that there is a gradient of diversification between the breeds in the direction of northeast‐southwest of Turkey. Which is consistent with the migration routes of first domesticated sheep (Clutton‐Brock, 1999) and pehaps with the migration route of the sheep specialized with the wool product (Chessa et al., 2009). a) b) Figure 3. Synthetic maps of Turkey. Genetic markers of the breeds are: a) mtDNA haplogroups, b) 19 microsattelite loci On the other hand, absence of Y‐Chromosome dependent European (H5 and H7) and of Asian (H4) haplotypes in Karayaka, Kıvırcık, Gökçeada, Sakız (Meadows et al., 2008; Oner et al., 2010) confirms the presence of a unique zone of sheep breeds. Northeast‐ southwest trend does not indicate the presence of a zone between the European and Asian breeds. Karayaka and Kıvırcık represent this zone if the suggested three breeds (Karayaka, İvesi, Kıvırcık) will be conserved. On the other hand, preliminary results of enJSRV polymorphisms on Dağlıç suggested that it may be harboring 10 % R1 retrotype which is associated with primitive breeds only (Chessa et al., 2009). Inconformity of this observation R1 retrotype was also observed in the sheep inhabiting Lesvos Island (Chessa et al., 2009) which is close to distribution area of Dağlıç. Hence, another population event Genetic Diversity Of Turkish Native Sheep In Conservation Studies 105 event (presence of products belonging to the first migration) would be missed if only mtDNA and microsattelites would be studied. Observation of relatively high frequency of R1 is the sign that some breeds in Turkey such as Dağlıç may be raised to rare breed status and may gain high priority in conservation. These results point out that in prioritization of the breeds their genetic diversity must be examined by different markers. Acknowledgement This study was supported by Scientific and Technical Research Council of Turkey (TUBITAK) as a part of the project In Vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources‐I (TURKHAYGEN‐I). We thank to Mr. Alper Döm for microsattelite typing. REFERENCES Belkhir, K., Borsa, P., Chikhi, L., Raufaste, N. and Bonhomme, F. (1996–2004) GENETIX 4.05, logiciel sous Windows pour la genetique des populations. Universite´de Montpellier II, Montpellier, France. Bennewitz, J. and Meuwissen, T.H.E. (2005) A novel method for the estimation of the relative importance of breeds in order to conserve the total genetic variance. Genetics Selection Evolution 37:315‐337 Chapuis, M‐P. and Arnaud E. (2007) Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24:621‐631 Chessa, B., Pereira, F., Arnaud, F., et al. (2009) Revealing the history of sheep domestication using retrovirus integrations. Science 324:532‐536 Clutton‐Brock, J. (1999) A natural history of domesticated mammals. Cambridge University Press Excoffier, L., Laval G. and Schneider, S. (2006) Arlequin: An integrated software package for population genetics data analysis, Version 3.1, Institute of Zoology, University of Berne, Bern, Switzerland Goudet, J. (2001) FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3) Guo, J., Du, L.X., Ma, Y.H., Guan, W.J., Li, H.B., Zhao, Q.J., Li, X., and Rao, S.Q. (2005) A novel maternal lineage revealed in sheep. Animal Genetics 36:331‐336 Gutiérrez‐Gil, B., Uzun M., Arranz, J., Primitivo, F.S., Yildiz, S., Cenesiz, M. and Bayon, Y. (2006) Genetic diversity in Turkish sheep. Acta Agriculturae Scandinavica 56:1‐7 Jakobsson, M. and Rosenberg, N.A., (2007) CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23:1801‐180 Lawson Handley, L.J., Byrne K., Santucci F., Townsend S., Taylor M., Bruford M.W. and Hewitt G.M. (2007) Genetic structure of European sheep breeds. Heredity 99:620‐631 Meadows, J.R.S., Cemal, I., Karaca, O., Gootwine, E. and Kijas, J.W. (2007) Five ovine mitochondrial lineages identified from sheep breeds of the Near East. Genetics 175:1371‐1379 Meadows, J.R.S. and Kijas, J.W. (2008) Re‐sequencing regions of the ovine Y chromosome in domestic and wild sheep reveals novel paternal haplotypes. Animal Genetics 40:119‐123 Meadows, J.R.S., Hiendleder, S. and Kijas, J.W. (2011) Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel. Heredity 106:700‐706 Oner, Y., Calvo, J.H. and Elmaci, C. (2010) Y chromosomal characterization of Turkish native sheep breeds. Livestock Science 136:277‐280 Pérez‐Figueroa, A., Saura, M., Fernández, J., Toro, M.A. and Caballero, A. (2008) METAPOP‐A software for the management and analysis of subdivided populations in conservation programs. Conservation Genetics 10:1097‐1099 Peter, C., Bruford M., Perez T., Dalamitra S., Hewitt G., Erhardt G. and Econogene Consortium (2007) Genetic diversity and subdivision of 57 European and Middle‐Eastern sheep breeds. Animal Genetics 38:37‐44. th 106 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Piyasatian, N., Kinghorn, B.P. (2003) Balancing genetic diversity, genetic merit and population viability in conservation programmes. Journal of Animal Breeding and Genetics 120:137‐149 Pritchard, J.K., Stephens, M., Donnely, P. (2000) Inference of population structure using multilocus genotype data. Genetics 155:945‐959 Uzun M., Gutierrez‐Gil B., Arranz J., Primitivo F., Saatci M., Kaya M. and Bayon Y. (2006) Genetic relationships among Turkish sheep. Genetics Selection Evolution 38:513‐524. Zeder, M.A. (2008) Domestication and early agriculture in the Mediterranean Basin: origins, diffusion and impact. Proceedings of the National Academy of Sciences 105:11597‐111604 TRENDS IN METHODS FOR GENETIC EVALUATIONS OF FARM ANIMALS AND THE CONTROL OF THE RATES INBREEDING Raphael Mrode Scottish Agricultural College, Roslin Institute Building, Easter Bush, Edinburgh, EH25, 9RG, UK Introduction In the first section, this paper charts the trend of developments in the methods of genetic evaluations for farm animals from the 1940’s until now. These advances in methods for genetic evaluation have also been accompanied with increased levels of inbreeding and consequently developments of methods to control rates of inbreeding. In the second section, such trends for the methods for controlling the rates inbreeding are discussed. Trends in methods for genetic evaluation Huge economic benefits have been achieved as a result of genetic improvement in beef and dairy cattle and sheep. In the United Kingdom, for instance, it has been estimated that genetic progress in growth and carcass traits in dual‐purpose beef breeds over a 10 year period could result in economic benefit of about £18.2 million over a 20 year time frame (Amer, et al., 2007). Similar figures for hill sheep and terminal sire breeding programmes were estimated to be £5.3 and £11.5 million. Undergirding these genetic improvement programmes is the accurate genetic evaluations of animals on which selection are based. Genetic evaluation methods therefore constitute an important component of improvement programmes and have evolved over time for the optimal use all available information. In the dairy cattle, evaluations were based on the simple Contemporary Comparison up to the 1960s (Henderson et al, 1954). This was replaced by the modified contemporary comparison to adjust for the average genetic merit of the sires of herd mates and also for genetic trend. However, the appropriate corrections for age effects and other fixed effects were not optimal. Genetic evaluation methods were completely transformed with the introduction of Best Linear Unbiased Prediction (BLUP) in 1950 (Henderson 1949). BLUP gradually became the method of choice for genetic evaluation at the national level from the 1970’s. Currently about 30 countries submitting data for International evaluation at the Interbull centre, utilise BLUP based methodology for their national evaluation (www.interbull.org). It has evolved in terms of its application from sire model, sire and maternal sire model in the early years to univariate and multivariate models in the more recent years. Advances in computational methods and computing power have enhanced this development. In beef cattle and sheep, performance testing constitutes the major route of improvement especially for growth traits. Thus the use of selection indices were more pronounced until BLUP was introduced. However, with the advent of BLUP, most evaluation methods in beef are based on multivariate models usually accounting for maternal effects (Quaas and Pollak (1980). However, the longitudinal nature of the data for the dairy cattle resulted in further developments in methods to explore this data structure. Thus covariance functions and random regression methods for genetic evaluation for productive traits were introduced in the early 1990’s. These models accounted for the covariance structure over time and better correction of fixed effects at the time of test (Kirkpatrick et al,1990,1994; Schaeffer and Dekkers,1994). These models have also been applied in a limited scale in the beef cattle (Meyer, 2004). Improvements in reproductive technologies in form of artificial insemination, embryo transfer, freeing of semen and embryo have resulted in huge international trade in cattle. This has resulted in th 108 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) the emergence of a global breeding structure for the Holstein/Friesian in particular in the early stages (1990’s) and now for almost dairy and beef breeds. Thus bulls are currently used or progeny tested in several countries. The emergence of the global breeding structure created the need to provide genetic evaluation for dairy sires at the initial stage. This was essentially in order to account for the effects genotype by environment interactions. Initial methods were based on computing conversion formulae based on bulls with breeding values in the two counties of interest. Interbull was formed in 1983 to handle these operations. This was confronted with problem of obtaining adequate numbers of reliable bulls especially for functional traits. In 1986, a linear model that accounts for effects of the country and genetic groups was introduced assuming a genetic correlation of unity among countries. This was replaced by the Multiple Across country Evaluation (MACE) in 1994 which accounted for the genetic correlation among countries( Schaeffer, 1994). Currently about 30 countries participate in international evaluations with 38 traits evaluated for 6 dairy breeds. The methodology utilises de‐regressed national proofs, fitting a sire, maternal grandsire model (www.interbull.org). Developments in international evaluations have been slower in beef cattle. Interbull started the Interbeef project 2006. This involves a joint analysis of performance data from several countries. An animal model with direct and maternal permanent environment effects have been applied to analysis Limousin and Charolais weaning weight data from about 5 countries (www.interbeef.org). In the late 1980’s, there was the emergence of genetic markers and their incorporation into genetic evaluations. At this stage, most work on genetic markers utilised microsatellites, which were highly polymorphic short sequences of repetitive DNA and explored linkage disequilibrium within families (linkage analysis). Fernando and Grossman (1989) presented a methodology, which incorporated marker information into BLUP procedure for the genetic evaluation of animals. However in recent years, another class of genetic markers, called single nucleotide polymorphisms which are very abundant in the genome has revolutionised the utilisation of markers in practical animal breeding. Due to linkage disequilibrium between SNPs and quantitative trait loci for economic traits, breeding values can be computed directly for animals on the basis of SNP effects (Meuwissen, et al , 2001). These are referred to as genomic breeding values (GEBV) which can then used to select animals (genomic selection). GEBV can be obtained early in life, reducing the generation interval and are also associated with increased accuracy. Currently, about 10 countries compute GEBVs as part of their national evaluation system. Most countries fit a linear model to model the SNP effects (VanRaden, 2008). On the international level, Interbull is working of a methodology to incorporate genomic information into MACE. A high density SNP chip of 800k has just been developed for the dairy cattle. In addition, a 3K SNP chip has also been released. This will make it possible for farmers to genotype their cows at affordable rate. The collection of phenotype will continue to play a major part for the utilisation of new molecular biological tools. In future, it is possible that the genome of some key sires might be fully sequenced making possible to almost impute the genome of their progeny and a host of related animals by imputation. Breeding value prediction will then simply comprise of summing the SNP effects over the whole genome for an animal. Trends in methods for the control of Inbreeding Inbreeding is the out come of the mating of individuals that are related to each other by ancestry. In other words, it occurs when an animal has two ancestors in common. In a sense, all populations are finite to various degrees, therefore inbreeding is inevitable as in a generation t, 2t distinct ancestors are needed from the base generation to avoid inbreeding completely (Falconer and Mackay, 1996). It becomes obvious that the number of required ancestors becomes untenable in any real population. Therefore the major challenge is how to monitor and manage inbreeding rather to completely avoid it. The control of inbreeding is essential due to the resultant decline in Trends in Methods For Genetic Evaluations of Farm Animals and The Control Of The Rates İnbreeding 109 performance termed inbreeding depression observed especially in fitness traits such as survival and reproductive ability. The trend in methods for genetic evaluation has had a corresponding influence on the rates of inbreeding (ΔF). Relative to mass selection or even selection index, BLUP places more emphasis on parental population and hence in the selection of more related individuals. Bijma and Woolliams (2000) presented ΔF at different levels of heritability under mass selection and selection on BLUP. They reported that with mass selection ΔF increases as heritability (h2) of the trait increases from zero, reaching a plateau when h2 is between 0.4 and 0.7 before reducing again. However with truncation selection on BLUP, ΔF decreases with increase in h2 until it converges with mass selection as h2 approaches unity. Thus at lower levels of heritability BLUP places much emphasis on family information and hence increased rates of inbreeding. Therefore methods for controlling inbreeding will be influenced by the method of selection applied. Some of the traditional methods that have been used to control the ΔF involve utilising the inbreeding coefficients of the parents or those of their offspring and secondly using the effective number of founders (Woolliams, 2007). The problem with the first approach is that it ignores the coancestry coefficient of the parents of the next generation which is the important factor rather than the inbreeding coefficients. The second approach only manages the genetic contributions from an arbitrary founding generation but what is needed is the managing of contributions from all generations (Woolliams, 2007). Some of the developments in the methods for the control of inbreeding have considered several factors such as the effective population size (Ne) at which the breed is maintained, selection of animals within the population, the mating strategy and monitoring of pedigree (Meuwissen, 2007). Ne is directly related to the ΔF, such that ΔF = 1/2Ne (Falconer and Mackay, 1996). Effective population size is important mainly from two angles deleterious mutations with large effects are likely to drift to high frequencies when Ne is smaller. Secondly the accumulation of natural selection pressure which operates to remove harmful inbreeding depression is less effective when Ne is small. Balancing the drift of current deleterious mutations against natural selection, Meuwisssen and Woolliams (1994) concluded the critical Ne, below which fitness traits decline steadily is between 50 and 100. Thus one of the basic steps in maintaining ΔF is ensuring a minimum Ne of 50 which gives a rate of inbreeding of 1% per generation. It should be noted that actual population should be larger than 50 because of unequal numbers of males and females or selection. In view of this vital relationship between Ne and ΔF, FAO (1998) gave simple recommendations for numbers of parents required to achieve Ne of 50 under mass selection and three scenarios; (i) selection is within families, (ii) selection is random and (iii) mass selection with h2 = 0.04. For instance the FAO recommended about 25 sires and dams for random selection and 35 sires and dams for mass selection assuming 6 progeny per female reproductive lifetime for an Ne of 50. Given the relationship ΔF and Ne, the rate of inbreeding can be controlled by monitoring the Ne through the average kinship across all pairs of animals in the population. Increases in the ΔF results from the increase in average kingship in the population, therefore the rate of inbreeding in future is best described by the current coefficient of kinship. The Ne can be monitored by computing the average kinship across all pairs of animals as (Falconer and Mackay, 1996; Meuwissen, 2007): C = 0.25( C (m)+ C (f)) + 0.5C(mf) (1) where C(m), C (f) and C(mf) are the average kingships between all pairs of males, females and male‐female pairs respectively, excluding pairs of animals with itself. The rate of increase in average kingship per year, ΔC(yr) can be computed and expressed per generation as ΔC(gen) = ΔC(yr) L, where L is the generation interval. Therefore Ne is 1/( ΔC(gen)) animals per generation and ΔC(gen) will equal the observed ΔF. Thus records of pedigree can be used in this manner to monitor the size of Ne and therefore the rate of future inbreeding. th 110 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) In the early 1990’s, the concept of long term contributions and it relationship to ΔF was first derived by Wray and Thompson (1990)). The long term contribution (r) of an ancestor i can be defined as the proportion of genes in the population derived from i by descent many generations later. When average r is large or highly variable or both, it is indicate of either few ancestors or unequal contribution among ancestors. A measure that would capture such increases in the mean and variability of r is the sum of squares of contributions. Wray and Thompson (1990) and Woolliams and Bijma (2000) showed that the relationship between the rate of inbreeding and sums of squares of contribution as: ΔF = ¼(1 ‐ α) Σr2i (2) where ri is the long term contribution of an individual summed over all animals in the generation, α measures the deviation from fully random mating, such that α >0 represents preference for mating relatives and α less than zero indicates avoidance of relatives. The above indicates that ΔF is minimised when all contributors make equal contributions to the future generation. This also implies equal contributions between males and females and therefore equal numbers of males and females in populations with both genders. However, in some cases due to management reasons, equal number of males and females may be difficult to achieve. Sanchez et al, (2003) presented mating ratios that minimise ΔF through minimising long term contribution assuming random mating. The use of equation (2) is limited as it relates to observed contributions. Woolliams and Bijma (2000) showed that future ΔF can be predicted as a result of predicting the expected long‐term contribution of an individual conditional upon it selective advantage. They showed that for random mating with Poisson litter sizes that ΔF = ½ Σ E(u2i) (3) 2 were E(u i) = E(ri ‫ ׀‬Ai) , with Ai being the breeding value of the individual i. The use of this equation for prediction of ΔF for index selection, overlapping generations, mass selection and truncation selection based on BLUP have been demonstrated by Woolliams and Bijma, (2000), and Bijma and Woolliams ,(2000). It should be noted that equation (1) can also be derived using the average genetic relationship among individuals by noting that 0.5Aij = Cij, with Aij being the additive genetic relationship between i and j. Implicit in equation (1) is that the fact the average inbreeding in the offspring generation equals the average coancestry of the parents we are currently selecting. Thus the future rate of inbreeding can be controlled by controlling the average coancestry of the selected parents. Muewissen (1997) demonstrated that optimum contribution (OC) as one of the methods to achieve this is. In OC, the aim is to either minimise the average coancestry among selected parents or to maximise genetic improvement while the average coancestry is restricted among selected parents. Thus the number of offspring each parent should contribute is determined using OC and this directly affects the ΔF and hence determines the future Ne. Meuwissen (2007) presented a simplified approach that minimises average coancestry among selected parents ( not selecting for genetic gain in any trait) using: (4) Cav = Σi Σj pipjCij where Cav is the average coancestry of selected animals, Cij is coefficient of coancestry between animals i and j, pi is the contribution of animal i to the next generation and Σi (Σj ) means summation is over all selection candidates. Note that if ni is the number of progeny from animal i, then pi = 0.5ni /N with N being the total number of progeny. Thus the optimum contribution pi, the number of progeny animal i should contribute equals ni = 2Npi. Expressing equation 4 in matrix form, the optimum contribution pi that minimises Cav can be computed as: Cav = p’C p and Cav is minimised when contributions are: p = 0.5C‐1Q(Q’C‐1)‐11 Trends in Methods For Genetic Evaluations of Farm Animals and The Control Of The Rates İnbreeding 111 with C = matrix of coefficients of ancestry size m by m; m is the number of selection candidates, p is the vector contributions, 1 is vector of ones, Q of size m by 2 is an incidence matrix of the sex of the selection candidates where the elements of first column are one for male and zero for female and vice versa for second column. Meuwissen (1997) extended OC to include situations when selection is on BLUP. The aim then is to maximise genetic gain, while controlling rate of inbreeding. In a simplified form, it involves the genetic merit of selected parents being weighted by their contribution. As Meuwiseen (1997) showed, it involves maximising G = Σj pj BVj = p’EBV with the restriction that Cs= p’Cp and Q’c = 0.5, where Cs is the restricted average coancestry which can equals 1 – (1‐ ΔFd)t, and t is the generation number and is the desired rate of inbreeding. Meuwissen (1997) gave the optimum solution for p as: p = A‐1(EBV –Qδ)/(2δ0) , where are δ and δ0 Lagrangian multipliers. Grundy et. al (1998) presented a similar approach to constrain ΔF through controlling total increase in squared genetic contributions. He replaced A and A*, where A*t+1= ZtA*Zt + D, where D is a diagonal matrix with elements equal to ½ and Zt is a gene flow matrix identifying parents of generation t + 1. For the base generate, t =0 and A*0 = I. Meuwissen and Sonesson (1998) and Grundy et al. (2000) have also extended the OC under selection to populations to overlapping generations. Developments for the methods for the control of inbreeding have also focused on mating schemes. Non‐random mating of individuals with a restriction on close relatives such as full or half sibs is the most simple and straight forward mating strategy. However factorial mating which implies each mating obtains only one offspring or as few progeny as possible is more optimum approach. It attempts to equalise the relationship among the progeny as to facilitate OC selection Kinghorn et al, (2002) and Fernandez et al, (2001) presented strategies that optimise selection and mating in one step and these are usually called mate selection. It involves maximising a selection criterion that incorporates average relationship of selected parents, genetic gain and average inbreeding of the progeny, with the user defining the weights on these various components. In more recent genetic evaluations have involved the incorporation of molecular information through the use of markers and SNPs. Marker assisted selection programmes are focused on a few QTL and therefore on a limited part of the total genetic variation (Meuwissen, 2007) . Thus inbreeding is likely to build up more in positions in the genome close to the QTL (and application of OC will be needed to control the build up of kingship and inbreeding in the population. Genomic selection involves selection for the total genetic variance although strong selection for particular chromosome regions can reduce genetic variance in large parts of the genome. It will therefore be necessary to apply OC selection either using kinship based on markers or pedigree or both will be necessary. (Meuwissen, 2007) Conclusion, In the early 1940’s, methods for genetic evaluations were focused on contemporary comparison especially in dairy cattle or mass selection with little information from relatives incorporated. Over time this has evolved into the use of selection indexes, and BLUP that involved the incorporation of all available family information. In the late 1980’s molecular information were incorporated using genetic markers such as microsatellites. However in recent years, the discovery of SNPs has revolutionised the utilisation of markers in practical animal breeding. Concurrently, methods for the control of inbreeding have advanced from the mere use of the inbreeding coefficients of individuals to methods that minimises kinship among selected parents (optimum contribution), that consider long‐term contribution from ancestors and mating schemes such as factorial mating. th 112 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Amer, P.R, Nieuwhof, G.J., Pollott, .G.E, Roughsedge, T., Conington, J. and Simm, G. 2007. Industry benefits from recent genetic progress in sheep and beef populations. Animal 1:10, 1414‐1426 Bijma, P. and Woolliams, J.A., 2000. Prediction of rates of inbreeding in populations selected on best linear unbiased prediction of breeding value. Genetics 156:361‐373 Falconer, D.S, and Mckay, T.F.C. 1996. Introduction to quantitative genetics. 4th Edition. Longman FAO, 1998. Secondary Guidelines for the National Farm Animal Genetic Resources Management Plans: management of Small Populations a Risk. FAO, Rome, Italy Fernando, R.L. and Grossman, M.1989. Marker‐assisted selection using best linear unbiased prediction. Genetics Selection Evolution 21,467‐477. Fernandez, J., Toro, M.A., and Caballero, A. 2001. Practical implementation of optimal management strategies in conservation programmes: a mate selection method. Animal Biodiversity and Conservation 24:17‐24. Goddard, M.E. 1985. A method for comparing sires evaluated in different countries. Livestock Production Science. 13:321‐331. Grundy, B., Villanueva, B and Woolliams, J.A. 1998. Dynamic selection procedures for constrained inbreeding and their consequences for pedigree development. Genetic Research 72:159‐168. Grundy, B., Villanueva, B and Woolliams, J.A. 2000. Dynamic selection for maximising response with constrained inbreeding with overlapping generation. Animal Science 70: 373‐382 Henderson, C.R., Carter, H.W. and Godfrey, J.T 1954. Use of contemporary average in appraising progeny test of dairy bulls. Paper presented at the 1954 meeting of the American society of Animal production Kirkpatrick, M., Lofsvold, D. and Bulmer, M. (1990) Analysis of the inheritance, selection and evolution of growth trajectories. Genetics 124, 979‐993. Kirkpatrick, M., Hill, W.G. and Thompson, R. (1994) Estimating the covariance of traits during growth and ageing, illustrated with lactation in dairy cattle. Genetics Research Cambridge 64:57‐69. Kinghorn, B.P., Mesaros, S.A and Vagg, 2002. Dynamic tactical decision for animal breeding. Proceeding 7th WCGALP 33: 179‐186. Meuwissen, T.H.E and Woolliams, 1994 Effective sizes of livestock populations to prevent a decline in fitness. Theoretical and Applied Genetics 89:1019‐1026 Meuwissen, T.H.E. 1997. Maximising the response of selection with a redefined rate of inbreeding. Journal Animal Science, 75:934‐940 Meuwissen, T.H.E and Sonesson, A.K, 1998. Maximising the response of selection with a pre‐defined rate of inbreeding. II Overlapping generations. Journal of Animal Science. 76:2575‐2583 Meuwissen, T.H.E. 2007. Operation of conservation schemes. In Utilisation and conservation of farm animal genetic resources. Edited by Kor Olenbroek. Wageningen Academic Publishers, The Netherlands. Chapter 8, page 167‐193. Meyer, K.(2004) Scope for a random regression model in genetic evaluation of beef cattle for growth. Livestock Production Science 86,69‐83. Quass, R. L. and Pollak, E. J. (1981) Modified equations for sire models with groups. Journal of Dairy Science 64,1868‐1872. Sanchez, L., Bijma, P. and Woolliams J.A. 2003. Minimizing inbreeding by managing genetic contributions across generations. Genetics 164:1589‐1595. Schaeffer, L.R. and Dekkers, J.C.M. 1994. Random regression in animal models for test‐day production in dairy cattle. Proceedings 5th WCGALP. Guelph, Canada XVIII, 443‐446 VanRaden, P.M. 2008. Efficient methods to compute genomic predictions. Journal DairyScience., 91:4414‐4423 Wilmink, J.B.M., Meijering, A. and Engel, B 1986. Conversion of breeding values for milk from foreign populations. Livestock Production Science. 14:223‐229. Woolliams, J.A and Bijma, P. 2000. Predicting rates of inbreeding: in populations undergoing selection. Genetics 154:1851‐1864 Woolliams, J.A. 2007. Genetic contributions and inbreeding. In Utilisation and conservation of farm animal genetic resources. Edited by Kor Olenbroek. Wageningen Academic Publishers, The Netherlands. Chapter 7, page 147‐165. Wray, N. R. and Thompson, R. 1990. Prediction of rates of inbreeding in selected populations. Genetic Research 55:41‐54 MILK YIELD AND BODY WEIGHT OF WHITE MARITZA SHEEP D.P.Dimov Department of Animal sciences, Agricultural University, 4000 Plovdiv, Bulgaria *Corresponding author: doytcho.dimov@gmail.com ABSTRACT The objectives of this study were to establish characteristics of milk yield and body weight of the local breed White Maritza sheep. Database of 1084 records of milk yield from 678 ewes in 15 herds between 1992 and 2010 have been used. Body weight data of 415 ewes in 7 herds measured throughout 2007 have been analyzed. Milk yield of 110.57 litres per 137.10 days of milking period with 823.38 ml of average daily milk yield have been established. The herd and the year of lactation have influenced significantly milk yield with high degree of probability (p<0.001). Depending on the herd, milk yield vary between 96.01 and 171.81 litres. White Maritza sheep have had high body weight of 71.71 kg and 100.40 kg for ewes and rams respectively. It has been found that there is a great variation in body weight of ewes from different herds and in a herd. The characteristics of milk yield and body weight of Wight Maritza sheep established in this study discover great potential for improvement by pure breed selection. Key words: Milk yield, body weight, sheep breed. INTRODUCTION White Maritza sheep is a Bulgarian multipurpose local breed ‐ milk, meat and wool. Its population is comparatively small and this breed is threatened of extinction. The size of this population was estimated about 825 sheep including 39 rams for 2011. The main objective of the conservation programme for White Maritza sheep is the increase of its population in order to guarantee its survival. The objectives of a conservation programme may include not only ensuring the survival and integrity of the target population, but also improving its reproductive and performance while maintaining its specific adaptive features (FAO, 2007). The fact that White Maritza sheep has been raised in a region of intensive farming and lifestock production set them in a specific competitive environment with other sheep breeds in the region and in the country, and in a long term its productive characteristics will define its competitiveness concerning sheep breeder’s choice. The production system in which White Maritza sheep had been kept was the object of study for the period of 2001 – 2004. It was established that the milk sold on the market provides 43.86% of the income from White Maritza sheep herds, the lambs sold – 37.73%, the sale of adult ewes and rams ‐ 8.66%. The sale of livе animals for meat ensures 46.39% of the total income of the herds (Dimov and Kuzmanova 2007). The structure of the incomes in herds of White Maritsa sheep indicates that milk yield provides an essential part of the total income, but the largeness of adult animals that are sold on the market is also important. Larger animals are sold at higher prices in a local market and ensure more incomes. The objectives of this were to establish characteristics of milk yield and body weight of White Maritza sheep in a real productive and breeding system. th 114 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) MATERIALS AND METHODS The established general characteristics of milk yield of White Maritza sheep and other relevant characteristics is based on database of 678 records of White Maritza sheep raised in 15 herds for the period 1992 ‐ 2010. The data are the result of an official milk yield control programme implemented at the Breeding association of Maritza sheep according to AC – a method conformable to the ICAR regulations. The suckling period has been calculated as a difference between the days from the date of lambing and 15 days before the date of the first test day. The test day was in the middle of 30‐day period. The method of milk recording was described in details by Dimov (1999). General linear model was used in data processing and overall means, standard deviations, coefficients of variation of the duration of milking period, milk yield and average daily milk yield, as well as the fixed effect of herds, year and month of lambing. The model is as follows: Yij = µ + x1 + eijn as: Yij = variable μ = LS ‐ mean x i = fixed effects of herds (15), year (19), month of lambing (6), age of lambing (8) – successively analyzed еijn = residual error Body weight of 418 ewes and 12 rams of White Maritza sheep breed has been measured by a portable electronic scales FX21 Electronic Weighing System produced by ICONIX. The measuring was made in 7 sheep herds in the region of the town of Plovdiv for the period 15th August – 15th September 2007. The usual statistics data processing was applied to sheep body weight records. RESULTS AND DISCUSSION White Maritza sheep is raised in the lowland areas of Plovdiv region (The Central part of South Bulgaria). The region is characterized with intensive farming and limited pastures for animals and on that account sheep are raised both at pastures and sheds. In summer in addition to pasture sheep are fed on vegetable waste after gathering the harvest from other crops. The average number of sheep in a herd is 73 ewes, varying from 20 to 207 in a herd (Dimov 2011). Table 1 shows overall means, standard deviations, coefficients of variation of milk yield characteristics, as well as the minimum and maximum values of the traits. Table 1. Overall means, standard deviations, coefficients of variation of milk yield characteristics of White Maritza sheep (n=1084) Characters X SD CV % Suckling period, d 67.50 15.39 22.80 45 99 Milking period, d 137.10 30.99 22.60 90 210 Milk yield, l 110.57 39.70 35.90 50.51 329.66 Average daily milk, ml 823.38 273.18 33.17 300 2198 Legend: х‐ overall mean ; SD – standard deviation; l – litres; d ‐ days CV – coefficient of variation; min Max Milk Yield And Body Weight Of White Maritza Sheep 115 Duration of suckling period The suckling period of White Maritza sheep lasts for 67.5 days that is typical of the sheep breeding practice for that region and the whole country. Compared to dairy sheep breeds from the Mediterranean, that is a longer suckling period (Lacon 35 days, Chios, 42 days, Latxa 31 day). Usually, farmers who breed White Maritza sheep follow the same practice of weaning the lambs at the age about 60 days, but in many cases the sheep breeder decides on his own when to wean the lambs depending on what they are meant for (slaughter or breeding purposes), demands of lambs on the market and the general strategy he has chosen – milk or meat. This is the reason for the great variation of the duration of the suckling period from 45 to 99 days in the database used (table 1) Duration of milking period On the average the duration of the milking period of White Maritza sheep is 137.10 days with a possible great variation from 90 to 210 days. It is considered that a longer milking periods is always associated with higher milk yields (Ruiz et al. 2000). In this research the ewes which lamb in November or December have a longer milking period of 163 and 153 days respectively. It is obvious that ewes that lamb earlier are capable of maintaining a longer lactation period. This corresponds to what was established by Ruiz et al. (2000) about ewes from Latxa breed ‐ ewes that lamb in November have a milking period of 198 days and others that lamb in March have a milking period of 151 days. In the lowland areas of Bulgaria typical months for mating of ewes are July and August and for lambing – December and January. In December and January 667 ewes lambed, which represents 61.53% of the sample of studied ewes and the others lambed out of season to some extent. A detailed analysis of table 2 shows another important characteristic of White Maritza sheep, namely the long lambing campaign (six months), which demonstrates the ability of White Maritza sheep for mating and lambing in and out of season. Out‐of‐season lambing is a desirable characteristic to permit adjustment of milk production to both breeding system and market demands (Barillet, 2007). Table 2. Duration of the milking period of White Maritza sheep depending on the month of lambing Month of lambing N LS‐means SE November 97 160.82 2.59 December 341 152.72 1.38 January 326 137.11 1.41 February 211 118.44 1.76 March 89 102.13 2.71 April 20 108.00 5.71 Total 1084 129.87 1.22 Milk yield The overall means of milk yield of White Maritza sheep included in the database is 110.57 litres. This milk yield is good but not very high, which is typical of multipurpose breeds. The same refers to daily milk yield values – 823.38 ml. There is a high coefficient of variation 22.60% and 28.15% for milk yield and average daily milk yield respectively (table 1). Generally there are a many factors that can influence sheep milk yield, but in this study only those that set up the environment and outline the frame for realizing the potential of White Maritza sheep for milk yield – herd, year and month of lambing have been analyzed. The analysis of these th 116 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) three sources of variation shows that the herd and the year are significant factors with a reliable effect on milking period, milk yield and average daily milk yield (p<0.001). The month of lambing is also statistically significant but with lower degree of probability for characteristics such as milk yield and daily milk yield (table 3). Table 3. Analysis of sources of variation of milk yield characteristics of White Maritza sheep. Sources of variation Df Milking period Milk yield Average daily milk F P F P F P Herd 14 11.84 *** 9.48 *** 14.92 *** Year 18 12.66 *** 3.81 *** 4.21 *** Month of lambing 5 103.39 *** 3.86 ** 27.69 * df – degree of freedom; F‐ test; P ‐ probability (*** ‐ p<0.001; ** ‐ p<0.01; *‐ p 0.05;). The herd is a complex factor that affects sheep milk yield. It includes the feeding level, provided by the farmer as well as the level of the in herd selection. In all the herds of White Maritza sheep young animals for breeding purposes are a result of in herd selection. During the years the animals are replaced by others which are a result of in herd selection. As it can be seen in figure 1, the herd has a variation from 96.01 l to 171.81 l ( a difference of 75.80 l) This discover great potential for in herd selection for genetic improvement of White Maritza sheep milk yield. Selection based on milk yield is not a priority in the breeding programme for White Maritza sheep because of the small population of this breed, but this could be the aim of any farmer who is a part of the programmme for preservation and improvement of White Maritza sheep. The increase of milk yield in combination with other characteristics could contribute to the sustainable breeding of this threatened with extinction sheep breed. The lambing year is a significant environmental factor that always influences sheep milk yield. This influence can be explained with temperature and rainfall levels measured during the years, that influence vegetation growth of the pastures. Lambing years in this study have shown variation in LS means between 93.14 and 138.76 liters. The difference in milk yield between the most favorable year 2001 (138.76 litre ) and the unfavorable 2008 (93.14 litres) was 45.62 liters. Milk Yield And Body Weight Of White Maritza Sheep 117 Due to the modern breeding programmes and selection based on milk yield with some Mediterranean breeds high levels of milk yield have been achieved. Haenlein (2007) made a survey of the highest levels of milk yield with some European sheep breeds and observed that Lacon sheep reached a level of 270 litres of milk yield per 165 days, Manchega sheep – 300 litres per 210 days. These levels are too high compared to White Maritza sheep milk yield, but compared to other similar local sheep breeds and synthetic populations in Bulgaria, White Maritza sheep milk yield is not low. The milk yield of the local sheep breed from Stara Zagora region is reported to be 85.7 to 129.4 litres per milking period of 120 days by Djorbineva et.al. (2011). Our own researches about the Black‐head Pleven sheep established 134.26 litres per milking period of 120 days (Dimov et. al. 2007). th 118 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Average daily milk yield The environmental factors herd and year affect the average daily milk yield significantly at (p>0.001), the lambing month affects it with lower level of probability (table 2). The established level of 823.28 ml daily milk yield is lower than the level with East Friesian and Awassi dairy breeds. Pacinovski et. al. (2007) established average daily milk of 1.09 l with Awassi and 0.94 l with East Friesian sheep raised in Macedonia. The average daily milk yield with White Maritza sheep that we have established is a little higher compared to some other local sheep breeds in Central Europe such as the Slovak multipupose breeds. The Improved Vlashka and Tsigai, for which Oravkova et. al. (2005) established 0.62 l and 0.63 l respectively. Body weight It has been established that body weight of White Matitza sheep is 71.71 kg, which is much higher compared to other Bulgarian local sheep breeds. In the past body weight of this breed was studied by Kostov and Ivanov (1951). They established that in 1948 body weight after shearing was 45.14 kg, varying from 30 to 71 kg. At present White Maritza sheep have an average body weight of 71.71 kg (2007), which is 32 kg higher compared to the typical breed representatives in 1948 and with wider range of deviation between the minimum and maximum body weight in this sampl. Considering the convention of this comparison and taking into account the fact that the animals were raised in different periods from the development of the population of White Matitza sheep, an obvious “evolution” towards heavier animals has been observed. Table 4. General statistical parameters about body weight of White Maritza sheep (ewes and rams). Characters N Х SD CV Body weight of ewes, kg 418 71.71 11.30 9.71 Body weight of rams, kg 12 100.12 20.05 20.03 Legend: х‐ overall mean; SD – standard deviation; CV – coefficient of variation; The established average body weight of 100.12 of rams refers to a comparatively small number of animals, but could be used informatively on the background of ewes body weight. It is interesting to take into consideration that body weight in this small extract of 12 rams varies form 82 to 131 kg. Compared to ewes body weight rams for breeding constitutes 139.60%. Table 5. Overall means, standard errors and minimum and maximum values of body weight of White Maritza sheep depending on the herd Number of the herds n x Sx min max Herd 1 38 72.07 1.40 56.0 88.5 Herd 2 17 99.44 3.17 76.0 125.0 Herd 3 67 72.29 1.22 52.5 98.0 Herd 4 56 71.39 1.19 54.0 98.0 Herd 5 134 69.43 0.85 53.5 93.0 Herd 6 80 72.67 0.85 58.5 93.0 Herd 7 26 61.02 1.29 50.0 71.0 Total 418 71.71 0.55 Milk Yield And Body Weight Of White Maritza Sheep 119 Sheep body weight is a functional characteristic Barillet et. al. (1997). Along with feed consumption and the state of body reserves, body weight has an important role in fodder utilization for milk production (Barillet 2007). In terms of herd incomes, high body weight of adult sheep sold on the market compensate to a certain extend lower income in small herds. Larger animals are sold at a higher price on the market. As it is shown in table 4, body weight in different herds vary in a wide range of 61.02 to 99.44 kg. The variation of body weight in a herd is also high from 50 kg to over 90 kg. The body weight record for white Maritza sheep is 125 kg in herd 2. Contrary to the concept that usually local breeds are primitive and with low performance, the present study reveals that sometimes local sheep breeds can have high body weight and good milk yield. The achievements of 171.81 litres of milk yield in herd 8 (Fig. 1) and of 99.44 kg of body weight in herd 2 (table 5) show a considerable potential of in herd selection for genetic improvement of local sheep breeds by pure breed selection (herd 8 and 2 are one and the same herd numbered differently in the separate studies). For that purpose, however, some additional characteristics should be studied, combined and taken into consideration, plus other environmental and genetic factors that influence sheep traits. CONCLUSIONS White Maritza sheep has good milk yield (110.57 l) and high body weight of ewes (71.71 kg) and rams (11.12 kg). The results of this study discover that there is a great variation between different herds and in herds, which give opportunities for improvement of this local breed by pure breed selection. The increase of milk yield in combination with other traits combined with increase of the population size can contribute to a sustainable breeding of this endangered breed. REFERANCES Bojkovski, S., D. Georgiev. 2005. Black‐head Pleven sheep. “JUNIEXPRESS” – Shumen. Djorbineva, M., G.Kalaydjiev, I.Dimitrov. 2011. Current state and future perspectives for the local Stara Zagora sheep. Agricultural sciences, Volume III, Issue 6, 47 – 51. Dimov, D. 2011. Breeding program of White Maritza sheep. “INTELEXPERT‐94” OOD. BARILLET, F., C. MARIE, and J.M.AUSTRUC. 1997. Selection for super traits or sub indices: A practical approach for dairy sheep. CIHEAM, Options Mediterraneennes, 33: 121‐130. BARILLET, F. 2007. Genetic improvement for dairy production in sheep and goat. Small Ruminant Research, 70, 60 – 75. DIMOV, D. (1999). Adaptation of Fleischman method for lactation calculations in sheep to local breeding system in Bulgaria and cost price of milk recording data. Proceedings of the 6th International Symposium on Milking of Small Ruminants, Athens, Greece, September 26 ‐ October 1, 1998. p.412‐417. EAAP Publication No. 95. Wageningen Pers. Dimov, D., K.Nikolov, H.Ivanov, D.Georgiev. 2007. Study on milk yield and prolificacy of Black‐head Pleven sheep. Sheep breeding in Bulgaria and in Europe. Proceedings of papers from scientific conference. p 178‐183. Research institute on feed.Pleven. Dimov, D., D. Kuzmanova. (2007). Zootechnical and Economical Characteristics of Sheep Genetic Resources in Plovdiv Area Lowlands. Bulgarian Journal of Agricultural Science, 13, 105 ‐ 118 FAO. 2007. The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by Barbara Rischkowsky & Dafydd Pilling. Rome. HAENLEIN, G.F.W. (2007). About the evolution of goat and sheep milk production. Small Ruminant Research, 68, 3‐6. Ivanov., P., S. KOSTOV. 1951. Study on body measurements and production of Parvomay sheep. Proceedings of BAN. 1 and 2. th 120 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Oravcová, M., E. Groeneveld, M. Covač, D. Peškoviĉová, M. Margetín. 2005. Estimation of genetic and environmental parameters of milk production traits in Slovak purebred sheep using test‐day model. Small Ruminant Research 56 (2005) 113–120. Pacinovski, N., E. Eftimova, M. Gievski. 2007. Comparison of milk production ability between Awassi and East‐ Frisian sheep in Macedonia. III Symposium of livestock production with international participation, 12‐ 14 September, Ohrid, Proceedings, p. 65‐72. Ruiz, R., L. M. Oregui, and M. Herrero. 2000. Comparison of Models for Describing the Lactation Curve of Latxa Sheep and an Analysis of Factors Affecting Milk Yield. Journal of Dairy Science Vol. 83, No. 11, 2709 – 2719. MOLECULAR CHARACTERIZATION OF CONSERVED SOME TURKISH NATIVE GOAT BREEDS B. ÇINAR KUL1*, Ö. KORKMAZ AĞAOĞLU2, B. AKYÜZ3, E. ÖZKAN4, Ö. GÜCÜYENER5, Ö.ÖZMEN6, M. AYTAÇ7, O. ERTUĞRUL1 1 2 Ankara University, Faculty of Veterinary Medicine, Department of Genetics, ANKARA Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Animal Science, BURDUR 3 Erciyes University, Faculty of Veterinary Medicine, Department of Animal Science, KAYSERI 4 Namık Kemal University, Faculty of Agriculture, Department of Animal Science, TEKIRDAG 5 Afyon Kocatepe University, Faculty of Veterinary Medicine, Department of Animal Science, AFYON 6 Fırat University, Faculty of Veterinary Medicine, Department of Animal Science, ELAZIG 7 General Directorate of Agricultural Research, ANKARA * Corresponding author: bkul@veterinary.ankara.edu.tr ABSTRACT Domestication of the animals, considered as one of the most important milestones of modern human life, began about 11,000 years ago in the Neolithic age on the lands known as "Fertile Crescent". In studies related with domestication, mitochondrial DNA (mtDNA) regions and microsatellite loci have been frequently used. In the present study, the mtDNA control region and 20 microsatellite loci were analyzed in preserving individuals from Angora (Ankara), Honamli, Kilis, Hair (Kıl) and Norduz goat breeds to reveal genetic diversity and differentiation of goat breeds. In terms of nucleotide and haplotype diversity, all groups show high values as compared with mainly world goat breeds. A, D and G haplogroups have been determined in 5 breeds studied. Through this study, an inexpensive novel method based on PCR‐RFLP was introduced to determine G haplotype, a unique haplotype to Fertile Crescent regions. As a result of 20 microsatellite loci analyses, average numbers of alleles in per locus and heterozygosity levels were fairly high. In terms of FIS values, all of the populations were in the Hardy‐ Weinberg equilibrium because they were defined close to zero. According to FCA, goat breeds except Angora cannot be genetically separated from each other. The chosen markers for this study were determined to be highly polymorphic in Turkish native goat breeds. These findings indicate a central localization for Turkey in the goat domestication course. Inbreeding and mating with culture breeds, yield to vanishing of the native breeds. Despite their low production profile, the loss of native breeds is of quite importance to genetics. This data showed that the studied 5 goat breeds preserved their molecular diversities. However, these results should be further analyzed using alternative molecular markers (such as Y chromosomal markers) and comparisons, in order to construct new preservation strategies accordingly. This study was supported by the project TURKHAYGEN–1 (KAMAG‐106G005). Keywords: Diversity, Fertile Crescent, microsatellite, mtDNA, turkish native goat breeds. INTRODUCTION Goat species, which is one of the first domesticated species, is important for the history of humanity. Domestication dated back to as early as 10,000 years ago and more than one domestication area have been determined with molecular studies. Human beings have made the domestication in these areas and then goats spread all over the world through human migrations, trade and natural animal migrations. (Zeder, 2008). In later centuries, hundreds of different goat breed for breeding purposes have emerged. But unfortunately, in Turkey as in all the world, goat breeding and the number of local goat breeds decreased because of the socio‐economic factors and government policies in recent years. th 122 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Genetic variation is explanatory for the history of the studied population and various DNA markers used for this purpose (Loftus et al, 1999; Luikart et al, 2001; MacHugh and Bradley, 2001; Naderi et al, 2007). Varieties of methods and phylogenetic analysis have been developed to test hypotheses or calculate the parameters of populations through these markers. (Tajima, 1989; Fu, 1997; Guindon and Gascuel, 2003; Evanno et al, 2005). In the present study, various population parameters were investigated using mtDNA sequences and microsatellites in Angora, Hair, Kilis, Honamlı and Norduz goat breeds. A combination of these two markers is a comprehensive approach and extensive field sampling improves reliability. Up‐to‐date, there is not much comprehensive data accumulated regarding the mitochondrial and autosomal diversity of these breeds. In this study, it is aimed to reveal genetic diversity and differentiation of conserved goat breeds within TURKHAYGEN‐1 project. MATERIAL AND METHOD Sampling and DNA Isolation Procedures Samples were collected within TÜRKHAYGEN‐1 project and analyzed for molecular characterization. A total of 252 blood samples of goats were collected from 5 Turkish native goat breeds on the natural habitat (Figure 1). After sampling procedure, mtDNA was extracted by phenol/chloroform method as described previously (Sambrook et al, 1989) and extracted DNA concentrations were adjusted for PCR amplification. In the presented report, mtDNA and microsatellite analyses were carried out within the scope of PhD theses of Dr. Bengi Çınar Kul and Dr. Özgecan Korkmaz Ağaoğlu, respectively. Figure 1. The localization of sampled provinces in the geographical Turkey map; yellow circle is Angora, red circle is Honamli, pink circle is Kilis, blue circle is Norduz, turquoise circle is Kıl goat breed (Çınar Kul and Ertugrul, 2011). Molecular Characterization Of Conserved Some Turkish Native Goat Breeds 123 MtDNA Analyses Amplification and sequencing: The complete D‐loop was amplified by using forward primer Typing‐2‐F and reverse primer Typing‐1‐R (Sultana et al., 2003). PCR was performed in a 25 μl reaction mixture containing 100 ng of genomic DNA, 2mM MgCl2, 5 pmol of each primer, 200 µM of each dNTP, 1U Taq DNA polymerase (MBI Fermentas) and 1X PCR buffer (10 mM Tris‐HCl, pH 9,0; 50 mM KCl) by using Mastercycler thermal cycler (Eppendorf AG, USA) under the following conditions: first denaturation for 4 min at 94°C followed by 30 cycles of 30 s denaturation at 94°C, 30 s primer annealing at 64°C and 70 s extension at 72°C with final extension 15 min at 70°C. The PCR products were run through 2% (w/v) agarose gel electrophoresis under 120V for 20 min and then amplicons were purified on spin columns according to the manufacturer's instructions (QIAquick PCR Purification Kit, Qiagen). Two internal primers (CAP‐F and CAP‐R) including Hypervariable region‐1 (HV‐1) were used for sequencing as previously described by Naderi et al (2007). Data and phylogenetic analyses: The nucleotide sequences were aligned and edited by using BioEdit Version7.0.9.1 (Hall, 1999). Nucleotide diversity (π), haplotype diversity (h) and their standard deviation values for the breeds were estimated by using DnaSP v5 software (Librado and Rozas, 2009). Maximum‐likelihood (ML) tree was created by using PhyML v3.0 (Guindon and Gascuel 2003). To identify possible phylogenetic clades, Neighbor‐Joining (NJ) tree was firstly constructed by using K2P model with pairwise deletion (1,000 replicates) with MEGA 4.0 software (Kumar et al., 2008) Differentiation between populations was assessed by sequence‐based F statistics and distances tree was constructed with PHYLIP 3.69 (Felsenstein, 2005) software. D‐loop region sequences of C. aegagrus, C. caucasica, C. sibirica, C. cylindricornis, C. nubiana and C. falconeri and O. aries as an out group were used in order to enlighten the relation with wild goat. Population history: A Median‐joining network was generated to further investigate the possible relationships among the lineages by the program Network v.4.516 (Bandelt et al., 1999). DnaSP v5 (Librado and Rozas, 2009) was used to test the neutral theory. mt‐lineage typing: In this study the new mt‐lineage typing for G haplogroup was described by using a PCR restriction fragment length polymorphism (PCR‐RFLP) method based on A16071G mutation in the D‐loop. A specific segment of mtDNA was amplified using outer D‐loop region primers. The amplified DNA was digested overnight at 37°C with the Bsp681 (NruI) (MBI Fermentas). Microsatellite Analyses Amplification and analysis: To generate data, a set of 20 microsatellite markers (Table 2) were selected based on the guidelines of ISAG and FAO. The PCR mix was subjected to an initial denaturation at 95oC for 5 min, followed by 35 cycles of 30 sec at 94oC, 45 sec at 58oC (for Set I and Set II), 57.9oC (for Set III) or 60ºC (for Set IV) and 1.5 min at 72oC with a final extension of 20 min at 72oC using the Mastercycler thermal cycler (Eppendorf). Set I, Set II and Set III had 5 loci whereas Set IV had 4 loci. However, Set IV was loaded on a fragment analysis system with loci BM1818 (multiplex+colading) (Korkmaz Ağaoğlu et al., 2010). The PCR of BM1818 was subjected to an initial denaturation at 94oC for 4 min, followed by 30 cycles of 30 sec at 94oC, 30 sec at 58oC and 30 sec at 72oC with a final extension of 15 min at 72oC. Two microliters of multiplex PCR products were mixed with 0.5 µl of CEQ‐Size Standard (Beckman Coulter) and 37.5 µl of SLS (Sample Loading Solution) (Beckman Coulter) and subjected to capillary electrophoresis. Fragments were resolved on a Beckman Coulter CEQ‐8000 Genetic Analyser and the collected data were analyzed using a CEQ fragment analysis program. th 124 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Statistical analyses: The following were calculated for each of the 20 microsatellite loci analyzed: the number of alleles (nA) and frequencies of alleles, observed (Ho) and expected heterozygosity (unbiased – He, Hnb) (Nei, 1978), Wright’s F‐statistics (Weir and Cockerham, 1984), polymorphic information content (PIC) (Botstein et al., 1980), Hardy‐Weinberg equilibrium (HWE), genetic distances (Nei et al., 1983), phylogenetic tree (Nei et al., 1983), Factorial Correspondence Analysis (Lebart et al., 1984), the STRUCTURE test (Pritchard et al., 2000; Evanno et al., 2005). nA, the frequencies of alleles, Ho and He, Wright’s F‐statistics, genetic distances and the Hardy‐Weinberg equilibrium were calculated using a program called Genetix (v4.05) (Belkhir et al., 2004), while PIC was calculated using PowerStats V12 (Brenner and Morris, 1990). Factorial Correspondence Analysis (Lebart et al., 1984) was performed to test the possible admixtures that occurred between the populations using GENETIX v4.05 software (Belkhir et al., 2004). An NJ tree was constructed with Population 1.2 (Langella O., 1999) software. Bootstrap resampling (n=1000) was performed to test dendrogram robustness. A genetic structure of the population was performed using a program called STRUCTURE (Pritchard et al., 2000). STRUCTURE (Pritchard et al., 2000; Evanno et al., 2005) was also used to ascertain a possible genetic structure in the analyzed dataset. RESULTS Genetic Variation and Structure of the Populations Statistical data regarding the mtDNA diversity in studied breeds is shown in Table 1. A total of 208 haplotypes were identified within 252 goat samples. Duplication insertions (77bp) were observed on D‐Loop regions of two individuals from different breeds. Table 1. Some statistical values regarding to mtDNA in the studied breeds. Breed N Nh h ± sd π ± sd Fu’s Fs Tajima’s D Angora 50 42 0,993; ± 0,005 0,0202;± 0,00162 ‐32,968 ‐1,57723* Honamli 49 42 0,993; ± 0,006 0,0233;± 0,00187 ‐29,266 ‐1,25471 Kilis 51 48 0,998; ± 0,004 0,0205;± 0,00188 ‐47,991* ‐1,85794** Hair 53 48 0,996; ± 0,005 0,0203;± 0,00108 ‐44,975 ‐1,46930 Norduz 49 36 0,983; ± 0,008 0,0192;± 0,00101 ‐20,170 ‐1,30735 Total 252 208 0,9982; ± 0,0006 0,0210;± 0,00073 *,P < 0,10; **, P < 0,05; N: Number of sampled individuals, Nh: Number of haplotypes, h: Haplotype diversity, sd: Standart deviation, π: Nucleotide diversity. Some statistical data regarding the microsatellite diversity in studied breeds is shown in Table 2. A total of 313 alleles were observed. The average number of alleles per locus was 15.65, ranging from 9 (INRA005) to 24 (OARFCB304). In native Turkish goat breeds, the number of observed alleles varied from 10.45 (Honamli goat) to 11.8 (Angora goat). Molecular Characterization Of Conserved Some Turkish Native Goat Breeds 125 Table 2. Primer sequences and variability parameters according to microsatellites in native Turkish goat breeds. Loci BM1818 CSRD247 HSC ILSTS11 ILSTS30 INRA005 INRA23 MAF65 MAF70 OARAE54 OARCP34 OARFCB20 OARFCB48 OARFCB304 SRCRSP1 SRCRSP5 SRCRSP8 SRCRSP15 SRCRSP23 TGLA53 Average Primer (5’→3’) AGCTGGGAATATAACCAAAGG Allele Size (bp) NA* Hnb Ho PIC** 226‐270 14 0.8526 0.8327 0.83 217‐249 16 0.8617 0.8487 0.84 266‐302 19 0.9046 0.8400 0.89 265‐283 10 0.7589 0.7697 0.72 150‐180 16 0.8513 0.7810 0.83 127‐145 9 0.6351 0.6145 0.57 193‐217 14 0.8754 0.8691 0.86 116‐168 21 0.8445 0.8166 0.82 132‐158 12 0.8318 0.8218 0.80 114‐150 16 0.8373 0.8244 0.81 104‐132 15 0.8540 0.8520 0.83 88‐124 13 0.7598 0.6822 0.72 136‐170 13 0.8358 0.8396 0.81 124‐178 24 0.7750 0.7449 0.75 118‐160 19 0.7883 0.7331 0.75 158‐182 13 0.8538 0.8284 0.83 210‐242 16 0.7815 0.7290 0.75 158‐230 14 0.7280 0.7057 0.69 76‐118 19 0.8505 0.8238 0.83 102‐168 20 0.7979 0.7338 0.77 ‐ 15,65 0.8139 0.7846 0.78 AGT GCT TTC AAG GTC CAT GC GGACTTGCCAGAACTCTGCAAT CACTGTGGTTTGTATTAGTCAGG CTG CCA ATG CAG AGA CAC AAG A GTC TGT CTC CTG TCT TGT CAT C GCT TGC TAC ATG GAA AGT GC CTA AAA TGC AGA GCC CTA CC CTGCAGTTCTGCATATGTGG CTTAGACAACAGGGGTTTGG CAA TCT GCA TGA AGT ATA AAT AT CTT CAG GCA TAC CCT ACA CC GAGTAGAGCTACAAGATAAACTTC TAACTACAGGGTGTTAGATGAACT AAAGGCCAGAGTATGCAATTAGGAG CCACTCCTCCTGAGAATATAACATG CACGGAGTCACAAAGAGTCAGACC GCAGGACTCTACGGGGCCTTTGC TACTAAAGAAACATGAAGCTCCCA GGAAACATTTATTCTTATTCCTCAGTG GCTGAACAATGTGATATGTTCAGG GGGACAATACTGTCTTAGATGCTGC GGAAAACCCCCATATATACCTATAC AAATGTGTTTAAGATTCCATACATGTG GAGTTAGTACAAGGATGACAAGAGGCAC GACTCTAGAGGATCGCAAAGAACCAG CCC TAG GAG CTT TCA ATA AAG AAT CGG CGC TGC TGT CAA CTG GGT CAG GG TGC AAG AAG TTT TTC CAG AGC ACC CTG GTT TCA CAA AAG G GGACTCTACCAACTGAGCTACAAG TGAAATGAAGCTAAAGCAATGC TGCGGTCTGGTTCTGATTTCAC GTTTCTTCCTGCATGAGAAAGTCGATGCTTAG CTTTACTTCTGACATGGTATTTCC TGCCACTCAATTTAGCAAGC TGAACGGGTAAAGATGTG TGTTTTTAATGGCTGAGTAG GCTTTCAGAAATAGTTTGCATTCA ‐ *NA: Number of alleles, **PIC: Polymorphic Information Content (PIC) th 126 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Phylogenetic relations of the individuals were investigated by NJ and ML tree constructions assuming a gamma distribution parameter of α=0,349 and the individuals were classified to haplogroups by the means of reference sequences (Figure 2). Figure 2. Maximum Likelihood tree of 252 individuals constructed under GTR model and aLRT test (Çınar Kul and Ertugrul, 2011). According to pairwise FST distances based on mtDNA data, all breeds have been involved on the same branch with C.aegagrus. Pairwise FST comparisons also showed that there is a low genetic differentiation between Hair and Honamli goats and likewise between Kilis and Norduz goats. Norduz and Honamli goats have also a mild genetic differentiation between each other. (0,045; p < 0,001) (data not shown). Population structure was assessed with STRUCTURE. The analysis was carried out with 20 different runs from K=1 to K=12 to identify the most likely number of clusters present in the dataset. All runs used a burn‐in period of 100,000 iterations and a data collection period of 100,000 iterations. The most likely K was 5 (Figure 4). For STRUCTURE analysis, the most appropriate number of clusters for modeling the data was five. Figure 4. Bar representation of the STRUCTURE analysis of native Turkish goat breeds (K=5). Molecular Characterization Of Conserved Some Turkish Native Goat Breeds 127 The calculated FST value based on microsatellites was 0.03005, which was statistically significant (P<0.001). According to FST values, a medium level of genetic diversity was found between Angora goats and other breeds. Among the other breeds, genetic diversity was low and this level of diversity was statistically significant. The genetic distance ranged from 0.0587 to 0.1589. The lowest genetic distance (0.587) was between Honamli goats and Hair goats. History of the Populations Fu’s Fs and Tajima’s D values are provided on Table 1. Median Joining network obtained from haplotypic data showed that all haplotypes condensed around a centric area, each sequence represented almost a specific haplotype and Haplogroup A has a star‐like pattern (data not shown). For the determination of Haplogroup G, a novel method was introduced. In this wise, two segments were harvested via an enzymatic digestion process of a 1002 bp D‐loop region obtained by amplification with outer primers (Figure 3). Figure 3. The PCR‐RFLP analysis for typing Haplogroup G. Lane G is Haplogroup G, Lane A is Haplogroup A and Lane M is 100bp DNA ladder (MBI Fermentas) (Çınar Kul and Ertugrul, 2011). DISCUSSION AND CONCLUSION High mtDNA and microsatellite diversity Two of the main factors to determine the domestication zones are nucleotide and haplotide diversity. The estimated mtDNA diversity indices suggest that Kilis goat breed exhibits the highest diversity. In terms of mtDNA diversity, all groups show high values as compared with mainly world goat breeds (Luikart et al., 2001; Joshi et al., 2004; Pereira et al., 2005; Naderi et al., 2007; Wu et al, 2009). Similarly, according to microsatellites, the average number of alleles per locus and the number of observed alleles in native Turkish goat breeds were higher than in goat breeds from the Czech Republic (Jandurova et al., 2004) and in Egyptian and Italian goat breeds (Agha et al., 2008). It is also higher than the values reported for other Indian and Chinese goat breeds (Fatima et al., 2008; Qi et al., 2009). In this study, the high number of alleles is indicative of polymorphism and the chosen loci were sufficient for assessing genetic diversity. These findings suggest that Turkey is one of the domestication regions, in accordance with the findings of Naderi et al. (2008). th 128 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Population structure and history A, D and G haplogroups have been determined in 5 breeds studied. Haplogroups B and C, often recognizable in Asian countries, were not found in this study. However, thought that Angora goats had been brought from Asia. Based on neutrality test findings, Kilis goat breed seems to have an expansion of population and accretion of new, low frequency haplotypes. Whereas, when considered that Kilis and Norduz breeds do not share a common haplotype with Hair goat breed, the claim that these breeds are Hair goat crossbreeds (Yalçın, 1986; Porter, 1996), may need a further ascertainment in terms of breed backgrounds. Besides, a novel, cost and time‐effective method for the determination of Haplogroup G is introduced in this study. Domestic goat (C. hircus) is thought to originate from various wild goat species. In the present study; our results demonstrated that 5 of the Turkey’s native goat breeds originated from C. aegagrus (bezoar), in accordance with the findings of Mannen et al. (2001). Two members of Kilis breed from Fertile Crescent region have highly similar sequence profile with two wild goats. According to FST values based on microsatellites, a medium level of genetic diversity was found between Angora goats and other breeds. Nevertheless, genetic diversity was low among the other breeds. The lowest genetic distance was especially observed between Honamli and Hair goats which they close to each other geographically. Angora goats had the highest genetic distance from other goat breeds. The axes in the FCA test also indicated that Angora goats are grouped separately from the other breeds. The native Turkish goat breeds (except for Angora) are not completely separated from each other. The result of this analysis is similar to those obtained from other analyses. The loss of acquired properties for thousands of years through natural selection of native breeds is very important for genetics. The results of the present study indicate that chosen individuals from the native breeds for conservation preserved their mtDNA and microsatellite diversities. However, these results should be further analyzed using alternative molecular markers and comparisons, in order to construct new preservation strategies accordingly. ACKNOWLEDGEMENTS The authors wish to thank to TURKHAYGEN–1 (In Vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources‐I; KAMAG‐106G005) project staff. REFERENCES Agha, S.H., Pilla, F., Galal, S., Shaat, I., D’andrea, M., Reale, S., Abdelsalam, A.Z.A., Li, M.H. (2008). Genetic diversity in Egyptian and Italian goat breeds measured with microsatellite polymorphism. J. Anim. Breed. Genet. 125: 194‐200. Bandelt H.J., Forster P., Röhl A. (1999). Median‐joining networks for inferring intraspecific phylogenies. Mol Biol Evol, 16:37‐48. Belkhir, K., Borsa, P., Chikhi, L., Goudet, J., Bonhomme, F. (2004). GENETIX 4.05 WindowsTM software for sample genetics. Laboratoire Génome, Populations, Intéractions, University of Montpellier, France (Université Montpellier II//www.univ‐montp2.fr/~genetix/genetix/genetix.htm//December 2004). Botstein, D., White, R. L., Skolnick, M., Davis, R.W. (1980). Construction of a genetic linkage map in man using restriction fregment length polymorphism. Am. J. Hum. Genet. 32: 324–331. Brenner, C., Morris. J. (1990). Paternity index calculations in single locus hypervariable DNA probes: validation and other studies, p. 21‐53. In Proceedings for the International Symposium on Human Identification 1989. Promega Corporation, Madison, WI. Çınar Kul B., Ertuğrul O. (2011). mtDNA diversity and phylogeography of some Turkish native goat breeds. Vet. J. Ank. Univ., 58(2):129‐134. Molecular Characterization Of Conserved Some Turkish Native Goat Breeds 129 Excoffier L., Lischer H.E.L. (2010). Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour, 10, 564‐567. Evanno, G., Regnaut, S., Goudet, J. (2005). Detecting the Number of Clusters of Individuals Using the Software Structure: A Simulation Study. Mol Ecol 14 (8): 2611‐20. Fatima, S., Bhong, C.D., Rank, D.N., Joshi, C.G. (2008). Genetic variability and bottleneck studies in Zalawadi, Gohilwadi and Surti goat breeds of Gujarat (India) using microsatellites. Small Ruminant Research, 77: 58‐64. Felsenstein, J. (2005): PHYLIP version 3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle. Fu, Y.X. (1997): Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147: 915–925. Guindon S., Gascuel O. (2003): A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 52: 696‐704. Hall T.A. (1999): BioEdit:a user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp, 41:95‐98. Jandurová, O.M., Kott, T., Kottová, B., Czerneková, V. (2004). Seven microsatellite markers useful for determining genetic variability in White and Brown Short‐Haired goat breeds. Small Ruminant Research 52:271–274. Joshi M.B., Rout P.K., Mandal A.K., Tyler‐Smith C., Singh L., Thangaraj K. (2004). Phylogeography and origin of Indian domestic goats. Mol Biol Evol, 21: 454‐462. Korkmaz Ağaoğlu, Ö., Çınar Kul, B., Akyüz, B., Özkan, E., Ertuğrul, O., Erol, H. (2010). Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu‐PZR (Multipleks PCR) Sistemleri. Vet Hekim Der Derg. 81(2): 21‐27. Kumar S, Dudley J, Nei M, Tamura K (2008). MEGA: A biologist‐centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform, 9:299‐306. Langella, O. (1999). Populations 1.2. 30: A Population Genetic Software. Lebart, L., Morineau, A., Warwick, K., (1984). Multivariant Descriptive Statistical Analysis. John Wiley and Sons, New York, USA. Librado P., Rozas J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25:1451‐1452. Loftus R.T., Ertugrul O., Harba A.H., El‐Barody M.A., Machugh D.E., Park S.D., Bradley D.G. (1999). A microsatellite survey of cattle from a centre of origin: the Near East. Mol Ecol, 8:2015‐2022. Luikart G., Gielly L., Excoffier L., Vigne J‐D., Bouvet J., Taberlet P. (2001). From the Cover: Multiple maternal origins and weak phylogeographic structure in domestic goats. PNAS, 98 5927‐5932. MacHugh D.E, Bradley D.G. (2001). Livestock genetic origins: Goats buck the trend. PNAS, 98:5382‐5384. Mannen H., Nagata Y., Tsuji S. (2001). Mitochondrial DNA reveal that domestic goat (Capra hircus) are genetically affected by two subspecies of Bezoar (Capra aegagrus). Biochem Genet, 39:145‐454. Naderi S, Rezaei HR, Taberlet P, Zundel S, Rafat SA, Naghash HR, Elbarody MAA, Ertugrul O, Pompanon F (2007). Large‐scale mitochondrial DNA analysis of the domestic goat reveals six haplogroups with high diversity. PLoS ONE, 2,10, e1012. Naderi S., Rezaei H.R., Pompanon F., Blum M.G., Negrini R., Naghash H.R., Balkiz O., Mashkour M., Gaggiotti O.E., Ajmone‐Marsan P., Kence A., Vigne J.D. Taberlet P. (2008). The goat domestication process inferred from large‐scale mitochondrial DNA analysis of wild and domestic individuals. PNAS, 105:17659‐17664. Nei, M. (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genet. 89: 583‐590. Nei, M., Tajima, F., Tateno, Y. (1983). Accuracy of estimated phylogenetic trees from molecular data. J Mol Evol 19:153–170. Pereira F., Pereira L., Van Asch B., Bradley D.G., Amorim A. (2005). The mtDNA catalogue of all Portuguese autochthonous goat (C. hircus) breeds: high diversity of female lineages at the western fringe of European distribution. Mol Ecol, 14:2313–18. Porter V. (1996). Goats of the World. Farming Press, Ipswich, UK. th 130 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Pritchard, J.K., Stephens, M., Donnelly, P.(2000). Inference of Population Structure Using Multilocus Genotype Data. Genetics 155:945‐959. Qi, Y., Luo, J., Han, X.F., Zhu, Y.Z., Chen, C., Liu, J.X., Sheng, H.J. (2009). Genetic diversity and relationships of 10 Chinese goat breeds in the Middle andWestern China. Small Ruminant Research 82:88–93. Sambrook J., Fritsch E.F., Maniatis T. (1989). Molecular Cloning: A Laboratory Manual, vol. I., 2ndedition. Cold Spring Harbor Laboratory Press. Sultana S., Mannen H., Tsuji S. (2003): Mitochondrial DNA diversity of Pakistani goats. Anim Genet, 34:417‐421. Tajima, F. (1989): Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123: 585‐595. Weir, B.S., Cockerham, C.C. (1984) Estimating F‐statistics for the analysis of population structure. Evolution, 38(6):1358‐1370. Wu Y.P., Guan W.J., Zhao Q.J., He X.H., Pu Y.B., Huo J.H., Xie J.F., Han J.L., Rao S.Q., Ma Y.H. (2009): A fine map for maternal lineage analysis by mitochondrial hyperviable region in 12 Chinese goat breeds. Anim Sci J, 80: 372–380. Yalçın B.C. (1986): Sheep and Goats in Turkey. FAO Animal Production and Health Paper, 60. Zeder M.A. (2008): Domestication and early agriculture in the Mediterranean Basin: Origins, diffusion, and impact. PNAS, 19: 11597‐11604. PRP GENE BASED SCRAPIE SUSCEPTIBILITY IN NATIVE TURKISH SHEEP: DO WE NEED TO INTRODUCE A BREEDING PROGRAMME TO SELECT FOR RESISTANCE TO SCRAPIE IN TURKEY? Emel OZKAN1*, M. İhsan SOYSAL1, Begüm UZUN2, Ebru GOKALP3, İnci TOGAN2 1 Namık Kemal University.Faculty of Agriculture.Department of Animal Science.59030 Tekirdag. Turkey 2 Middle East Technical University.Faculty of Arts and Sciences.Department of Biology. 06531 Ankara 3 Yıldırım Beyazıt University.Faculty of Health.Ankara * e‐mail: ozemel@nku.edu.tr ABSTRACT Scrapie is an infectious fatal disease of sheep and member of Transmissible Spongiform Encephalopathies (TSE) (or a prion disease) and affecting the central nervous system of sheeps and goats. Susceptibility to scrapie is associated with polymorphisms in sheep prion protein gene, based on their genotypes at codons 136, 141, 154 and 171. Even though in Euro Asia spectrum, accumulated data is mostly from Europe, archeological and genetic evidences, has indicated that Middle East is the heart of sheep domestication and all of the sheep breeds must have went out from his region. The main purpose of the study is to collect reliable (where breeds are well‐ represented), extensive (covering 7 breeds and 745 bp DNA sequence) data on the PrP gene polymorphisms mainly from coastalregions ofTurkey from which scrapie incidence has not been reported. In the current study, sheep were sequenced for 3rd exon of PrP gene. INTRODUCTION Scrapie is a neural degenerative and lethal disease with a long incubation period, affecting the central nervous system of sheep and goats. It has been known in Europe for more than 250 years (McGowan, 1922). The formation of the disease is associated with the accumulation of an isoform of prion protein (PrP), which normally is not observed in central nervous system. Scrapie leads to the reduction of yield loss followed by death as well as when mixing of sheep tissues infected with scrapie to animal feed it causes deadly mad cow (Bovine Spongiform Encephalography, BSE) in cattle and from them by infecting orally it can result in the emergence of deadly prion disease variant called Creutzfeld‐Jacob disease in human . The ovine PrP gene located on chromosome 13 has three exons and two introns and more than 50 single nucleotide polymorphisms (SNP) have been observed in 35 different codons on third exon (Alvarez et al., 2011). However, the polymorphisms in codons 136, 154 and 171 have been determined to be related to sheep industry, human and animal health. The polymorphisms in codons 136 (valine (V) is associated with high scrapie susceptibility while alanine (A) is associated with low susceptibility), 154 (arginine (R) is associated with susceptibility while histidine (H) is associated with partial resistance) and 171 (glutamine (Q) and histidine (H) are associated with susceptibility while arginine (R) is associated with resistance (Baylis et al. 2004)) of the PrP gene are known to be highly related to the degree of susceptibility or resistance to scrapie in sheep (Vaccari et al., 2001; Tongue et al., 2004). The various combinations of these amino acids produce a variety of haplotypes. Recent studies showed that ARR haplotype is in scrapie resistant sheeps while VRQ haplotype exist in scrapie susceptible sheep (Pongolini et al., 2009). The binary combinations of these haplotypes create various genotypes such as ARR‐ARR and ARQ‐TRQ. The individuals having different genotypes show different susceptibility to scrapie. Therefore, British National Scrapie Plan (NSP), the European Commission has grouped the PrP genotypes of sheep into five classes representing different levels of risk (Hunter et al., 2007; Dawson et al., 1998). The breeding is made by selection in flocks of sheep according to this plan. For this reason, countries scan prion protein gene polymorphisms in 3. codons especially mentioned above in order to assess the susceptibility of their sheep races to scrapie. In addition, in many countries, especially European Union countries, with the aim of producing flocks resistant to scrapie, the strict selection programs th 132 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) are performed to increase the frequency of resistant genotypes. Under this program a large number of individuals were screened in terms of both PrP gene and the presence of scrapie. Recent studies revealed that there are different scrapie strains and isolates (atypical scrapie) the scrapie strain (e.g. ARR‐ARR genetically resistant to scrapie) that had been identified in previous experiments was started to name as classical scrapie. Alongside classical scrapie, atypical forms of the disease have been identified which show different epidemiology, clinical signs and distinct biochemical characters (Benestad et al., 2003). Furthermore, prion protein genotypes condition atypical scrapie in a very different way compared to classical scrapie. Specifically, alleles AHQ and AF141RQ (hereafter AFRQ), an ARQ variant with L to F mutation at codon 141, have been associated with increased risk while the ARR allele gives no protection (Moum et al., 2005; Arsac et al., 2007; Lühken et al., 2007; Benestad et al., 2008). Atypical scrapie susceptible individuals, which are relatively resistant to classic form of scrapie, are pointed that the previous selection programs implemented to increase the frequency of genotypes are needed to be checked. A reason of high presence of classical scrapie susceptible genotypes in Europe may be related to some production characteristics and it is thought that the disease has arisen during increase yields of sheep here. The both ideas of that the probability of classical scrapie resistant genotypes being susceptible to atypical scrapie and, the yield may decrease while scrapie resistant flocks being produced have created worries. In addition, they have revealed that not only the polymorphisms in Prp protein gene but also the scrapie and yield characteristics relations need to be worked in a comprehensive way. Although the source of atypical scrapie is not known yet, the studies suggest that the mutations in both codons 141 and 154 constitute atypical scrapie source (Moum et al., 2005; Benestad et al. 2008, Fediaevsky et al., 2009). The individuals with different genotypes in atypical scrapie may also represent different risk groups due to variations in susceptibility to atypical scrapie (Fediaaevsky et al., 2009) Since domestic sheep all around the world may have been gone from this region it is expected that almost all existing PrP poly morphism scan be seen in Turkish sheep. That is why not only the known polymorphisms but the whole sequence of the region was examined. There are few studies on prion protein genepoly morphisms of native sheep breeds in Turkey (Un et al., 2008, Alvarez et al., 2011). Even though8 breeds were scanned from Turkey, in order to understand fully the genetic condition in our country with a high number of the native races (more than 15) more races and individuals should be studied carefully. The main purpose of this study to create a database that reflects better Prp gene polymorphisms of Turkey native sheep breeds and haplotypedistributions on the basis of geography and breeds. MATERIALS AND METHODS In the present study, sampling was made from seven native sheep breeds: Sakiz (n=15, Izmir), Gokceada (n=15) one of the two Aegean islands of Turkey in Aegean Sea), Hemsin (n=15, Artvin), Guney Karaman (n=15, Konya), Karayaka (n=15, Ordu and Tokat), Kivircik (n=15, Kırklareli), Cine Capari (n=15, Aydin). Prp Gene Based Scrapie Susceptibility in Native Turkish Sheep: Do We Need To Introduce a Breeding Programme to Select For Resistance to Scrapie in Turkey? 133 G.Karaman Figure 1. Sampling sites of seven Turkish native sheep breeds. Blood samples were collected from 105 sheep including seven native sheep breeds. DNA samples were isolated from blood by phenol chloroform method (Sambrook et al.. 1989). By using polymerase chain reaction. 745 bp region of genomic DNA containing complete coding sequence in exon 3 of PrP gene were amplified with the following primers: Forward Primer: 5’‐ AAAGCCACATAGGCAGTTG‐3’; Reverse Primer:5’‐AATGAGGAAAGAGATGAGGAG‐3. PCR amplification was carried out in a 25 µl reaction volume containing 1X reaction buffer, 2.5mM of MgCl2, 0.2mM of each dNTP (FermantasdNTP set, Thermo Fisher Scientific Inc.), 10 µM of each primer, 1U of Taq polymerase (Fermantas. Thermo Fisher Scientific Inc.), and 50–100 ng of genomic DNA. The amplification was performed in a DNA Thermal Cycler Biometrawith a heat step of 2’at 94 ◦C and 30 cycles of 1’at 94 ◦C,1’at 57 ◦C and 1’ at 72 ◦C with a final extension of 10 min. PCR product was visualized after electrophoresis on a 2% agarose gel with a long‐wavelength UV transilluminator. Sequencing was performed by using an ABI‐3100 sequencer (PE Biosystems, Germany) and theHigh Pure PCR Product Purification kit (Roche Applied Science).After the purification of the PCR products. Forward and reverse primers were used to sequence the PCR products. Amplified region was sequenced, edited, aligned. Single nucleotide polymorphisms in codons 136, 141, 154 and 171 were checked directly. Results were evaluated in two ways: in the form of sequences and in the collapsed form as haplotypes. RESULTS AND DISCUSSION The analyzed amino acid sequences of all the PrP genes in 105 sheep belonging to seven Turkish native sheep breeds showed that some polymorphisms were present at each of the codons 136.141.154 and 171. Allele Frequencies Frequencies of the 11 alleles investigated (i.e., ALRQ, ALRR, ALHQ, VLRQ, ALRH, TLRQ, ALRK, ALHR, TLRH, VLRH) in seven Turkish native breeds are presented in Figure1. The most frequent allele was ALRQ (frequency = 0.733) followed by ALRR (0.50), ALRH (0.1667) and ALHQ (0.1667). The lowest allele frequency was VLRH, ALRK and AFRQ with a frequency of 0.0333. The ALRQ allele was present in all breeds and within breeds; it was predominant genotype in all breeds. The high susceptibility allele VRQ was identified Kivircik (frequency = 0.1333), Cinecapari (frequency = 0.1250), Karayaka (frequency = 0.1000) and Gokceada (0.033) sheep with the lowest th 134 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) level. In addition, the PrPallelesTLRH, VLHR, ALRK, and AFRQ were present only in Karayaka, Kıvırcık, Cine Capariand Kıvırcıksheep respectively and not found in other six sheep breeds. Figure 1.Haplotype frequency of eleven allelic variants (ALRR, ALRQ, TLRQ, ALRH, ALHQ, VLRQ and ALHR) of the PrP gene for 136, 141, 154 and 171 codons in investigated breeds: SAK: Sakız, GOK: Gokceada, HEM: Hemsin, GKAR: GuneyKaraman, KRY: Karayaka, KIV: Kıvırcık, CIC: Cinecapari. Genotypic frequencies PrP genotyping for codons 136, 141, 154 and 171 in 105 sheep revealed a total of nineteen genotypes (ALHQ / ALHQ, ALHQ / TLRQ, ALHR / ALHQ, ALRH / ALRH, ALRH / ALRQ, ALRH / TLRH, ALRH / VLRH, ALRQ / AFRQ, ALRQ / ALHQ, ALRQ / ALRK, ALRQ / ALRQ, ALRQ / TLRQ, ALRQ / VLRQ, ALRR / ALRH, ALRR / ALRQ, ALRR / ALRR, ALRR / TLRQ, ALRR / VLRQ and VLRQ / VLRQ) (Table 2) including wild‐type genotype ALRQ/ALRQ detected in all seven breeds. These genotypes were classified in five risk groups according to Tongue et al. (2004). Table 2. Genotype frequencies of PrP gene in Turkish native sheep breeds and their comparison with genotyped individuals in relation to their classic and atypical risk status. Classic Atypical Genotype SAK GOK HEM GKAR KRY KIV 0,0667 0.0667 3 4 ALHQ/ALHQ (AHQ/AHQ) 0.0667 n n ALHQ/TLRQ (AHQ/TRQ) 0.0667 n 0 ALHR/ALHQ (AHR/AHQ) 3 2 ALRH/ALRH (ARH/ARH) 3 0 ALRH/ALRQ (ARQ/ARH) n n ALRH/TLRH (ARH/TRH) n n ALRH/VLRH (ARH/VRH) 0.0667 3 3 ALRQ/AFRQ (ARQ/ARQ) 0.0667 3 3 ALRQ/ALHQ (AHQ/ARQ) n n ALRQ/ALRK (ARQ/ARK) 3 0 ALRQ/ALRQ (ARQ/ARQ) n n ALRQ/TLRQ (ARQ/TRQ) 5 0 ALRQ/VLRQ (ARQ/VRQ) 2 1 ALRR/ALRH (ARR/ARH) 2 0 ALRR/ALRQ (ARR/ARQ) 1 1 ALRR/ALRR (ARR/ARR) n n ALRR/TLRQ (ARR/TRQ) 4 0 ALRR/VLRQ (ARR/VRQ) 5 1 VLRQ/VLRQ (VRQ/VRQ) n=not known risk level 0.0667 0.0667 0.0667 CIC 0,0667 0.0667 0,1333 0.0667 0,1333 0.1333 0.0667 0.4000 0.2000 0.6000 0.4000 0.2667 0.2667 0.2000 0.0667 0.2000 0.1333 0.0667 0.1333 0.2000 0.2667 0.2667 0.3333 0.0667 0.1333 0.3333 0.3333 0.0667 0.0667 0.2667 0.1333 0.0667 0.0667 0.0667 0.0667 0.0667 Prp Gene Based Scrapie Susceptibility in Native Turkish Sheep: Do We Need To Introduce a Breeding Programme to Select For Resistance to Scrapie in Turkey? 135 Table 3 shows the PrP genotypes of sheep with respect to five classes representing different levels of classic(1‐5) and atypical (0‐4) risk and their distribution in Turkey. Overall, the more frequent genotypewas ALRQ/ALRQ, followed by ALRR/ARQ ALRR/ALRR and ALRQ/VLRQ. Very susceptible genotype VLRQ/VLRQ was found in the investigated Kıvırcık and Cinecapari breeds. The most scrapie‐resistant genotype ALRR/ALRR was present in seven (Sakız, Gökçeada, Hemşin, Guney Karaman, Karayaka, Kıvırcık and Cine Capari) breeds. Discussion To date, none of the typical scrapie cases have been reported in Turkish native sheep. The reasons are most period of the disease, culling most of the animals at earlier ages and lack of suitable screening systems for diagnosis. The present study revealed that frequency of VRQ allele which is highly associated with scrapie susceptibility was very low in seven Turkish native probably as follows; long incubation sheep breeds. Most of the investigated sheep belongs to the risk groups 1, 2 and 3.Since ARQ allele is predicted to be wild‐type allele of the PrP gene, the predominant allele in the majority of the breeds is ARQ allele (Elsen et al., 1999; O’Doherty et al., 2004). Therefore, analysis of ten Turkish native sheep supports this prediction. The results of this study are very useful since it allows us to understand the distribution of scrapie susceptibility in native sheep of Turkey. This information in turn may help to establish a fully scrapie susceptibility ‐ free breeds. By establishing and implementing scrapie control measures by the authorities, Turkey will benefit economically. Furthermore, it will be beneficial for the public health in the country. This data will be important and useful for the authorities responsible from the avoidance of scrapie in Turkey, for animal breeders associations and for research units of universities. At the same time, it will considerably fill the big gap which is present in the data of geographic distribution of PrP polymorphisms in the world. REFERENCES Arsac, J.N., Andreoletti, O., Bilheude, J.M., Lacroux, C., Benestad, S.L., Baron, T., 2007. Similar biochemical signatures and prion protein genotypes in atypical scrapie and Nor98 cases, France and Norway. Emerg. Infect. Dis. 13, 58–65. Alvarez L., Gutierrez‐Gila, B., Uzun M., Primitivo F. S., Arranz, J. J.(2011).Genetic variability in the prion protein gene in five indigenous Turkish sheep breeds. Small Ruminant Research 99 (2011) 93‐98 Benestad, S.L., Sarradin, P., Thu, B., Scho¨ nheit, J., Tranulis, M.A., Bratberg, B., 2003. Cases of scrapie with unusual features in Norway and designation of a new type Nor98. Vet. Rec. 153, 202–208. Benestad, S.L., Arsac, J.N., Goldmann, W., No¨remark, M., 2008. Atypical/ Nor98 scrapie: properties of theagent, genetics, andepidemiology.Vet. Res., doi:10.1051/vetres:2007056. Dawson, M., Hoinville, L.J., Hosie, B.D., Hunter, N., 1998. Guidance on the use of PrP genotyping as an aid to the control of clinical scrapie. Scrapie Information Group. Vet. Rec. 142, 623–625. Elsen, J.M., Amigues, Y., Schelcher, F., Ducrocq, V., Andreoletti, O., Eychenne, F., Khang, J.V., Poivey, J.P., Lantier, F., Laplanche, J.L., 1999. Genetic susceptibility and transmission factors in scrapie: detailedanalysis of an epidemic in a closedflock of Romanov. Arch. Virol. 144, 431–445. Fediaevsky A., Morignat E., Ducrot C., Calavas D., 2009. A Case–Control Study on the Origin of Atypical Scrapie in Sheep, France. Emerging Infectious Diseases www.cdc.gov/eid Vol. 15, No. 5, May 2009, 710‐718. Hunter, N. (2007). Scrapie‐Uncertainties, biology and molecular approaches. Biochimicaet Biophysica Acta 1772 (2007) 619–628. Lühken, G., Buschmann, A., Brandt, H., Eiden, M., Groschup, M.H., Erhardt, G., 2007. Epidemiological and genetical differences between classical and a typical scrapiecases. Vet. Res. 38, 65–80. O’Doherty, E.,Aherne, M., Ennis, S., Weavers, E., Roche, J.F., Sweeney, T., 2004. Prion protein gene polymorphisms in pedigreesheep in Ireland. Res. Vet. Sci. 70, 51–56. th 136 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) McGowan, J.P., 1922. Scrapie in sheep.J. Agric. 5, pp. 365–375. Moum, T., Olsaker, I., Hopp, P., Moldal, T., Valheim, M., Moum, T., Benestad, S.L., 2005. Polymorphisms at codons 141 and 154 in the ovine prion protein gene are associated with scrapie Nor98 cases. J. Gen. Virol. 86, 231–235. Pongolini, S., Bergamini, F., Bassi, S., 2009. A new genotyping strategy for efficient scoring of closely positioned SNPs in the ovine prion protein gene. Mol. Cell. Probes 23, 122–125. O’Doherty, E., Aherne, M., Ennis, S., Weavers, E., Roche, J.F., Sweeney, T., 2004. Prion protein gene polymorphisms in pedigreesheep in Ireland. Res. Vet. Sci. 70, 51–56. Sambrook J., Fritsch E.F., Maniatis T. 1989. Molecular cloning: A laboratory manual. Cold‐Spring Harbor, New York. Tongue, S.C., Wilesmith, J.W., Cook, C.J., 2004. Frequencies of prion protein (PrP) genotypes and distribution of ages in 15 scrapieaffected flocks in Great Britain. Vet. Rec. 154, 9–16. Ün, C., Oztabak, K., Ozdemir, N., Akıs, I., Mengib, A., 2008. Genotyping of PrP gene in native Turkish sheep breeds. Small Rum. Res. 74, 260–264. Vaccari, G., Petraroli, R., Agrimi, U., Eleni, C., Perfetti, M.G., Di Bari, M.A., Morelli, L., Ligios, C., Busani, L., Nonno, R., Di Guardo, G., 2001. PrP genotype in Sarda breed sheep and its relevance to scrapie. Arch. Virol. 146, 2029–2037. REPRODUCTIVE CHARACTERIZATION OF BLACK RACKA RAMS I.EGERSZEGI1*, P. SARLOS1, A. MOLNAR1, S. CSEH2 and J. RATKY1 1 Research Institute for Animal Breeding and Nutrition,Herceghalom 2 Szent István University, Faculty of Veterinary Science,Budapest * Corresponding author: istvan.egerszegi@atk.hu One of the oldest Hungarian sheep breed is the Hortobágy Racka. Some different bloodlines could be identified countrywide, so in situ preservation of the breed is secured. However more profound knowledge on male reproductive characteristics of this breed could assist more effective use of breeding animals and could help for ex situ in vitro conservation as well. Authors determined scrotal circumference, quantitative and qualitative semen parameters of ejaculate and give preliminary overview about liquid and cryo‐preservation of semen from Hungarian Black Racka rams. Altogether 386 ejaculates were collected using artificial vagina from 9 rams. Semen volume, motility, sperm concentration and total number of spermatozoa per ejaculate were determined. The percentage of abnormal spermatozoa was evaluated after Cerovsky‐staining. The mean semen volume was 0.69±0.019 ml with a concentration of 5.66±0.098x109 spermatozoa/ml. High sperm motility was observed in all samples 4.81±0.03. Percent of abnormal spermatozoa was 14.13±0.49. Different antioxidants were added to liquid preserved semen (Resveratrol (R), Ubiquinon, Vit‐E) against lipidperoxidation during storage on 5 °C for 8 days. Mixed semen samples from nine matured rams’ ejaculates were treated. Sperm cells from control sample died by day8 of preservation, while treated ones characterized by 45.5‐65.4% and 26.1‐44.9% motile and progressively motile cells respectively. Antioxidant treatment improved preservation success, the best result was obtained after R treatment. Semen samples from these rams were frozen and post‐thaw motility was assessed by CASA. Motility% varied between 40‐60%. In conclusion, volume of semen is less, whilst concentration and total number of sperm cells are higher in Black Racka ejaculate than in other sheep breeds, furthermore results indicated that good quality liquid and frozen samples could be produced from these rams, which could be utilized in preservation of the breed. Keywords: Black Racka, ram, semen, liquid preservation, semen freezing Introduction Hungarian indigenous sheep breed, the Hortobagy Racka or Hungarian Sheep has two colour variants. Nowadays more than 6450 purebred females are in breeding and approximately 40% of them are black ones (MAJUSZ, 2011). This breed has three utilization ways: ‐ meat, ‐ milk and – wool. In the last decades several experiments were carried out to investigate body measurements, the inheritance and quality of the wool and fur, the milking performance, fattening and meat quality of the Racka sheep (Dunka, 2002; Nagy et al., 2004; Nagy and Komlósi, 2005). The TSE (scrapie) susceptibility of the native sheep breeds in Hungary was described by Fésüs et al., 2004. Egerszegi et al. (2008) monitored follicular development and early embryonic development by ultrasonography in Black Racka ewes. However the knowledge about the reproductive characteristics of the breed is quite poor. It could be summarized in the following parameters: ram lambs attain puberty at the age of 7 months, whilst ram and virgin ewes are bred at first at the age of 1.5 years. The mating season lasts from the end of August till November (Dunka, 2002). The ewes have their first lambing till the age of 28 months with 110% lambing percent (MJKSZ, 2011). In contradiction to previous data we have no information on the reproductive performance of Racka rams, which could be quite different compared to that of modern breeds. Profound knowledge of specific reproductive properties could help to increase utilization and preservation of Racka sheep. It is well known that most sheep breeds are seasonal ones. Among farm animals bred in temperate climate zone sheep is declared as strongly seasonal species. This phenomenon is controlled primarily by cyclic changes of daylight as well as th 138 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) several other factors i.e. temperature, feeding, contact with males, lambing time, lactation length (Rosa and Bryant, 2003). Above the 35° latitude level of seasonality is increasing continuously. The British sheep breeds are strongly seasonal while moving to southern countries 5 to 25 percent of their population have spontaneous ovulation detected after the traditional (August to December) mating season (Hafez, 1952). These seasonal changes of the reproductive performance could be observed in rams, too which decrease according to the level of domestication and intensive breeding (Lincoln et al., 1990). Seasonal changes could be observed in behavior, testes size (weight and volume), gametogenesis and hormone secretion pattern (Land, 1973; Schanbacher and Lunstra, 1976) which are detectable parallel to the reproductive activity of the ewes from the same breed (Thibault et al., 1966). These changes are less marked compared to the ewes because spermatogenesis and sexual activity never stop and the females have a definite anoestrus period (Pelletier and Almeida, 1987). Aim of this study was to determine how season affect on the Black Racka rams’ semen parameters, furthermore effect of antioxidant treatments on liquid preservation of the ejaculates was investigated. At least aim was to obtain preliminary data about freezability of semen from Hungarian Black Racka rams. Materials and methods Animals Nine mature Black racka rams (picture 1.) were included in a whole year trial. Animals were group housed and fed by alfalfa hay and concentrate during whole year. They were allowed to pasture from March till December. Animals had free access to fresh water and mineralized salt block. Picture 1. Black Racka rams Semen collection, evaluation and processing Experiment1. The rams were trained for semen collection by using artificial vagina. Only rams from which semen could be collected 5 consecutive times were included in the trial. Samples were taken in plastic tubes connected to the pre‐warmed (41°C) vagina. Semen volume was immediately measured by pipettes and prepared for further investigations. A drop of raw, undiluted semen was put on glass slide heated to 37°C and motility was classified as described by Evans and Maxwell (1987) between 1 to 5 grade under 40x magnification phase contrast objective of Olympus BX51 microscope. The concentration was measured by spectrophotometer (IMV, Accucell) after dilution of the samples 1:400 with isotonic saline solution. Cerovsky staining (1976) was used after dilution of the samples 1:200 with isotonic saline solution to identify morphological anomalies of spermatozoa. Slides were examined under 1000x magnification. Experiment 2‐3. Semen collection and evaluation before liquid and cryopreservation was performed as described in experiment 1. Immediately after quality control semen samples were Reproductive Characterization of Black Racka Rams 139 diluted either with Citrate based extender and treated with antioxidants or freezing extender. Briefly, mixed semen samples of 109/ml volume were treated with sodium‐citrate‐glucose‐eggyolk extender as well as with antioxidants and their combination i.e. with 15 µg Resveratrol (R15), 25 µg Resveratrol (R25), 15 µg Ubiquinon (Coenzim Q10, U15), 25 µg Ubiquinon (U25), 3 mg Vitamin E (E3), 5 mg Vitamin E (E5) antioxidants and 15µgR+3mgE (RE), 15µgU+3mgE (UE) and 15µgR+15µgU (RU) combinations, respectively. Prepared samples were stored on 5oC for 8 days. Motility was controlled by CASA method on day 0, 1, 3 and 8 of storage. Abnormality of sperm cell membrane was checked by acrosome staining (Kovács and Foote, 1992; picture 2.). For freezing process samples were diluted with Andromed (Minitube) extender for 0.3 109/ml and after 2 hours of equilibration on 5oC, straws were frozen in N2 vapour for 8 minutes. 24 h later straws were thawed in 38oC water bath for 20 seconds. Motility was controlled by CASA method. Statistical analysis All data received from experiment 1 were analysed using SPSS for Windows 15.0 software. Means, SEM and Oneway ANOVA (LSD‐test; P<0.05) procedure were conducted to compare seasonal effects on semen parameters. Results and Discussion The seasonal variations of semen characteristics of Black Racka rams are summarized in Table 1. The average volume of the ejaculates was nearly 0.7 ml and contained more than five billion cells per ml. Constant high motility grade of spermatozoa was observed. The mean number of morphological abnormalities was under 15 %. Circumference of testes was increased continuously from 22.58±1.43 cm (winter) to 31.55±1.16 cm (autumn). Significant difference were detected between winter‐autumn, spring‐autumn relation (p<0.05). Seasonal variations of the testes size and semen parameters were described in several sheep breeds demonstrated by decreasing versus increasing LH and FSH secretion (Lincoln and Davidson, 1977; Boland et al., 1985; Ortavant et al., 1988; Sarlós et al., 1996; Mandiki et al., 1998; Kafi et al., 2004; Avdi et al., 2004; Dickson and Sanford, 2005). Table 1. Semen parameters of Black Racka rams Season n Mean± SEM Minimum Maximum Volume (ml) winter 101 0.64±0.032a,d 0.1 1.3 b,d spring 99 0.54±0.028 0.1 1.3 summer 76 0.60±0.034d 0.15 1.6 autumn 105 0.88±0.032c 0.1 1.7 Concentration winter 99 4.95±0.13a,d 2.09 8.2 (x109/ml) spring 93 5.57±0.17b,d 1.8 9.63 summer 65 6.12±0.19b,c 3.14 9.03 2.84 8.85 autumn 104 5.27±0.13d Motility (1‐5) winter 98 4.68±0.086 0 5 spring 89 4.87±0.045 2 5 summer 67 5.0±0.0 5 5 autumn 103 4.77±0.051 3 5 Total number of winter 97 3.32±0.21b,d 0.31 8.2 sperm spring 95 3.07±0.21a,d 0.23 9.76 cells/ejaculate summer 65 3.73±0.27b,d 0.59 9.5 9 (x10 ) 0.39 13.42 autumn 102 4.64±0.24a Total number of winter 93 16.92±0.78a 3 36 morphological spring 92 16.35±0.76a 3 34 b defect (%) summer 71 8.45±0.67 1 25 1 25 autumn 106 8.42±0.47b In each parameters different superscripts a:b; c:d mean significant difference between values (p<0.05) th 140 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) In accordance to the previous studies we detected also significant differences in semen parameters between seasons. The lowest ejaculate volumes were measured in spring (March to May) whilst the highest in autumn (September to November) respectively. The mean concentrations of the semen samples were relatively high compared to those of other breeds (Sarlós et al., 1996; Mandiki et al, 1998; Oláh, 2010). Rams’ fertility is indicated by quality parameters of the ejaculates. In earlier experiments, significant difference was detected in sperm motility and sperm cell abnormalities in ejaculates collected in various seasons. Sarlós et al (1996) observed the most intensive sperm motility in British Milk sheep rams in winter whilst in autumn lower values were obtained. In contradiction Suffolk and DLS rams gave less motile ejaculates in the spring (Dufour et al., 1984). Motility of Racka rams’ spermatozoa was relatively high during the experiment, however small nadir could be observed in winter and autumn. Morphological defects had peak values in winter and lowest rate in summer to autumn which is partly in accordance to others findings. Colas and Courot (1977) found twice more sperm defects (22.1%) in spring ejaculates from Il de France rams than in autumn ejaculates (10.3 %). In British Milk Sheep rams the percent of sperm abnormalities was the same in spring and autumn samples (10.7%) but in summer their number increased (22.77%) significantly (Sarlós et al., 1996). Similar result was reported by Cupps et al. earlier (1960) in Suffolk and Hampshire rams. Photo: A. Kovács Picture 2. Frozen‐thawed ram semen with Kovács‐Foote staining. Experiment 2‐3. Apart from treatments semen quality was reduced during storage. However till d 3 sperm motility of all treated samples was lower than that of control samples, motility decreased and membrane abnormalities increased. Sperm cells in E3 and control samples died on d 8. Motility of other treated samples was 45.5 to 65.4 % and progressive motility was 26.1 to 44.9 %. Following antioxidant treatment we got less cell membrane abnormality and the best results gave treatment with R15 – 14.15±5.1% and RU ‐ 14.8±4.9%. Besides liquid semen preservation there is an improved use of cryopreserved semen. Since decades there have been many trials to develop this method (Maxwell and Salamon, 1995; Salamon and Maxwell, 1995). The ram semen freezabilty is dependent on season (D’Allessandro and Martemucci, 2003), furthermore difference was observed between breeds too (Joshi et al., 2005; El‐Alamy and Foote, 2001). Despite several weak points of the method, semen freezing was used in conservation programs of numerous native sheep breeds (Marco‐Jimenez et al., 2005; Nel‐Themaat et al, 2006; Sabev et al., 2006). In our preliminary study it was found relatively high post thaw motility 40‐60% (52.4±4.35% motility and 49.3±5.1% progressive motility), however percent of live‐intact cells was 30‐45%, which indicate that improvement is needed for protect cells against membrane damages. Reproductive Characterization of Black Racka Rams 141 Conclusions Semen production of Black Racka rams could be fitting for ex situ in vitro conservation of this breed however some seasonal features should be kept in mind e.g. lower ejaculate volume in spring, higher number of morphological defects in winter. For the most adequate conservation further experiments are needed to improve membrane integrity and viability of cells during liquid preservation and freezing. Acknowledgement The study was supported by Hungarian Scientific Research Foundation OTKA ‐ K 76371. Istvan Egerszegi received Janos Bolyai research grant from the Hungarian Academy of Sciences. Authors thanks for technical help of Geza Gyimothy and Janosne Szabo. REFERENCES Avdi, M., Banos, G., Stefos, K. and Chemineau, P. (2004) Seasonal variation in testicular volume and sexual behavior of Chios and Serres rams. Theriogenology 62: 275–282. Boland, M. P., Alkamali, A.A., Crosby, T.F., Haynes, N.B., Howles, C.M., Kelleher, P.L. and Gordon, I. (1985) The influence of breed, season and photoperiod on semen characteristic, testicular size, libido and plasma hormone concentration in rams. Anim. Reprod. Sci. 9: 241‐252. Cerovsky, J. (1976) A method of the staining of boar spermatozoa for morphological evaluation. Zivocisna Vyroba 21: 361‐366. Evans, G. and Maxwell, W.M.C. (1987) Salamon's artificial insemination of sheep and goats. Butterworths Sydney Colas, G. and Courot, M. (1977) Production of spermatozoa, storage of semen and artificial insemination in the sheep. Management of Reproduction in sheep and goats, Symposium, Madison, Wisconsin, 24: 31. Cuups, P.T., McGowan, B., Rahlman, D.F., Reddon, A.R. and Weir, W.C. (1960) Seasonal changes in the semen of rams. J. Anim. Sci., Albany, N.Y. 19: 208. D’Alessandro, A.G. and Martemucci, G. (2003) Evaluation of seasonal variations of semen freezability in Leccese rams. Animal Reproduction Science 79: 93–102. Dickson, K.A. and Sanford, L.M. (2005) Breed diversity in FSH, LH and testosterone regulation of testicular function and in libido of young adult rams on the southeastern Canadian prairies. Small Ruminant Research 56: 189–203 Dufour, J.J., Fahmy, M.H. and Minvielle, F. (1984) Seasonal changes in breeding activity, testicular size, testosterone concentration and seminal characteristics in rams with long or short breeding season. J. Anim. Sci., Albany, N.Y. 58: 416‐422. Dunka, B. (2002) Hungarian sheep (Magyar juh (Ovis aries strepsiceros hungaricus))In: Génmegőrzés: Kutatási eredmények régi háziállatfajták értékeiről, Debrecen (in Hungarian) Egerszegi, I., Molnár, A. Sarlós, P., Soós, F. and Rátky, J. (2008) Investigation of the follicular development and early pregnancy in Hungarian Black Racka ewes by means ultrasonography – preliminary study. AWETH 4. (2.): 311‐318. (in Hungarian) El‐Alamy, M.A. and Foote, R.H. (2001) Freezability of spermatozoa from Finn and Dorset rams in multiple semen extenders. Animal Reproduction Science 65: 245–254. Fésüs L., Zsolnai A., Horogh G. P., Anton I. (2004) Scrapie in sheep. 2. Frequency of prion genotypes in indigenous Hungarian sheep breeds. (A juhok surlókórja. 2. A priongenotípusok gyakorisága hazai õshonos juhállományainkban). Magyar Állatorvosok Lapja 11: 670‐675. (in Hungarian) Hafez, E.S.E. (1952) Studies on the breeding season and reproduction of the ewe. J. Agric. Sci. Camb. 42: 189– 265. Joshi, A., Bag, S., Naqvi, S.M.K., Sharma, R.C. and Mittal, J.P. (2005) Effect of post‐thawing incubation on sperm motility and acrosomal integrity of cryopreserved Garole ram semen. Small Ruminant Research 56: 231– 238. th 142 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Kafi, M., Safdarian, M. and Hashemi, M. (2004) Seasonal variation in semen characteristics, scrotal circumference and libido of Persian Karakul rams. Small Ruminant Research 53: 133–139. Kovács, A. and Foote, R.H. (1992) Viability and acrosome staining of bull, boar and rabbit spermatozoa. Biotechnic and Histochemistry 67: 119–124. Land, R. B. (1973) The expression of female sex‐limited characters in the male Nature 241: 208 – 209. Lincoln, G.A. and Davidson, W. (1977) The relationship between sexual and aggressive behaviour, and pituitary and testicular activity during the seasonal sexual cycle of rams, and the influence of photoperiod. J. Reprod. Fertil. 49: 267–276. Lincoln, G.A., Lincoln, C.E. and McNeilly, A.S., (1990) Seasonal cycles in the blood plasma concentration of FSH, inhibin and testosterone, and testicular size in rams of wild, feral and domesticated breeds of sheep. J. Reprod. Fertil. 88: 623–633. MJKSZ (Hungarian Sheep and Goat Breeding Association) (2011) Mandiki, S.N.M., Derycke, G., Bister, J.L., Paquay, R. (1998) Influence of season and age on sexual maturation parameters of Texel, Suffolk and Ile‐de‐France rams 1. Testicular size, semen quality and reproductive capacity. Small Ruminant Research 28: 67‐79. Marco‐Jimenez, F., Puchades, S., Gadea, J., Vicente, J.S. and Viudes‐de‐Castro M.P. (2005) Effect of semen collection method on pre‐ and post‐thaw Guirra ram spermatozoa. Theriogenology 64: 1756–1765. Maxwell, W.M.C. and Salamon, S. (1995) Frozen storage of ram semen. II. Causes of low fertility after cervical insemination and methods of improvement. Animimal Reproduction Science 38: 1‐55. Nagy, L., Domanovszky, Á. and Székely P. (2004) Investigation of fattening and slaughter performance in Hungarian Racka sheep. (A magyar racka juh hizlalási‐ és vágási vizsgálata.) Acta Agraria Debreceniensis 13: 1‐6. (in Hungarian) Nagy, L. and Komlósi, I. (2005) Milk composition changes during lactation in Racka sheep. (A magyar racka juh tejének beltartalmi változása a laktáció alatt) Acta Agraria Debreceniensis 16: 24‐28. (in Hungarian) Nel‐Themaat, L., Harding, G.D., Chandler, J.E., Chenevert, J.F., Damiani, P., Fernandez, J.M., Humesa, P.E., Pope, C.E. and Godke, R.A. (2006) Quality and freezing qualities of first and second ejaculates collected from endangered Gulf Coast Native rams. Animal Reproduction Science 95: 251–261. Oláh, J. (2010) Factors affect on semen parameters in ram. PhD Thesis. (in Hungarian) Ortavant, R., Bocquier, F., Pelletier, J., Ravault, J.P., Thimonier, J. and Volland‐Nail, P. (1988) Seasonality of reproduction in sheep and its control by photoperiod. Aust. J. Biol. Sci. 41: 69–85. Pelletier, J. and Almeida, G., (1987) Short light cycles induce persistent reproductive activity in Ile‐de‐France rams. J. Reprod. Fertil. Suppl. 34: 215–226. Rosa, H.J.D. and Bryant, M.J. (2003) Seasonality of reproduction in sheep. Small Ruminant Research 48: 155– 171. Sabev, M., Nikolov, I., Ivanova‐Kicheva, M., Stefanov, R., Chemshirova, T., Baycheva, E. and Popova, M. (2006) Cryopreservation of ram sperm from autochthonous breeds during a non‐mating season. Journal of Central European Agriculture 4: 677‐682. Salamon, S. and Maxwell, W.M.C. (1995) Frozen storage of ram semen. I. Processing, freezing, thawing and fertility after cervical insemination. Anim. Reprod. Sci. 37: 185‐249. Sarlós, P., Molnár, A., Huszár, Sz., Rátky, J. and Brüssow, K.‐P. (1996) Seasonal changes of andrological characteristies in British milk ram. Arch. Tierz. 39: 265‐275. Schanbacher, B.D. and Lunstra, D.D. (1976) Seasonal changes in sexual activity and serum levels of LH and testosterone in Finnish Landrace and Suffolk rams. J. Anim. Sci. 43: 644–650. Thibault, C., Courot, M., Martinet, L., Maulion, P., Du Mesnil Du Buisson, F., Ortravant, R., Pelletier, J. and Signoret, J.P. (1966) Regulation of breeding season and estrous cycles by light and external stimuli in some mammals. J. Anim. Sci., Albany, N.Y. 25 Suppl.: 119. HAPLOTYPE VARIATION of EXON 4 ESTROGEN RECEPTOR‐α (ERα) GENE in TURKISH SHEEP BREEDS O. Ozmena1, I. Seker1, B Cinar Kul2, O. Ertugrul2 1 Firat University Faculty of Veterinary Medicine Department of Animal Breeding. Elazig. Turkey 2 Ankara University Faculty of Veterinary Medicine Department of Genetic. Ankara. Turkey Summary In the present study, on the basis of the sequences of human, cattle and caprine estrogen receptor α (ERα) genes, available in the GenBank database, sets of PCR primers were designed and used to amplify the ovine ER‐α gene exon 4 region. In the present study, identified six single nucleotide polymorphisms (SNP) in the ER‐α exon 4. Some variations determined for exon 4 g.43A>G, p.T43A; g.49C>T, p.L49F; g.178A>T, p.T178S led to changes in the amino acids, but no amino acid changes were determined in g.18G>C, g.27C>T, g.96G>A. These fragments were deposited in the GenBank database under accession number: JF262030‐JF262035. It was noted in particular that White Karaman and Awassi were similar to each other, whereas the Chios breed had a different variation. Keywords: Turkish sheep breeds, Estrogen receptor gene, Polymorphism Introduction Estrogens play a crucial role in sexual development and reproduction in various tissues. In mammals, estrogens are responsible for development of female secondary sex characteristics and function as reproductive hormones in both males and females. However, these are not the only roles of estrogens (Leader et al 2006) but it is most important role is the development and functioning of the female reproductive system. Due to numerous functions that estrogens play in the animal organisms, estrogen receptors and their genes are considered candidates for the markers of production and functional traits in farm animals (Szreder and Zwierzchowski, 2004‐a) The effects of estrogens are mediated by spesific receptor subtypes, which is ERα and ERβ, known as ESR1 and ESR2 respectively (Kuiper et al. 1996). In the ovine genome ERα and ERβ is encoded by a separate gene, localized on chromosome 8 and 7 respectively. It has been suggested that ERα and ERβ may play different roles in estrogen‐responsive tissues. For example, the mRNA for ERα is highly expressed in the rat brain areas responsible for reproduction, whereas ERβ mRNA is present mainly in regions of non‐reproductive function (Merchentjhaler et al 1997, Osterlund et al 1998). Of the estrogen receptor (ER) genes, expression levels of ERα are much higher than those of ERβ in the uterus. In addition, ERα knock‐out mice demostrate complete uterine dysfunction and resistance to estrogen while ERβ knock‐out mice do not (Petterson and Gustafson, 2001 and Curtis et al 2000). Interestingly, only ERα is regulated by estradiol in the utrerus (Wang et al 1999.) That is the reason our studies focus on ER‐α. Litter size is the one of the most important production traits in sheep breeding. In recent years, researchers have investigated to detect major genes or molecular markers influencing litter size, including the ERα. Marker‐assisted selection (MAS) could be an important tool for genetic improvement of litter size. A few candidate genes for litter size have been already identified according to their roles in the physiology of reproduction and their position within chromosomal regions containing quantitative trait loci (QTL) for reproductive traits. To use these markers in MAS, it is necessary to verify whether these markers are associated with the traits in the specific population under selection. However, as a preliminary step, it is important to evaluate whether the markers are polymorphic in the investigated populations (Dall’Olio et al. 2010 and Distl O. 2007). The Chios sheep breed has a high milk yield and an outstanding prolificacy. The average litter size is 2.3. The Awassi is principally a milk breed, but meat production from this breed is also important and the twinning rate is 10‐20%. The White Karaman is a breed indigenous to Turkey with a twinning rate of 20‐30% th 144 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) (Akcapinar 2000 ). It is well known that Chios sheep are highly prolific in comparison with many other breeds. The purpose of this study is to reveal the genetic polymorphism of ERα gene in high prolificacy Chios and low prolificacy White Karaman and Awassi sheep breeds. Material and Method Animal Resources and DNA Isolation Jugular blood samples (2 ml per ewe) were collected from 48 Chios sheeps, 41 White Karaman sheeps, 48 Awassi sheeps using EDTA as an anticoagulant. These ewes were chosen at random. Genomic DNA was extracted from the whole blood using the Phenol‐chloroform method and then it was dissolved in 10 mM Tris‐HCl (pH 8.0) buffer and kept at ‐20º C. PCR Amplification and Sequence Analysis In the present study, according to the human (AF123496), cattle (AY538775) and caprine (GQ358923) sequence homology of exon 4 of ERα gene, using Primer3 software (www.genome.wi.mit.edu), following PCR primers were designed: F: 5’‐ GAGGGAGAATGTTGAAGC ‐ 3’ and R: 5’‐ GCCCAGTTGATCATGTGTA ‐3’. PCR reaction was carried out in 50 µl of total volume, containing 10X PCR Buffer (50 mM/l KCl, 10 mM/l Tris‐HCl (pH 8.0), 0.1% Triton X‐100), 1.5 mM MgCl2, 0.2 mM of each dNTP, 10 pM/l of each primer, 50 ng ovine genomic DNA and 1U Taq DNA polymerase (Eppendorf AG, Hamburg Germany). PCR conditions were as follows: denaturation at 94 °C for 5 min, followed by 34 cycles of denaturation at 94 °C for 1 min, annealing at 62 °C for 1 min, extention at 72 °C for 1 min and final extention at 72 °C for 10 min, on Mastercycler ® (Eppendorf AG, Hamburg, Germany). The PCR products were separated by electrophoresis on 2% agarose gels (Promega, Madison,WI, USA) in paralel with a 100 bp DNA marker. Then yield and specificity of PCR products were purified with the PCR purification kit and sequenced in an ABI 310 Prism Sequencer. Computer and Statistic Analysis Sequences were analysed using the BIOEDIT software (http://www.mbio.ncsu.edu./ BioEdit/bioedit.html) for sequence alignment. NETWORK 4.5.1.6. (http://www.fluxus‐ engineering.com) was used to build the network of exon 4 haplotype groups using the median joining algorithm. MEGA version 4.1 (Tamura et al. 2007) was used for the phylogenetic sequence analysis of haplotypes by the Neighbour‐Joining method based on Kimura‐2P model and the reliability of the inferred tree was assessed by bootstrap (1000 replicates) (data not shown). The DnaSP software 5 (Rozas et al. 2003) was used to calculate haplotype diversity (Hd) and nucleotide diversity (π); Watterson’s theta estimator for the studied species separately using a haplotype sequence was obtained. Pi is based on the average number of nucleotide differences between the sequence, and theta is based on the total number of segregating sites in the sequence (Iso‐Touru et al. 2009). To estimate the effect of selection, we calculated Tajima’s D (Tajima 1989), Fu and Li’s D* and F* test (Fu and Li 1993) and Fu’s Fs test (Fu 1997) for each group separately. Tajima’s D test compares the difference between the number of segregating sites and average number of pairwise (Tajima 1989). Under neutrality Tajima’s D value is assumed to be zero; under positive selection there is an excess of rare polymorphisms and Tajima’s D value is negative. Negative D values can also be due to population expansion. If there is balancing selection, intermediate frequency genetic variants are kept and Tajima’s D value is positive (Iso‐Touru et al. 2009). The statistical analysis package DnaSP 5 (Rozas et al, 2003) was used for the neutrality tests. The impact of amino acid variants on protein structure via analysis of multiple sequence alignments was done with Sorting Intolerant From Tolerant (SIFT), which uses sequence homology to predict whether an amino acid substitution will affect protein function and hence, potentially alter the phenotype. It gives a normalized probability score value that the amino acid change is tolerated. If the score value is less than 0.05, the amino acid change is predicted to be deleterious. The median Reproductive Characterization of Black Racka Rams 145 conservation value for the diversity of the sequence in the alignment is measured as well, and the default value is 3.0. Higher conservation values can lead to higher false positive error (Pauline and Henikoff, 2003). Results In this study, the sequence analysis of the exon 4 of the ERα gene revealed interesting variations in the studied populations and subpopulations. For exon 4, six different haplotypes were obtained (Table 1). The most common haplotype was OVIS_ER6 for the Chios breed and OVIS_ER1 for White Karaman and Awassi. OVIS_ER2, OVIS_ER3, OVIS_ER4, OVIS_ER5 and OVIS_ER 6 haplotypes were not detected in the White Karaman breeds. Table 1. Polymorphic sites and amino acid changes at the ERα gene exon 4 for the Turkish sheep breeds. (Nucleotides are numbered from 1 to 258.WK, AW, CH represent White Karaman, Awassi and Chios respectively) Haplotypes (Genebank no) Haplotype frequency WK AW CH 1 2 4 4 9 1 8 7 3 9 6 7 (n:41) (n:48) (n:48) 8 T L T AA 4 4 1 change 3 A 9 7 F 8 S OVIS_ER1 (JF262030) 41 29 9 G C A C G A OVIS_ER2 (JF262031) 0 OVIS_ER3 (JF262032) 0 16 5 . . . . A . 1 0 . T . . A . OVIS_ER4 (JF262033) 0 2 4 . T . . . . OVIS_ER5 (JF262034) 0 0 1 . . . T . . OVIS_ER6 (JF262035) 0 0 29 C . G . . T Six variations were determined in exon 4, of which three were non‐synonymous mutations: g.43A>G, p.T43A; g.49C>T, p.L49F; g.178A>T, p.T178S; while three variations (g.18G>C, g.27C>T, g.96G>A) were determined as synonymous mutations (Table 1). The ERα haplotype sequences from these sheep breeds have been deposited in the GeneBank database (http://www.ncbi.nlm.nih.gov) under the accession numbers: JF262030‐JF262035. Based on the observed mismatch distributions and the constructed radiation tree (data not shown), two main groups (Group A:White Karaman, Awassi populations; Group B: Chios populations) were determined (Table 2). Neutrality tests were applied separately to these haplotype groups. Neutrality tests at ovine ERα gene, Tajima’s D value, Fu and Li’s D* and F* values are shown in Table 2. Tajima’s D value, Fu and Li’s D* and F* values for exon 4 both group are negative. Only the Fu and Li’s F* and D* values for group B deviate statistically significantly from zero. Haplotype diversity (Hd), nucleotide diversity (π) and Watterson’s theta estimator were calculated separately for the studied species using the haplotype sequences obtained. Since in all groups nucleotide diversities were low but haplotype diversities were high, recent population growth is suggested. A median joining network for exon 4 is presented in Figure 1. The most common haplotype for exon 4 is OVIS_ER1. For exon 4 haplotypes, OVIS_ER2, OVIS_ER4 and OVIS_ER5 differs from th 146 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) OVIS_ER1 by one nucleotide; OVIS_ER3 differs from OVIS_ER1 by two nucleotides; OVIS_ER6 differs from OVIS_ER1 by three nucleotides; OVIS_ER5 and OVIS_ER6 haplotypes were observed only in the Chios breed. We studied the possible impacts of the amino acid changes for the protein structure with the methods implemented in SIFT programs. The substitution p.T43A, p.L49F and p.T178S was found not to affect the protein function by SIFT analysis (Table 3). These substitutions were observed only in the Chios breed. Table 2. Diversity and neutrality indices in exon 4 ERα gene Group A Haplotype number Group B 5 1 π 0.00208 0.00077 Hd 0.425 0.067 Өw 0.56991 0.75726 Tajima’s D ‐ 0.32580 ‐1.73178 Fu & Li’s F* ‐ 0.60672 ‐2.79394* Fu & Li’s D* ‐ 0.60529 ‐2.68759* π = nucleotide diversity, Hd = haplotype diversity, Өw = Watterson’s theta estimator, * P<0.05 Table 3. Predicted affection status for the amino acid substitutions from ERα gene exon 4 SIFT T43A Prediction Score MSC n Tolerated 1.00 3.33 29 L49F Tolerated 0.16 3.35 1 T178S Tolerated 1.00 3.11 29 Figure 1. Median joining network for ERα gene exon 4 haplotypes observed in Turkish sheep samples. (Different colours represent different sheep breeds) Reproductive Characterization of Black Racka Rams 147 Discussion Only a few studies were carried out of the ERα gene polymorphism in farm animals. Most of the studied regions have been exon 1 and 5’‐region in ERα gene. In 1996 Rotschild et al (lit. Gelecek) proposed ER genes as a candidate markers for prolificacy in pigs. Other authors then confirmed such relationships (Kmiec et al 2002; Chen et al 2000, Wang et al 2006, Noguera et al 2003, Short et al 1997). Munoz et al (2007) was identified five silent SNP in the ERα cDNA in different Chinese‐ European pig line: c.669T > C (exon 3), c.1227C > T (exon 5), c.1452C > T (exon 7), c.1665T > C and c.1755A > G (exon 8) . They found the ERα c. 1227T allele was significantly associated total number born. Szreder and Zwierzchowski (2004‐a) reported that a single strand conformation polymorphism (SSCP) within the coding region of the bovine ERα gene –the A > C transversion at position 503 in exon 1. Same authors then determined polymorphism in the 5’ region of the bovine ERα gene for the first time (Szreder and Zwierzchowski 2004‐b). Xiao‐Dan et al (2005) determined SNP in exon 1 of the ERα gene by PCR‐RFLP in both high fecundity sheep breeds (Small Tail Han sheep,Hu sheep and german Mutton Merino sheep) and low fecundity sheep breeds (Dorset sheep, Suffolk sheep). Their results indicated that there were three genotypes (AA, AB and BB) in all three high fecundity sheep breeds, but only two genotype (AA, AB) in low fecundity breeds. Sequencing revealed a C > G mutation at position 363 in exon 1 of ERα gene in the BB genotype in comparison to the AA genotype. The genotype distribution was observed significantly different between Small Tail Han and Hu sheep breeds (P < 0.01) and between Dorset and Hu sheep (P < 0.05). These authors found that the Small Tail Han sheep ewes with genotypes AB or BB had 0.51 (P < 0.05) and 0.7 (P < 0.05) more lambs than those with genotype AA, respectively. In the present study, a 258 bp ovine exon 4 of the ERα gene region was PCR amplified and sequenced. For the first time a polymorphism was described within the ERα gene exon 4 region in the Turkish high fecundity sheep (Chios) and low fecundity sheep breeds. As a result, this suggests that population expansion can be based on the negative neutrality test values obtained in exon 4 groups A and B. Under positive selection there is an excess of rare polymorphisms and Tajima’s D, Fu and Li’s D* and F* values are negative. Both population and subpopulation variations for exon 4 of the ERα gene polymorphisms were found in Chios, White Karaman and Awassi ewes. It was interesting to note that White Karaman and Awassi sheep were similar to each other in terms of exon 4 haplotypes, whereas the Chios breed had different variations. The Chios breed showed greater and different haplotype diversity and different variations in comparison with White Karaman and Awassi. The results of this study may be used in the further search for associations between polymorphism of the ovine ERα gene, its expression and reproduction traits. The next step will be to analyse these polymorphisms in a larger sample of sheep breeds and evaluate their association with prolificacy. REFERENCE Akcapinar H (2000): Sheep Breeding, 2nd. Ismat Press, Ankara. Turkey. Chen KF, Huang LS, Li N, Zhang Q, Luo M, Wu CX (2000): The geentic effect of estrogen receptor (ESR) on litter size traits in pig. Yi chuan Xue Bao 27, 853‐857. Curtis Hewit S, Couse JF, Korach KS (2000): Estrogene receptor knock out mice: what their phenotypes reveal about mechanism of estrogen action. Breast Cancer Research 2, 345‐352 Dall’Olio S, Fontanesi L, Tognazzi L, Russo V (2010): Genetic structure of candidate genes for litter size in Italian Large White pigs. Veterinary Research Communications 34, 203‐206. Distl O (2007): Mechanisms of regulation of litter size in pigs on the genome level. Reproduction in Domestic Animals 42, 10‐16. Fu YX (1997): Statistical tests of neutrality of mutations aganist population growthh, hitchhiking and background selection. Genetics 147, 915‐925. Fu YX, Li WH (1993) Statistical tests of neutrality of mutations. Genetics 133, 693‐709. th 148 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Iso Touru T, Kantanen J, Li MH, Gizejewki Z, Vilkki J (2009): Divergent evolution in the cytoplasmic domains of PRLR and GHR genes in Artiodactyla. BMC Evolutionary Biology 9, 172. Kimeć M, Dvorak J, Vrtkova I (2002): Study on a relation between estrogen receptor (ESR) gene polymorphism and some pig reproduction performance characters in Polish Landrace breed. Czech Journal Of Animal Science 47, 189‐193. Kuiper GG, Enmark E, Pelto‐Huikko M, Nilsson S, Gustafsson JA (1996): Cloning of a novel receptor expressed in rat prostate and ovary. Proceedings of The National Academy Of Sciences Of The United States Of America 93, 5925‐5930. Leader, JE, Wang C, Fu M, and Pestell RG (2006): Epigenetic Regulation of Nuclear Steroid Receptors. Biochemical Pharmacology 72, 1589‐1596 Merchenthaler I, Lane MV, Numan S, Dellovade TL (1997): Distribution of estrogen receptor alpha and beta in the mouse central nervous system: in vivo autoradiographic and immunocytochemical analyses. Journal of Comparative Neurology 388, 507‐525. Munoz G, Ovilo C, Estelle J, Silio L, Fernandez A, Rodriguez C (2007): Association with litter size of new polymorphisms on ESR1 and ESR2 genes in a Chinese‐European pig line. Genetics Selection Evolution 39, 195‐206. Noguera JL, Varona L, Gomez‐Raya L, Sanchez A, Babot D, Estany J, Messer LA, Rothschild M, Perez‐Ensico M (2003): Estrogen receptor polymorphism in Landrace pigs and its association with litter size performance. Livestock Science 82, 53‐59. Osterlund M, Kupier GG, Gustaffson JA, Hurd YL (1998): Differantial distribution and regulation of estrogen receptor‐alpha and –beta mRNA within the female rat brain. Molecular Brain Research 54, 175‐180. Pauline CN, Henikoff S (2003): SIFT: prediciting amino acid changes that affect protein function. Nucleic Acid Research 31, 3812‐3814. Petterson K, Gustafson JA (2001): Role of estrogen receptor β in estrogen action. Ann. Rev. Physiol 63: 165‐192. Rotschild M, Jacobson C, Vaske D A , Tuggle C K, Wang L, Short T, Eckardts G R, Sasaki S, Vincent A, McLaren D, Southwood O I, van der Steen H, Mileham A J, Plastow G S. (1996). The estrogen receptor locus is associated with a major litter size in pigs. Proc Natl acad Sci 93:201‐205. Rozas J, Sanchez DelBario JC, Messeguer X, Rozas R (2003) DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, 2496‐ 2497. Short TH, Rothschild F, Southwood O I, McLaren D, de Vries A, van der Steen H, Eckardts G R, Tuggle C K, Helm J, Vaske D A, Mileham A J, Plastow G S (1997). Effect of the estrogen receptor locus on reproduction and production traits in four commercial pig lines. J Anim Sci 75: 3138‐3142. Szreder T and Zwierzchowski L.(2004‐a). RFLP‐ TspRI polymorphism within exon 1 of the bovine estrogen receptor‐α (ER‐α) gene. Animal Science Papers and Reports 22: 543‐549. Szreder T and Zwierzchowski L.(2004‐b) Polymorphism within the bovine estrogen receptor α gene 5’‐region. J. Appl. Genet. 45(2): 225‐236. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585‐589. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596‐1599. Wang H, Masironi B, Erikson H, Sahlin L. (1999). A comparative study of estrogen receptors α and β in the rat uterus. Biol Reprod 61:955‐964 Wang X, Wang A, Fu J, Lin H. (2006). Effects of ESR1, FSHB and RBP4 genes on litter size in a Large White and Landrace Herd. Arch Tierzucht 49: 64‐70. Xiao‐ Dan B, Ming‐Xing C, Hai‐Guo J, Li F, Su‐Cheng Y. (2005). Estrogen receptor as a candidate gene for prolificacy of Small Tail Han sheep. Acta Genetica Sinica.32: 1060‐1065. CERTAIN CARCASS AND MEAT QUALITY CHARACTERISTICS OF ANATOLIAN WATER BUFFALOS A. YILMAZ1*, B. EKİZ1, M.İ. SOYSAL2, İ. YILMAZ3, H. YALÇINTAN1 1 Istanbul University, Veterinary Faculty, Department of Animal Breeding and Husbandry Avcılar, 34320, Istanbul, Turkey 2 3 Namık Kemal University, Agricultural Faculty, Department of Animal Science, Tekirdağ, Turkey Namık Kemal University, Agricultural Faculty, Department of Food Engineering, Tekirdağ, Turkey * Corresponding author: yalper@istanbul.edu.tr Abstract: In the study, ten male and ten female Anatolian Water Buffalos were used. The carcass quality characteristics and the meat quality characteristics in M. longissimus dorsi samples which were aged for two different durations (7 and 21 days) were investigated comparatively. Hot carcass weights of male and female Anatolian Water Buffalos were 325.4 kg and 288.2 kg, respectively. Carcass lengths were higher (P<0.05) in females, where leg lengths were higher (P<0.01) in males. The effects of sex on water holding capacity, cooking loss and shear force in samples of M. longissimus dorsi were not significant (P>0.05). Meat samples aged for 21 days had less water loss (P<0.05), less cooking loss (P<0.01) and less shear force value (P<0.01) than samples aged for 7 days. The colour lightness results of meat samples aged for longer were higher than samples aged for 7 days. The meat of female Anatolian Water Buffalos was darker than males. There were not significant differences between male and female Anatolian Water Buffalos in terms of sensory evaluation scores (P>0.05). Keywords: Anatolian Water Buffalo, carcass quality, meat quality, aging duration Introduction Water buffalos are being used as draught animals in rural places in underdeveloped countries. Moreover, meat, milk and products of water buffalos are among the main protein sources of the poor breeders and providing a significant income for the rural economy (Borghese, 2005). Water buffalo breeding is providing 5% of the total milk production in the world (Atasever and Erdem, 2008). In the last thirty years the water buffalo population in the world is decreasing (Georgoudis et al., 1998). The water buffalo population and the amount of production from water buffalos in Turkey is also decreasing. The number of water buffalos in Turkey was 544 831 in 1985 (FAO, 2009) and it decreased to 86 297 in 2008 (TUİK, 2009). The water buffalos in Turkey are named as Anatolian Water Buffalo and they are among Mediterranean Water Buffalos which are subgroup of river buffalos (Soysal et al., 2005). They are mostly bred in Samsun and Sinop in North Anatolia sea shore; in Çorum and Amasya in Middle Anatolia; in Afyon and Balıkesir in Inner West Anatolia; in Sivas and Muş in East Anatolia and in Diyarbakır in Southeast Anatolia (Atasever and Erdem, 2008). In Turkey water buffalos are particularly bred for milk production and they are slaughtered for meat production after they finish their productive ages (Şekerden, 2001). The cream produced from Anatolian Water Buffalo milk is a popular product which is consumed together with many local desserts (Soysal et al., 2005). In some regions, Anatolian Water Buffalo milk is also used for cheese production. Anatolian Water Buffalo meat is consumed as fresh or in meat products like Turkish style fermented sausage, pastrami and salami. In the recent years there has been a rise in the production for only meat. Anatolian Water Buffalo meat is more commonly used in Turkish sausage as it decreases the fermentation duration and is believed to give taste. The rise in the education levels and life standards causes changes in the consumption habits. Parallel to the improvements in socioeconomic status the consumption of products of animal origin th 150 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) and people’s attitude towards quality animal products increase. Among the most significant factors determining quality in meat and meat products and therefore consumer approval are the colour of meat and hygiene conditions at the point of purchase, the cooking loss at cooking and the tenderness (texture) of meat at consumption (Murray, 1995; Vergara ve Gallego, 1999; Warris, 1995). The meats having dark meat colour and yellow fat colour are considered as meats from older animals, tough, tasteless and with lower aroma (Özdoğan et al., 2004). Therefore meats with dark colour are marketed harder and at lower prices. In some regions in Turkey, Anatolian Water Buffalo breeding is a traditional production model which has great importance in the economy and culture of its breeders. However, the studies carried out to determine and improve the production characteristics of Anatolian Water Buffalos are very limited. Particularly there was not a study to determine the meat quality characteristics of Anatolian Water Buffalos. Therefore, there is a need for studies investigating the carcass and meat quality characteristics of Anatolian Water Buffalos. In this study, it was aimed to determine the carcass and meat quality characteristics of Anatolian Water Buffalo which is a significant indigenous genetic resource of Turkey. Moreover, the effects of gender and two different aging durations (7 and 21 days) on slaughter, carcass and meat quality characteristics of Anatolian Water Buffalos were also investigated. Materials and Methods The animals used in the study were a total of 20 (10 male and 10 female) indigenous Anatolian Water Buffalos at the age of 2‐2.5 years. They were selected among the Anatolian Water Buffalos which were bred in a private farm (Coşkun Fattening Farm) and brought to the slaughterhouse (Coşkun Slaughterhouse). In the fattening period of Anatolian Water Buffalos the routine housing and feeding programme of the private farm was practiced and no other application in terms of the research was carried out. During the slaughter of the Anatolian Water Buffalos the standard procedure of the private slaughter house was applied. Each Anatolian Water Buffalo was identified during slaughter and the numbered papers were stuck in the carcasses so as to identify the carcasses. Each carcass was weighted to record the carcass weight. In order to decide for the Anatolian Water Buffalo carcasses to be used in the study the carcass weight means of 61 male and 37 female Anatolian Water Buffalos were taken into consideration. 10 male and 10 female carcasses which had the closest carcass weight to their gender group carcass weight means were chosen to be investigated in the study. After slaughter the internal organs were removed and hot carcass weights were recorded. In the study, carcass length, chest depth, leg length, leg width measurements; carcass conformation and fatness scoring according to EUROP system; M. longissimus dorsi section area and back fat thickness measurements between 12th and 13th ribs; fat colour measurements between 12th and 13th ribs at 12‐15 cm lateral of median line were measured. To investigate the meat quality characteristics, pH measurements were made between 12th and 13th ribs in M. longissimus dorsi; meat colour (L*, a*, b* coordinates), water holding capacity, shear force, cooking loss measurements and sensory panel evaluation samples were collected from longissimus dorsi muscle between 7th to 12th ribs. In the study, colour, water holding capacity, shear force and cooking loss measurements were made for both aging durations for 7 and 21 days. In order to determine meat quality characteristics the procedures below were fallowed: Certain Carcass and Meat Quality Characteristics of Anatolian Water Buffalos 151 a. Measurement of water holding capacity (WHC): In order to measure water holding capacity (WHC) modified Grau and Hamm method described by Briain et al. (2000) was applied. From the meat samples without fat, 6‐8 tiny meat strips weighting about 5 g were cut parallel to the muscle fibres. The weights of two filter papers to be used for the analyses were recorded. 5 g of the cut tiny meat strips were weighted and put between the two filter papers. The filter papers were placed between the glass petri plates and a pressure of 2250 g weight was applied for 5 min. After 5 min the weight was removed, meat samples were taken from the filter papers and the filter papers were weighted. After these procedures WHC was calculated by the formula below: WHC (%) = (Filter paper last weight ‐ Filter paper initial weight) / Meat sample weight × 100 b. Measurement of meat colour: To measure meat colour a chromometer (Minalto CR400) measuring with L*, a*, b* coordinate system was used. In measurements with this system three basic colour parameter (L*= lightness, a*= redness colour coordinate, b*= yellowness colour coordinate) are determined numerically. In the measurements the standards reported by CIE (1976) were applied and D65 was chosen as light source. In each measurement day the chromometer was calibrated according to white plate (Y= 93.8, x=0.316, y=0.3323). Chromometer was adjusted to make three measurements in each order and to give the average means of these measurements. In each colour measurement time, 3 measurements with 3 repeats (a total of 9 measurements) by choromemeter from unfatty parts of cut section of each meat sample were collected and the means calculated by these measurements were recorded as colour parameter measurement result. The meat samples cut 3 cm thick for colour measurements were packaged under vacuum and aged (for 7 or 21 days). At the end of aging duration, 2 cm thick samples were cut and they were placed in plates by the cut surface facing upwards. Colour measurements for 2 times, 1h and 24h after cutting were recorded from these samples. During this period the meat samples were kept at 4oC and under continuous white light. c. Measurement of cooking loss: In order to measure cooking loss the meat samples from M. longissimus dorsi were firstly weighted and then were vacuumed and aged (7 days or 21 days) at 4oC. After aging meat samples were cooked in a water bath at 75oC for 60 min. At the end of this application the samples were removed from the water bath and were cooled for 60 min under running water. Then the meat samples were removed from the packages, dried with paper towels and weights after cooking were measured. Cooking loss (%) was estimated by means of percentage of weight loss of the cooked sample to initial sample weight (Honikel, 1998). d. Texture analyses: In terms of texture analyses, Instron 3343 equipped with a Warner Bratzler (WB) blade was used. The force applied to meat with Instron machine was 50 kg and the speed of blade was 200 mm/min. Cooked samples for the measurement of cooking loss were used for texture analyses. Six sub‐samples cut parallel to the muscle fibres with a cross section of 1×1 cm were removed from each cooked sample. The peak shear force measured and force time graphic were recorded by the computer. An average of six sub‐samples was accepted to be the peak shear force value of that sample. th 152 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) e. Sensory panel: The M. Longissimus dorsi samples collected for sensory panel evaluation were frozen and stored at ‐18oC until panel evaluation. One day prior to each panel session, frozen samples were taken out of the freezer and thawed at 4oC for 24 h. Samples were folded in aluminium folio and cooked in an electrical oven at 175oC until the internal temperature reached 80oC. Internal temperatures of samples were monitored with a Testo 177‐T4 data logger equipped with thermocouples placed in geometric centre of each sample. Each cooked sample was cut into 7 subsamples (approximately 1×1×1 cm dimensions) and stored at 60oC in another oven until they were served to panellists. Sensory characteristics of cooked samples were assessed by using an eight point category scale (Sanudo et al., 1998). Seven semi‐trained panellists were in charge of the assessment. In the sensory panel evaluation: scale 1 = non odour, extremely tough, extremely dry, no flavour, dislike extremely flavour and dislike extremely; scale 8 = very strong odour, extremely tender, extremely juicy, very strong flavour, like extremely flavour and like extremely. Statistical methods: In order to determine the effect of gender on carcass quality characteristics independent sample t‐test was used. To calculate the effects of gender (male and female) and aging duration (7 and 21 days) on instrumental meat quality characteristics GLM procedure was applied. In the model used for statistical analyses gender (male and female), aging duration and gender × aging duration interaction were used as fixed effects. The model used in the analyses of sensory characteristics included the fixed effects of gender, panellist, panel session and also significant two‐way interactions between these main effects. Results and Discussion Means and statistical significance controls for hot carcass weight, certain carcass measurements, carcass pH and back fat colour parameters for male and female Anatolian Water Buffalos are presented in Table 1. Male Anatolian Water Buffalos had higher hot carcass weight (P<0.001), leg length (P<0.01) and fat lightness (P<0.05) than female ones. Carcass length was higher (P<0.05) in female Anatolian Water Buffalos than males. Ultimate pH was lower (P<0.001) in females than males. On the other hand there were not significant differences (P>0.05) between male and female Anatolian Water Buffalos in terms of chest depth, leg width, conformation and fatness scores, back fat thickness, back fat redness and yellowness results. These results indicate that although male Anatolian Water Buffalo carcasses were heavier, they were not fattier than females and leg production of males were higher than females. Dark yellow fat colour is not desired by consumers (Kerth et al., 2007; Özdoğan et al., 2004). In the present study, in terms of yellowness colour coordinate, the results of male and female Anatolian Water Buffalos were lower than back fat yellowness results in cattle carcasses (Karth et al., 2007) and could be classified as light yellow. It can be evaluated that the back fat colour of Anatolian Water Buffalos will not have a negative effect on the preference of the consumers. Least square means and statistically significance controls of water holding capacity (WHC), cooking loss, shear force and meat colour parameters (L*, a*, b*) of M. longissimus dorsi samples aged for different durations (7 and 21 days ) in male and female Anatolian Water Buffalos are presented in Table 2. The effects of gender on WHC, cooking loss and shear force were not statistically significant (P>0.05). There were not significant differences (P>0.05) between male and female Anatolian Water Buffalos in terms of meat colour yellowness coordinates. On the other hand, M. longissimus dorsi meat samples of female Anatolian Water Buffalos had lower meat lightness (P<0.001 at 1h and 24 h after cutting) and higher redness values (P<0.05 at 1h after cutting, P<0.001 at 24 h after cutting) than male ones. These results indicate that meat samples from female Certain Carcass and Meat Quality Characteristics of Anatolian Water Buffalos 153 Anatolian Water Buffalos were darker than samples from males. Similarly various researchers reported that female cattle had darker meat colour than males (Fimes et al., 2003; Wulf et al., 1997). Table 1. Means and standard errors (SE) for certain carcass quality characteristics of male and female Anatolian Water Buffalos Male Characteristics Female Sig. Mean SE Mean SE Hot carcass weight, kg 325.40 2.65 288.20 5.99 *** Carcass length, cm 127.07 1.00 132.16 1.93 * Chest depth, cm 45.37 0.43 46.26 0.60 NS Leg length, cm 72.62 1.30 67.87 0.84 ** Leg width, cm 29.96 0.65 28.99 0.61 NS Conformation score 5.20 0.42 5.50 0.40 NS Fatness score 7.70 0.47 7.30 0.68 NS Backfat thickness, cm 19.84 1.69 19.77 2.06 NS Lightness (L*) 64.00 1.04 60.03 0.96 * Redness (a*) 6.14 0.49 7.01 0.89 NS Yellowness (b*) 7.03 0.63 7.08 0.59 NS pHu 5.49 0.01 5.44 0.01 *** Fat colour parameters NS= Not significant (P>0.05). *=P<0.05; **=P<0.01; ***=P<0.001. At the point of purchase of meat at market, a number of factors including price, sensory quality, product safety and nutritional quality are taken into consideration by consumers. Although appearance and colour are the most important quality characteristics at selection of product, consumer judgements may also be influenced by any negative quality attributes such as excessive leakage of fluid into the pack (Mead, 2004). In the present study aging duration significantly affected WHC and cooking loss of M. longissimus dorsi samples. By increasing aging duration form 7 to 21 days water loss decreased (P<0.05) (therefore water holding increased) and cooking loss decreased (P<0.01). Tenderness level of meat samples influence the appreciation of consumer during the eating phase (Mead, 2004). In the current study, the shear force results of Anatolian Water Buffalo meat samples aged for 21 days were lower and so were softer than the ones aged for 7 days (P<0.01) The colour of meat is used to judge the freshness and quality of meat by consumers at the point of purchase at market (Mead, 2004). In the present study, Anatolian Water Buffalo meat samples aged for longer durations had higher L* results (lighter meat colour) (P<0.05 at 1 h after cutting, P<0.01 at 24 h after cutting) and lower yellowness results at colour measurements 24 h after cutting (P<0.001). These results indicate that by aging Anatolian Water Buffalo meat for 21 days rather than for 7 days, an improvement in meat quality parameters like meat tenderness, water holding capacity and meat colour could be achieved. Similar to the results of the current study many researchers found that by aging cattle (Oliete et al., 2005; Sierra et al., 2010) and water buffalo (Irurueta et al., 2008) meats for longer durations meats with more tenderness, higher water holding capacity and higher lightness could be produced. In the present study the effects of gender and aging duration interactions on investigated meat quality characteristics were not significant (P>0.05). This result shows that the positive results of aging for 21 days rather than 7 days on meat quality characteristics are similar for both male and female Anatolian Water Buffalos. th 154 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. Least‐squares means for meat quality characteristics of Anatolian Water Buffalos due to gender and aging duration Aging Duration (AD) Gender (G) Characteristics Male Female 7‐day 21‐day WHCa, % 9.81 9.98 10.57 9.23 Cooking loss, % 27.40 27.93 28.84 Shear force, kg 3.26 3.18 Lightness (L*)1h 39.33 Redness (a*)1h Yellowness (b*)1h Significance SEM G AD G × AD 0.284 NS * NS 26.49 0.336 NS ** NS 3.54 2.90 0.095 NS ** NS 36.49 37.35 38.48 0.257 *** * NS 21.78 22.98 21.29 23.47 0.281 * *** NS 7.48 7.56 7.30 7.74 0.189 NS NS NS Lightness (L*)24h 40.87 38.23 38.82 40.29 0.215 *** ** NS Redness (a*)24h 23.99 25.89 25.30 24.58 0.262 *** NS NS Yellowness (b*)24h 7.84 7.91 8.90 6.85 0.198 NS *** NS Colour parameters at 1 h Colour parameters at 24 h a WHC=Water holding capacity NS= Not significant (P>0.05). *=P<0.05; **=P<0.01; ***=P<0.001. Table 3. Means and standard errors (SE) for sensory characteristics of male and female Anatolian Water Buffalos Male Characteristics Female Sig. Mean SE Mean SE Odour intensity 4.54 0.12 4.53 0.12 NS Tenderness 4.67 0.12 4.68 0.12 NS Juiciness 4.29 0.12 4.23 0.12 NS Flavour intensity 4.87 0.12 4.96 0.12 NS Flavour quality 4.79 0.12 4.79 0.12 NS Overall acceptability 4.66 0.12 4.69 0.12 NS NS : Not significant (P>0.05). The cooking loss results (26.49‐28.84%) in the meat samples of Anatolian Water Buffalos in the current study were similar to the reported results of studies with similar cooking method and temperature on cattle meat samples (Kim and Lee, 2003; Olieta et al., 2005). According to the reports of Shackelford et al. (1991), meat samples having Warner Bratzler shear force values exceeding 5.5 kg would be evaluated as tough by a trained sensory panel and by consumers. Moreover, Bickerstaffe et al. (2001) noted that shear force values of cooked meat samples accurately reflects the consumer perception of tenderness, and meat samples classified as “very tender” by consumers had mean shear force value of 5.1 kg. In the current study, WB shear force values found for longissimus dorsi muscles of Anatolian Buffalos (2.90 – 3.54 kg) were quite Certain Carcass and Meat Quality Characteristics of Anatolian Water Buffalos 155 lower than levels specified in above references. Hence, meat of Anatolian Buffalos might be considered to be very tender meat. The sensory evaluation scores given by panellists and significance controls of results for male and female Anatolian Water Buffalo meat samples are presented in Table 3. There were not significant differences (P>0.05) between male and female Anatolian Water Buffalo meats in terms of odour intensity, tenderness, juiciness, flavour intensity, flavour quality and overall acceptability. The results that there were not significant differences between male and female Anatolian Water Buffalos for tenderness and juiciness were in accordance with instrumental shear force and WHC results (Table 2). Supporting the results of the current study Kandeopen et al. (2009) found the differences in flavour and juiciness characteristics in male and female water buffalos not significant. Similarly, the effects of gender on sensory characteristics of cattle were not found significant on flavour, juiciness and tenderness by Marti et al. (2011) and on flavour and juiciness by Wulf et al., (1997). Conclusions The results in the current study show that male Anatolian Water Buffalos yielded heavier carcasses and higher leg lengths whereas there were not significant differences between male and female Anatolian Water Buffalo carcasses in terms of carcass conformation and fatness scores, back fat thickness and back fat yellowness results. There were not also significant differences for investigated meat quality characteristics between male and female Anatolian Water Buffalos other than meat colour. Female Anatolian Water Buffalos had darker meat colour than males. Moreover, it was concluded that Anatolian Water Buffalo meats with more tenderness, higher lightness and higher water holding capacity could be produced by aging for 21 days rather than for 7 days. REFERENCES Atasever, S., Erdem, H. (2008). Manda yetiştiriciliği ve Türkiye’de ki geleceği. OMÜ Ziraat Fakültesi Dergisi, 23:1, 59‐64. Beriain, M. J., Horcada, A., Purroy, A., Lizaso, G., Chasco, J., & Mendizabal, J. A. (2000). Characteristics of Lacha and Rasa Aragonesa lambs slaughtered at three live weights. Journal of Animal Science, 78, 3070‐3077. Bickerstaffe, R., Bekhi, A.E.D., Robertson, L.J., Roberts, N., Geesink, G.H. (2001). Impact of introducing specifications on the tenderness of retail meat. Meat Science, 59, 303‐315. Boghese, A. (2005). Buffalo production and research. REU technical series 67, FAO regional office for Europe Inter‐Regional Cooperative Research Network On Buffalo (Escorena), Rome. CIE (1976). Centre Internationale de L’Eclairage, Definition dun space de coleur por deux coordonees de cromaticite et la luminosite. Supplement 2 to CIE publication no 15 (E‐1‐3‐1) 1971/ (TC‐1‐3). Cente Internationale de L’Eclairage, Paris. FAO, (2009). www.fao.org, (erişim tarihi: 12.05.2009). Fiems, L.O., De Campeneere, S., Van Caelenbergh, W., De Boever, J.L., Vanacker, J.M. (2003). Carcass and meat quality in double‐muscled Belgian Blus bulls and cows. Meat Science, 63, 345‐352. Georgoudis, A.G., Papanastasis, V.P., Boyazoğlu, J.G. (1998). Use of Water Buffalo for Environmental Conservation of Waterland. Review. Symposium VIII. Entitled “Role of Water Buffaloes in Producing th Foods” of the 8 World Conference on June 30, 1998 at Seoul National University, Seoul, Korea Honikel, K.O. (1998). Reference methods for the assessment of physical characteristics of meat. Meat Science, 49, 447‐457. Irurueta, M., Cadoppi, A., Langman, L., Grigioni, G., Carduza, F. (2008). Effect of aging on the characteristics of meat from water buffalo grown in the Delta del Paraná region of Argentina. Meat Science, 79, 529‐533. Kandeepan, G., Anjaneyulu, A.S.R., Kondaiah, N., Mendiratta, S.K., Lakshmanan, V. (2009). Effect of age and gender on the processing characteristics of buffalo meat. Meat Science, 83, 10‐14. th 156 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Kerth, C.R., Braden, K.W., Cox, R., Kerth, L.K., Rankins, D.L. (2007). Carcass, sensory, fat color, and consumer acceptance characteristics of Angus‐cross steers finished on ryegrass (Lolium multiflorum) forage or on a high‐concentrate diet. Meat Science, 75, 324‐331. Kim, C.J., Lee, E.S. (2003). Effects of quality grade the chemical, physical and sensory characteristics of Hanwoo (Korean native cattle) beef. Meat Science, 63, 397‐405. Marti, S., Realini, C.E., Bach, A., Pérez‐Juan, M., Devant, M. (2011). Effect of vitamin A restriction on performance and meat quality in finishing Holstein bulls and steers. Meat Science, doi: 10.1016/j.meatsci.2011.05.003. Mead G.C: Meat quality and consumer requirements. In Mead GC (Ed) Poultry Meat Processing and Quality, pp.1‐18, CRC Press, Cambridge, 2004. Murray, A.C. (1995). The Evaluation of Muscle Quality. in: Quality and Grading of Carcasses of Meat Animals, CRC press, Inc. London, Pp: 83‐108. Oliete, B., Moreno, T., Carballo, J.A., Varela, A., Monserrat, L., Sánchez, L. (2005). Influence of ageing time on the quality of yearling calf meat under vacuum. Eur Food Res. Technol., 220, 489‐493. Özdoğan, M., Önenç, A., Önenç, S.S., Köknaroğlu, H. (2004). Sığır Eti Kalitesi Üzerine Beslemenin Etkisi, 4. Ulusal Zootekni Bilim Kongresi, Isparta. Sañudo, C., Nute, G. R., Campo, M. M., María, G., Baker, A., Sierra, I., et al. (1998). Assessment of commercial lamb meat quality by British and Spanish taste panels. Meat Science, 48, 91‐100. Shackelford, S.D., Morgan, J.B., Cross, H.R., Savell, J.M. (1991). Identification of threshold levels for Warner‐ Bratzler shear force in beef top loin steaks. J Muscle Foods, 2, 289‐296. Sierra, V., Guerrero, K., Fernández‐Suárez, V., Martinez, A., Castro, P., Osoro, K., Rodriguez‐Colunga, M.J., Coto‐ Montes, A., Oliván, M. (2010). Eating quality of beef from biotypes included in the PGI “Ternera Asturiana” showing distinct physicochemical characteristics and tenderization pattern. Meat Science, 86, 343‐351. Soysal, İ., Özkan, E., Kök, S., Tuna, Y.T., Gürcan, E.K. (2005). Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers. Tekirdağ Ziraat Fakültesi Dergisi, 2:3, 240‐244. Şekerden, Ö. (2001). Büyükbaş Hayvan Yetiştirme (Manda Yetiştiriciliği). Temizyürek Ofset Matbaacılık, 296 s.: 1‐ 12. Hatay. TÜİK (2009). T.C. Başbakanlık Türkiye İstatistik Kurumu, Hayvansal Üretim 2008, Sayı 83, 14 Mayıs 2009. Vergara, H., Gallego, L. (1999). Effect of type of suckling and length of lactation period on carcass and meat quality in intensive lamb production systems. Meat Science, 53, 211‐215. Warriss, P.D. (1995). Antemortem Factors Influencing the Yield and Quality of Meat from Farm Animals. In: Quality and Grading of Carcasses of Meat Animals, CRC press, Inc. London, 1‐13. Wulf, D.M., O’Connor, S.F., Tatum, J.D., Smith, G.C. (1997). Using objective measures of muscle color to predict beef longissimus tenderness. J. Anim. Science, 75, 684‐692. THE RELATIONSHIPS BETWEEN MILK CONSTITUENTS AND VARIOUS MILK PROPERTIES IN ANATOLIAN BUFFALOES Ö.ŞEKERDEN1*, Y.K. AVŞAR2 1 Mustafa Kemal Univ. Fac. of Agric. Dept. of Anim. Sci., Antakya, Turkey 2 Mustafa Kemal Univ. Fac. of Agric. Dept. of Food Engineering, Antakya, Turkey * Corresponding author: sekerden@mku.edu.tr Abstract The objectives of this study were to investigate the relationships among milk composition, renneting time, urea concentration, acidity, density and pH of Anatolian Buffaloes’ milk. As a total of 115 individual milk samples from 53 Anatolian buffalo cows that calved in 2004 and 2005 on days of their lactations 30±15, 60±15, 90±15, 120±15, 150±15, 180±15., 210±15, 240±15 and 270±15 in 8 units of Ilıkpınar village were collected in morning milkings for June, September, December and March. Samples were analysed for total dry matter, fat, protein, ash, density, pH, acidity, renneting time and urea content. Data were classified according to the following environmental factors: lactation stages: 1 (30±15, 60±15, 90±15 days): 2 (120±15, 150±15, 180±15 days): 3 (210±15, 240±15, 270±15 days); calving year: 1 (2004), 2 (2005); calving season: 1 (January‐May), 2 (September and October); month of samples collection: 1 (June), 2 (September), 3 (December), 4 (March); lactation order: 1 and 2 : 1, 3 and 4: 2, 5 and 6: 3. Means and correlation coefficients for the characteristics investigated were calculated. Keywords: Anatolian buffalo, milk, coagulation, urea Introduction It is a well established fact that reducing protein concentration (80 gr/kgFCM and lower) diminishes milk yield and its fat percentage (Wohlt and Clark, 1978, Teller et al, 1983) and that increasing milk yield leads to a decrease in milk fat and protein concentrations (Sethi et al, 1994, Şekerden et al, 1999). Milk coagulation properties (rennet coagulation time, firming time and firmness of clot) are well known important criteria for cheese production. These properties (rennettability) can be affected by genotype (Ikoneen, 2000, Povinelli et al, 2003) season, lactation order, lactation stage and feeding (Kreuzer et al, 1996). Moreover, they change throughout the lactation depending on milk yield, protein and fat concentrations. These properties are found best at the beginning and the end of lactation. Piironeen et al. (1992) reported that protein content affected milk coagulation considerably, which increased as the lactation stages progressed, and that any negative alterations in milk composition had a clear effect on milk coagulation time. Milk coagulation properties also differ significantly from one unit to another. It is most likely that differences are due to feeding and management factors (Ikoneen, 2000). Povinelli et al. (2003) found that titratable acidity and protein content had a significant effect on milk coagulation ability. pH has a negative influence on milk coagulation ability and the effect increases to a significant degree as lactation progresses (Piironen et al, 1992). Milk urea concentration can be used as a tool to monitor crude protein and energy intake (Broderick and Clayton, 1997). It is related to the rate of protein‐energy in ration and crude protein intake (Roseler et al, 1993, Baker et al, 1995). In order to use milk urea concentration as a tool to identify any imbalances related to feeding, food intake and ration composition together with other factors and levels of their effect have to be determined and taken into consideration while interpreting urea concentration (Hojman et al, 2005). These factors can be ordered as follows: sample collection season, analyze method used, live weight of animal, parity and milk yield of cow (Rajala‐Schultz and Saville, 2003). Roy et al. (2004) reported that milk urea concentration increased th 158 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) significantly in Murrah Buffaloes as the control day milk yield increased. As the lactation number increased, a significant reduction occurred in milk urea concentration. However, lactation stage did not have significant effects on urea and protein concentrations of milk. The objectives of this study were to investigate relationships among milk composition, renneting time, urea concentration, acidity, density and pH of Anatolian Buffaloes milk. Material and Methods The material of the study were formed by 115 milk samples from 53 Anatolian buffalo cows of Ilıkpınar Village of Kırıkhan District of Hatay Province in 8 units that calved in 2004 and 2005. Milk samples were collected from the morning milkings for June, September, December and March. The cows were on 30±15, 60±15, 90±15, 120±15, 150±15, 180±15, 210±15, 240±15 and 270±15 days of their lactations. Samples were analysed for total dry matter, fat, protein, ash contents, pH, density, rennetting time and milk urea content. Protein and fat contents were determined by Formol Titration (James, 1998) and Gerber Methods (Kurt, 1984) respectively. Rennet coagulation time was determined by recording time from the addition of enzyme to milk to appeareance of first clot using Berridge Method (Koçak and Devrim, 1994). Milk urea content determined with diacetyl monoxime by Photometric Method, as described in Merck handbook (Anonymous, 2005). The means and correlation coefficients of the characteristics were calculated. SPSS programme (standard version, SPSS Inc.) were used in the statistical analysis. Results Correlation coefficients between milk yield and milk constituents contents are given in Table 1. Relationships among the rennet coagulation time with composition, pH, density, titratable acidity and urea content of milk are shown in Table 2a and Table 2b. Table 1. Correlation coefficients between milk yield and milk constituent contents. Variables measured Correlation coefficient (r) Morning milk yield Daily milk yield 0.737** TDM % Morning milk yield ‐0.030 “ Daily milk yield ‐0.232* “ Fat % 0.675** “ Protein % 0.660** “ Ash % ‐0.408** Morning milk yield ‐0.028 “ Daily milk yield ‐0.202* “ Protein % 0.596** “ Ash % ‐0.338** Morning milk yield 0.052 Fat % Protein % “ Daily milk yield ‐0.204* “ Ash % ‐0.495** Morning milk yield ‐0.104 Daily milk yield 0.084 Ash % *P <0 .05, **P < 0.01 The Relationships Between Milk Constituents And Various Milk Properties In Anatolian Buffaloes 159 Table 2a. Relationships between various variables Coagulation time Variables Urea content Correlation Variables coefficient Density Correlation Variables coefficient Correlation Coefficient Morning milk yield 0.238* Morning milk yield ‐0.069 Morning milk yield ‐0.138 Daily milk yield 0.038 Daily milk yield ‐0.118 Daily milk yield ‐0.165 TDM % 0.320** TDM % 0.084 TDM % ‐0.247* Fat % 0.293** Fat % ‐0.046 Fat % ‐0.247* Protein % 0.447** Protein % ‐0.058 Protein % ‐0.256* Ash% ‐0.273** Ash % ‐0.143 Ash % 0.210* Density ‐0.049 Density ‐0.015 pH 0.027 pH ‐0.022 pH 0.050 Titratable acidity 0.367** Urea 0.035 Titratable acidity 0.002 Titratable acidity 0.094 *P < 0.05, **P < 0.01 Table 2b. Relationships between various variables Titratable acidity Variables pH Correlation Variables coefficient Correlation Coefficient Morning milk yield ‐0.159 Morning milk yield ‐0.055 Daily milk yield ‐0.323** Daily milk yield 0.127 TDM % 0.171 TDM % ‐0.339** Fat % 0.205* Fat % ‐0.358** Protein % ‐0.029 Protein % ‐0.291** Ash % 0.098 Ash % ‐0.280** pH ‐0.394** *P < 0.05, **P < 0.01 Discussion As can be seen in Table 1, there was a significant relationship between morning and daily milk yields. There are negative significant correlations between daily milk yield with TDM, fat and protein percentages. These result were confirmed by the following literature [protein (Kadecka, 1992; Agabriel et al, 1993; Şekerden, 1999), at (Kadecka, 1992)]. There were negative relationships between TDM with fat and ash contents and positive relationships between fat with protein concentrations and TDM with fat and protein contents. In other words, as ash content increased, TDM content decreased. Fat content was adversely affected by the increase in ash content and the increase in TDM and protein contents positively. Protein content increased as fat and TDM contents increased. However, Roy et al. (Roy and Sirohi, 2004) reported that protein concentration did not change significantly. Milk component concentrations have negative relationships with production characteristics, and changing component contents only by genetic selection is not possible. However, there are significant correlations between milk yield and fat, protein and TDM yields. It suggests that th 160 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) genetic selection has to be directed towards increasing fat, protein and total not fat dry matter yields. Under selection programs in which milk yield is taken into consideration, fat and protein yields also increase, but fat and protein concentrations decrease. As can be seen in Table 2a and Table 2b, as daily milk yield and pH increase, titratable acidity is affected negatively. In parallel to increase in fat rate, titratable acidity rises. In the literature it is reporeted that titratable acidity rises together with a decrease in urea content of milk (Hanus et al, 1994). Whereas feeding level is influencial on the urea content of milk (Hockea, 1985; Erbersdobler and Zucker, 1990). There were significant negative relationships between pH and all of the milk constituents. As pH increased, the amount of milk constituents decreased. Relationship between milk yield and pH was found insignificant. Piironen et al. (1992) reported that protein percentage had a positive effect on pH, and the effect enhanced as lactation stage progressed. Density reduces as TDM, fat and protein contents increase. Similarly, as ash content rises density also increases. Relationships between density with milk yield and pH were not significant. Despite the fact that there is positive correlation between TDM content and density of milk, the negative correlation found in the study was due to increase in fat percentage of TDM content. Time laps from the addition of rennet to the appearance of first clot get longer as TDM, fat and protein percentages increase, whereas as ash content increases it becomes shorter. Likewise, the studies (Kreuzer et al, 1996; Ikoneen, 2000; Povinelli et al, 2003) supported that there were positive relationships between rennet coagulation time with protein and fat contents. Negative alterations related to milk composition were reported to have clear effects on milk coagulation properties and alterations in protein content related to production season result in rennet coagulation properties of milk (Piironen et al, 1992). In this study, relationship between milk coagulation time and pH was not significant. The study (Piironen et al, 1992) supported this findings and state that as lactation stage progressed the effect increased significantly. Relationships between milk urea concentration with none of milk constituents, milk yield, density, pH and titratable acidity were not significant statistically. Correlation between urea content and milk yield was found to be negative and not significant as opposed to the literature (Rajala‐Schultz and Saville, 2003; Roy et al, 2004). REFERENCES Agabriel, C., Coulon, J.B., Marty, G. and Bonaiti, B. (1993) Changes in Fat and Protein Concentrations in Farm With High Milk Production. J. of Anim. Bred. 61: 532. Anonymous (2005) Urea in Milk. http://photometry. Merck.de/servlet/PB/ menu/ 1169740_ePRJ‐MERCK‐EN‐ pcontent_12/content.html, 15.09.2005. Baker, L.D., Ferguson, J.D. and Chalupa, W.(1995) Responses in Urea and True Protein of Milk to Different Protein Feeding Schemes for Dairy Cows. J. Dairy Sci. 78: 2424‐2434. Broderick, G.A.and Clayton, M.C.(1997) A Statistical Evaluation of Animal and Nutritional Factors Influencing Concentrations of Milk Nitrogen. J. Dairy Sci. 80: 2964‐2971. Erbersdobler, H.F. and Zucker, H.(1990) Harnstoffgehalt der Milch‐ein Indicator der Proteinversorgung von Milchkühen Kraftfutter 1: 11‐12. Hanus, O., Malina, F., Kopecky, J., Fedelska, R.and Beranova, A.(1994) Sezonni Kolisani Slozeni Bazenoveho Mleka. Mliekarstvo 25: 36‐37. Hockea, P.(1985) Ursachen der Nachgeburtsverhaltung Beim Rind Zuchtwahl u. Besamung, 108: 34‐36. Hojman, D., Adin, G., Gips, and Ezra, E.(2005) Association Between Live Body Weight and Milk Urea Concentration in Holstein Cows. J. Dairy Sci. 88: 580‐584 Ikoneen, T (2000) Possibilities of Genetic Improvement of Milk Coagulation Properties of Dairy Cows. Academic Dissetation, Univ. Of Helsinki, Dept. of Anim. Sci., Publications: 49. The Relationships Between Milk Constituents And Various Milk Properties In Anatolian Buffaloes 161 James, C.S. (1998) Analytical Chemistry of Foods. Elsevier Publisher, New York. Kadecka, J. (1992) A Higher Content of Protein in Cow’s Milk. Zem Edelsk Fakulta. Çeske Budejovice. Zoot. Rada. 9 141(special issue). Koçak, C. and Devrim, H.(1994) Effect of Heat Procedure on Coagulation Ability of Goat Milks. J of Food, 19: 125‐129. Kreuzer, M., Schulz, J.P., Fry, C. and Abel, H.(1996) Rennet Coagulation Properties of Milk From Cows at Three Stages of Lactation Supplied with Graded Levels of an Antimicrobial Feed Supplement. Milchwissenchaft 51: 243‐247. Kurt, A. (1984) Guide of Analysis Methods of Milk and Milk’s Products. Atatürk. Üniv. Publ. No: 18. Lecture book No: 252. Piironen, T., Ojala, M., Niini, T., Syvaoja, E.L. and Setala, J.(1992) Effects of Milk Protein Genetic Variants and Lactation Stage on Renneting Properties of Bovine Milk. 43rd EAAP Meeting, Madrid, Spain 13‐17 September, 1992; Commission on Cattle Production, Session II. Povinelli, M., Marcomini, D., Zotto, R.D., Gaiarin, G., Gallo, L., Carnier, P.and Casandro, M.(2003) Sources of Variation of Milk Rennet‐Coagulation Ability of Five Dairy Cattle Breeds Reared in Trento Province. Proceedings of IX. World Animal Production Congress, Porto Alegre, Brazil.,24‐31 October 2003. Rajala‐Schultz P.J. and Saville, W.J.A.(2003) Sources of Variation in Milk Urea Nitrogen in Ohio Dairy Herds. J. Dairy Sci. 86: 1653‐1661. Roseler, D.K., Ferguson, J.D., Sniffen, C.J. and Herrema, J.(1993) Dietary Protein Degradability Effects on Plasma and Milk Urea Nitrogen and Milk Nonprotein Nitrogen in Holstein Cows. J. Dairy Sci. 76: 525‐534. Roy, B., Mehla, R.K. and Sirohi, S.K.(2004) Influence of Milk Yield, Parity, Stage of Lactation and Body Weight on Urea and Protein Concentration in Milk Murrah Bffaloes.(http://www.ajas.info/contents/abr/03‐9‐9 htm), 2004. Sethi, R.K., Khatkar, M.S. Kala, S.N. and Tripathi, V.N.(1994) Effect of Pregnancy on Milk Constituents During Later Stages of Lactation in Murrah Buffaloes. Proceedings 4th World Buffalo Congress. San Paolo, Brazil (2): 27‐30. Şekerden, Ö., Erdem, H., Kankurdan, B. and Özlü, B.(1999) Factors Affecting Milk Composition and Changes in Milk Composition with Lactation Stage in Anatolian Buffaloes. Turk. J. Vet.Anim.Sci. 23: 505‐509. Şekerden, Ö (1999) Effects of Calving Season and Lactation Order on Milk Yield and Milk Components in Simmental Cows. Turk. J. Vet. And Anim. Sci. 23: 79‐86. Teller, F., Godeau, J.M. and Lebrun, P.(1983) A Study of Different Nitrogen Supplements for Lactating Cows. Zeitschrift für Tierphysiologie, Tierernahrung und Futtermittelkunde 49: 98‐104. Wohlt, J.E. and Clark, H.J.(1978) Nutritional Value of Urea Versus Performed Protein for Ruminants. I. Lactation of Dairy Cows Fed Corn Base Diets Containing Supplementai Nitrogen from Urea and/or Soybean Meal. J. Dairy Sci. 61: 902‐915 DETERMINATION OF LIVE WEIGHT, DAILY WEIGHT GAINS AND SURVIVAL RATE PROPERTIES IN DIFFERENT TIME OF MORKARAMAN SHEEP GROWN IN LOCAL CONDITIONS S. KOPUZLU1*, E.SEZGİN2, S.YÜKSEL2, Ö. BİBEROĞLU2 N. ESENBUĞA3, A. ÖZLÜTÜRK4, M. BAYRAM5 3 1 Atatürk University Narman Vocational School‐Erzurum 2 East Anatolian Agricultural Research Institute‐Erzurum Atatürk University Agricultural Faculty Animal Science Department‐Erzurum 4 Agriculture and Rural Development Support Agency‐Erzurum 5 Marmara Livestock Research Institute Bandırma‐ Balıkesir *Corresponding author: skopuzlu@atauni.edu.tr ÖZET Bu çalışma, Erzurum İlinde yetiştirilmekte olan Morkaraman Koyun ırkının halk elinde bazı özelliklerini geliştirmek amacıyla yapılmıştır. 2006‐2010 yılları arasında yapılan araştırmada çeşitli dönem canlı ağırlık canlı ağırlık, canlı ağırlık artışı, dölverimi ve yaşama gücü gibi özellikler üzerinde durulmuştur. Araştırmada çeşitli dönem canlı ağırlık canlı ağırlık, canlı ağırlık artışı üzerine cinsiyet, doğum tipi, yıllar ve sürü tipi gibi çevresel etmenlerinin etkileri incelenmiştir. Bu çalışmada genel olarak; mera başına ve mera sonu yaşama gücü oranı sırasıyla %95.6 ve 92.2 olarak bulunmuştur. Doğum, mera başı canlı ağırlık, mera sonu canlı ağırlık, mera başı günlük canlı ağırlık artışı ve mera sonunda günlük canlı ağırlık artışı sırasıyla, 3.5±0.01 kg, 21.4±0.02±0.07 kg, 37.4±0.09 kg, 239±1.33 g, 201±0.78 g olarak bulunmuştur. ABSTRACT This project was carried out to improve some characteristics of Morkaraman Sheep in farming conditions in Erzurum. Between 2006 and 2010 the study focused on traits such as live weight, daily weight gains in different time points, reproductive traits and survival rate. Effects of environmental factors such as gender, birth type, years and flock type on the live weight and daily weight gains in different time points were examined. In this study, in general; survival rate at the beginning of pasture and at the end of pasture were %95.6 and 92.2 respectively. Birth, live weights at the beginning of pasture, live weight at the end of pasture, daily weight gain at the beginning of pasture, daily weight gain at the end of pasture were found 3.5±0.01 kg, 21.4±0.02 kg, 37.4±0.09 kg, 239±1.33 g, 201±0.78 respectively. Keywords: Morkaraman, sheep, live weight, daily weight gains, survival rate INTRODUCTION The sheep stock in Turkey is around 21.8 million according to 2009 data (Anonymous, 2009). Local races constitute the highest share with approximately 97 % among the races making up the sheep population. Morkaraman breed, which comes from fat‐tailed local sheep breeds, makes up an important part of this population (20 %) (Özcan, 1990; Soysal, 2010). Morkaraman sheep, known to have spread mainly across the eastern part of Sivas province, has been grown in Erzurum, Ağrı, Van, Kars and Muş provinces in Eastern Anatolian Region. The sheep breed grown widely in Erzurum city is Morkaraman sheep. th 164 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) As other indigenous breeds of sheep, Morkaraman sheep is also known to breed in an uncontrolled manner in the hands of growers. This leads to a decrease in local sheep breeds and races or an increase in the number of hybrid animals. For this reason, as in all local races, the protection and improvement of genetic material in Morkaraman sheep, the future of genetic improvement and socio‐economic considerations have become one of the most important issues to focus on. Morkaraman is a combined productive sheep breed. It is known to have a lower twin reproduction rate than some other local sheep breeds. In addition, the fat‐tailed structure of this breed is a negative factor reducing the carcass efficiency. The yields such as reproductive performance and growth rate are among the features of the sheep to be improved and they should be given considerable importance. The studies and researches on local sheep race in our country have generally been conducted by public enterprises. The researches intended to determine the overall performance, morphological and physiological characteristics and growing conditions of sheep populations under grower conditions will be of great importance in introducing more effective livestock development policies. Without a clear definition of conditions in rural enterprises and the performance of our sheep under these conditions, effective breeding programs cannot be scheduled. In carrying out these policies efficiently and developing the country’s sheep growing sector, the outcomes of such studies make up the most important stage. In addition to examination and evaluation of traditional sheep growing substructure in different areas, researches intended to describe and develop local sheep populations are of significant importance (Karaca et al., 1996). This project aimed to launch the breeding practices to be carried out by growers by determining the characteristics of this race under grower conditions in Erzurum city, and supply the sheep growers in the region with superior quality breeding sheep and rams. In addition, the project intended to create registered Morkaraman flocks owned by local people and promote the establishment of race‐specific growing union. Moreover, the project also aimed to make a breeding sheep and ram selection based on performance test under current conditions in flocks owned by sheep growers in Erzurum and then improve the growth characteristics, thus increase the reproductive performance and the income per sheep. Material and Method A total of 5592 Morkaraman sheep owned by 42 growers in 19 villages in Erzurum province made up the animal material of the study. 5339 of the total sample were sheep and 253 were rams.Three different flocks were created in the project: base, medium and elite. The base flock (breeding flock) included 4542 sheep, the medium flock included 735 sheep and the elite flock had 315 sheep. Elite, medium and base flocks were established by making a selection from appropriate growers in Erzurum province. Records: Live weight control in different periods Plastic number labels were fitted on both ears of the sheep. The lambs were weighed on a 100 g sensitive scale within 24 hours following the birth. The following features were recorded: weight of the lambs, the ear number of the mother, date of birth, age of mother, birth method, gender of the lambs, mating period, birth, weaning or beginning of pasture season, end of pasture season, live weight at the beginning of pasture season, the number of animals at the end of pasture season and those reaching one year. The number of lambs born per ewe mated, twin reproduction rate, survival between beginning and end of pasture season and the live weight gains during these periods were determined. Determination Of Live Weight, Daily Weight Gains And Survival Rate Properties In Different Time Of Morkaraman Sheep Grown In Local Conditions 165 a) Results regarding the introduction of rams and lambing Twin reproduction rate (%)= twin lambing sheep / lambing sheep The number of lambs per ewe mated (Fecundity) = Lambs born / ewe mated The number of lambs per lambing sheep (Litter size) = Lambs born / lambing sheep b) Results regarding the growth Survival rate (%) = Lambs at the beginning of pasture season/ lambs born Survival rate (%) = Lambs at the end of pasture season / lambs born Statistical Analysis The data obtained from the records of the growers and the controls carried out in the scope of the project were statistically analyzed using SAS (1999) software. Harvey (1990) and DF‐REML (Meyer, 1989) software packages were used to estimate the basic parameters. The open nucleus breeding system was used in the development of selection models (Roden, 1994). RESULTS AND DISCUSSION 1. Some Mating and Reproduction Rate Characteristics The data regarding mating periods between 2006 and 2010, lambing, sheep and lamb deaths, weights during 3 months at the beginning of pasture season and 5‐6 months at end of pasture season were recorded. Table 1 presents the data regarding the total birth and death figures, survival and some reproduction rates belonging to the flocks. It can be seen in Table 1 that the highest values in the number of twin lambing sheep and the related twin reproduction rates were observed during 2008 and 2009. There was a 0.8 % decline in twin reproduction rates in 2009‐2010. This decline was mostly observed in base flocks. The average twin reproduction rate of all years was calculated as 10.7 %. This value was slightly below the value reported by Karataş (1973) and over what Aytuğ et al. (1990) determined. When the years were considered separately, the highest values were determined in 2009 and 2010 respectively. The number of lambs per ewe mated (91,5) and the number of lambs per lambing sheep (112,5) were higher in 2010 in comparison with other years. The number of lambs per ewe mated in flocks was 87,3 % in average. The number of lambs per ewe mated was obtained lower than the value obtained by some other studies (Akçapınar et al., 1982; Aytuğ et al., 1990; Dayıoğlu et al., 1998). The number of lambs per lambing sheep was the highest in 2008‐2009 period, whereas the values were close to each other during 2006‐2007 and 2007‐2008, and 2008‐2009 and 2009‐2010 periods. The overall average of the flocks was obtained as 109.8 %. This value was higher than those determined by Baş et al. (1986) and Aytuğ et al. (1990) and lower than the values reported by Akçapınar et al. (1982) and Dayıoğlu et al. (1999). These researches studied the same race, too. th 166 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1. Some Mating and Reproduction Rate Characteristics FEATURES / YEARS The number of sheep 2007 2008 5031 5533 The number of rams The number of twin lambing sheep Twin Reproduction Rates (%) 2010 Overall 5339 5339 21242 263 253 253 1010 3843 4433 4284 4339 16899 568 544 1770 241 The number of lambing sheep 2009 289 369 7,5 8,3 13,3 12,5 10,5 4132 4781 4852 4883 18548 Male 2052 2319 2397 2389 9157 Ewe 2080 2462 2355 2494 9391 107,5 108,3 113,3 112,5 110,5 The number of lambs born The number of lambs born per lambing sheep The number of lambs born per ewe mated 82,1 86,4 90,8 91,5 87,3 The number of dead lambs (up to the beginning of pasture season) 331 188 137 165 821 Survival rate % (up to the beginning of pasture season) 92,0 96,1 97,2 96,6 95,6 The number of dead lambs (up to the end of pasture season) 619 294 280 262 1455 Survival rate % (up to the end of pasture season) 85,0 93,9 94,2 94,6 92,2 2. Live Weights 2.1 Birth Weight The average birth weight was 3.5±0,02 kg. It was below the value determined by Davutoğlu et al. (1999), and Esenbuğa and Dayıoğlu (2002), while it was over the value determined by Macit et al. (1998; 2001) in studies conducted with the same sheep race. The average birth weight in male lambs was determined 3.6±0,02 kg and it was 3.4±0,02 kg in ewe lambs. These values were quite close to those obtained in a study carried out on the same race male and ewe lambs by Geliyi and İlaslan (1978) in Karacaören village of Kars province. On the other hand, they were higher than those of another study (Ulusan and Aksoy, 1996). There was a significant difference between (P<0.01) the average birth weights of male and ewe lambs. When the birth weights were examined over the years, the highest value was obtained from the births in 2007 (3.9 ± 0,02 kg). An average of 0.4 kg decrease was observed in this value through 2009. The increasing twin birth rate and the negative impact of climatic and health factors were the reasons why the birth rate was the highest at the beginning of the project and it declined in the following years. There was a quite significant difference between the average birth rates over the years (P<0.01). The average birth weights in elite, medium and base flocks were determined as 3,47±0,01 kg, 3,73±0,02 kg and 3,46±0,01 kg respectively. These values were higher than those obtained by Ulusan and Aksoy (1996), and Macit et al. (1998) from Morkaraman lambs. When the average birth weight was examined by years, it was found to be the lowest in 2010. Particularly, the birth weight was found to be the lowest in elite. For the last two years, the elite flock experienced absence of a shepherd. Moreover, it also had health problems. In addition, an increase in twin birth rate had been observed in the flock in recent years. The impact of flock types on birth weights was determined to be quite significant (P<0.01). 2.2 Weights at The Beginning of Pasture Season The overall flock average of live weights of lambs at the beginning of pasture season was determined as 21.4± 0,07 kg. This value was higher than the value found by Esenbuğa and Dayıoğlu (2002) in 75 day old lambs, and Dayıoğlu et al. (1999) at the beginning of pasture season in studies carried out on the same race lambs. On the other hand, it was lower than the value found by Macit Determination Of Live Weight, Daily Weight Gains And Survival Rate Properties In Different Time Of Morkaraman Sheep Grown In Local Conditions 167 et al. (2002). The average live weights at the beginning of pasture season were 21.9±0,01 kg and20.9±0,01 in male and ewe lambs respectively. The difference between the average values was found to be statistically quite significant (P<0.01). In a study carried out on Morkaraman sheep, average weight in male and ewe lambs in 75 day olds was determined to be 22.54 kg and 20.30 kg respectively. They were lower than the values obtained from male lambs and higher than those obtained from ewe lambs (Akçapınar and Aydın, 1984). The average live weights in single and twin born lambs at the beginning of pasture season were found to be 21.9 ± 0,07 kg and 20.9 ± 0,07 kg respectively. This difference was determined to be statistically quite significant (P<0.01). The average live weight between 2007 and 2010 was the lowest in 2009 (17.5±0.10 kg). An increase was observed in this value year by year and the highest value was obtained in 2007 (25.3±0.10 kg). season determined through years was found to be quite significant (P<0.01). The variability of this weight over the years can be explained by the improvement of environmental factors such as maintenance in different farms every year and feeding and barn conditions. It was determined to be 24.0±0.14 kg in elite, 20.1±0.11 kg in medium and 20,0±0,06 kg in base flock. The impact of flock type factors on average weight at the beginning of pasture season was found to be quite significant in all flocks (P<0.01). 2.3 Weights at The End of Pasture Season The average time spent in the pasture was 162.7 days over years. Regarding the weights at the end of the pasture season, the overall average was calculated as 37.4±0.11 kg. This average value was lower than the value reported by Yaprak et al. (1996) and similar to the value reported by Macit et al. (1996). The live weight gains at the end of pasture season in male, ewe, single and twin lambs in overall flocks were 39.0±1.11 kg, 35.9±1.11 kg, 37.8±0.09 kg and 37.1±2.03 kg respectively. Regarding these average values, male lambs gained more weight than ewe lambs and single lambs more than twin lambs. The differences between average values regarding gender and birth method influencing live weight at the end of pasture season were found to be quite significant (P<0.01). The average weights at the end of pasture season from 2007 to 2010 were determined to increase. This increase was found to be about 5,4 kg between 2007 and 2010. This increase was very important in terms of ensuring the objectives of the improvement program. It was obtained by progress in selection, flock management and enhancement in care and feeding conditions. The differences between weight averages at the end of pasture season over years were determined to be statistically quite significant (P<0.01). When Table 2 is examined, it can be seen that the weights at the end of pasture season were obtained the highest in elite (41.0±0.19 kg) and the lowest in medium flock (34.7±0.15 kg). The effect of gender and years on the weight average at the end of pasture season was found to be quite significant (P<0.01), whereas mother age and birth method was found to be insignificant. The effect of birth method on weight at the end of pasture season was found to be quite significant (P<0.01). 3. Daily Live Weight Gains 3.1 Daily Live Weight Gains Up to The Beginning of Pasture Season The average daily live weight gains up to the beginning of pasture season was 239±1.33 gr. The average gains were determined to be 245±1.54 and 233±1.53 g in male and ewe lambs; 251±1.24 g and 227±2.01 g in single and twin lambs; 260±2.02 g, 217±1,95 g, 235±1.79 g and 243±1.82 g in 2007, 2008, 2009 and 2010 respectively; 244±2.76 g, 251±2.19 g and 222±1.10 g in elite, medium and base flocks respectively. The effect of gender, birth method, years and flock type on the average daily live weight gains up to the beginning of pasture season was found to be quite significant (P<0.01). The daily live weight gains at the beginning of pasture season in medium flocks were higher than those in elite and base flocks. The negative effect of diseases in elite flock in the last two years decreased daily live weight gains at the beginning of pasture season. The weight at the beginning of pasture th 168 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) season in base flocks involving lots of growers got the lowest value. This was due to weaknesses in animal material, care and feeding conditions and grower tendencies to improvement. Dayıoğlu et al. (1999) found daily live weight gains at the beginning of pasture season in a study with Morkaraman sheep in Erzurum as 183 g. This value was below the value obtained in this study. Table 2.Birth and Live Weights at Beginning and End of Pasture Season(kg), Daily Live Weight Gains(g) Regarding Different Periods of Lambs, Standard Error(Sx) and Variation Coefficients(VK) Birth weight Weight at the beginning of pasture season Weight at the end of pasture season N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum 18669 3,5 ± 0.01 7.0 1.1 9277 ** 3.6 ± 0.02 7.0 1.1 17848 21.4± 0.07 46.0 9.0 8777 ** 21.9 ± 0.08 46.0 11.0 17216 37.4 ± 0.09 67.0 15.0 8429 ** 39.0 ± 1.11 67.0 16.0 Weights between the birth and beginning of pasture season ‐ Daily L.W.G. 17848 239 ± 1.33 614 50 8777 ** 245 ± 1.54 614 61 N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum 9392 3,4 ± 0.02 6.5 1.1 15129 ** 3.6 ± 0.01 7.0 1.1 3540 3.4 ± 0.02 6.5 1.1 4132 ** 3.9 ± 0.02a 5.3 2.1 4802 3.5 ± 0.02b 4.0 1.5 9071 20.9 ± 0.08 45.0 9.0 14563 ** 21.9 ± 0.06 46.0 10.0 3285 20.9 ± 0.10 45.0 9.0 3801 ** 25.3 ± 0.10a 45.0 12.0 4714 20.5 ±0.09c 45.0 9.0 8737 35.9 ± 1.11 66.0 15.0 14010 ** 37.8 ± 0.09 67.0 15.0 3206 37.1 ± 2.03 64.0 17.0 3513 ** 35.0 ± 0.14d 49.0 16.0 4608 36.0 ± 0.13c 60.0 17.0 N X ± Sx Maximum Minimum 4852 3.1 ± 0.02c 6.3 2.2 4715 17.5 ± 0.10d 43.5 14.0 N ± Sx 4883 3.2 ± 0.02c 7.0 1.1 2010 2009 Year 2008 2007 Twin Birth Type Single Ewe Gender Male Overall Features X Maximum Minimum Weights between the birth and end of pasture season ‐ Daily L.W.G. Weights between the beginning and end of pasture season ‐ Daily L.W.G. 17216 201 ± 0.78 520 61 8229 ** 211 ± 0.90 520 61 17216 179 ± 1.18 384 61 8229 ** 192 ± 1.37 384 65 9071 233 ± 1.53 587 50 15563 ** 251 ± 1.24 495 75 3285 227 ± 2.01 365 50 3801 ** 260 ± 2.02a 319 75 4714 217 ± 1.95c 404 71 8737 191 ± 0.89 497 65 14010 ** 207 ± 0.73 520 80 3206 195 ± 1.18 320 61 3513** 182 ± 1.18c 361 75 4606 169 ± 1.15d 340 71 8737 165 ± 1.36 298 61 14010 * 180 ± 1.11 384 80 3206 178 ± 1.79 320 61 3513** 114 ± 1.80c 361 75 46108 138 ± 1.74c 340 71 4572 38.4 ± 0.12b 60.0 15.0 4715 235 ± 1.79b 495 61 4572 250 ± 1.05a 349 61 4572 278± 1.60a 349 61 4987 22.3 ± 0.09b 4432 40.4 ± 0.12a 4987 243 ± 1.82b 4432 203 ± 1.07b 4432 185± 1.62b 46.0 9.0 18.0 67.0 614 50 520 74 384 78 Determination Of Live Weight, Daily Weight Gains And Survival Rate Properties In Different Time Of Morkaraman Sheep Grown In Local Conditions Features Medium Base Flock Type Elite N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum N X ± Sx Maximum Minimum Birth weight 1534 ** 3.5 ± 0.01b 7.0 1.1 2258 3.6 ± 0.02a 6.7 1.1 14890 3.4 ± 0.03c 6.8 1.1 Weight at the beginning of pasture season 1427 ** 24.0 ± 0.14a 45.0 10.0 2156 20.1 ± 0.11b 45.0 9.0 14278 20.0 ± 0.06b 46.0 9.0 1362** Weights between the birth and beginning of pasture season ‐ Daily L.W.G. 1427** 41.0 ± 0.19a 67 17 2056 34.7 ± 0.15c 67 15 13819 36.6 ± 0.08b 67 17 244 ± 2.76b 320 78 2156 251 ± 2.19a 495 85 14278 222 ± 1.10c 50.00 61 Weight at the end of pasture season 169 Weights between the birth and end of pasture season ‐ Daily L.W.G. Weights between the beginning and end of pasture season ‐ Daily L.W.G. 1362** 1362** 212 ± 0.65a 480 80 2056 203 ± 1.28b 410 85 13819 187 ± 1.61c 520 61 209 ± 0.98a 349 80 2056 177 ± 1.95b 361 85 13819 150 ± 2.46c 320 61 **:P<0.01: Quite significant; *:P<0.05: Significant 3.2 Daily Live Weight Gains Up to The End of Pasture Season The average daily live weight gains of the lambs up to the end of pasture season was 201±0.78 gr. The average gains were determined to be 211±0.90 and 191±0.89 g in male and ewe lambs; 207±0.73 g and 195±1.18 g in single and twin lambs; 182±1.18 g, 169±1,15 g, 250±1.05 g and 203±1.07 g in 2007, 2008, 2009 and 2010 respectively; 212±0.65 g, 203±1.28 g and 187±1.61 g in elite, medium and base flocks respectively. The effect of gender, birth method, years and flock type on the average daily live weight gains up to the end of pasture season was found to be quite significant(P<0.01). The live weight gains at the end of the pasture season were determined to be the highest in elite flock. Within this respect, medium flocks got higher values than base flocks did. CONCLUSION This project was a good start for the protection, development and improvement studies of the genetic potential of Morkaraman sheep owned by the local people. With the help of the project, breeding rams and sheep with superior performance characteristics were obtained and they were given to the breeders. The sheep breeders were trained and the foundations of a registered breeding system were established. The related breeding unions were founded and structured. An average of 4 to 5 kg live weight gain in sheep was achieved in this 5 year long study. To sum up, the objectives were largely achieved from the beginning of the project towards the end. th 170 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Akçapınar, H. and Kadak, R.(1982) The effects of some factors on gestation and birth weight in Akkaraman and Morkaraman sheep. Atatürk University. Vet. Fac. Journal, 29 (2‐4);392‐400. Akçapınar, H. and Aydın, İ.(1984) The growth and survival rate of Morkaraman sheep under semi intensive conditions in a private enterprise in Erzurum city. Atatürk Univ. Vet. Fac. Journal. 31(1);128‐136. Anonymous.(2009) TUIK. Statistics of sheep and goats http://www.tuik.gov.tr/VeriBilgi.do?tb_id=46&ust_id=13 Aytuğ, C. N., Yalçın,B.C. Alaçam, E. Türker, H. Özkoç Ü. and Gökçen, H.(1990) Sheep and goat diseases and raising. Tüm Vet. Hay. Hizmetleri Yay: 2, İstanbul. 302. Baş S., Özsoy, M.K. and Vanlı, M.(1986) The effects of feeding in different flocks before mating period on reproduction rate in sheep and growth and survival rates in lambs. Tr. Vet. Ve Hay. D. C. 10(3); 221‐224). Dayıoğlu H., Esenbuğa, N. Yaprak, M. Kopuzlu, S. Karaoğlu M. and Macit, M. (1998) A comparative research on flock productivity in Morkaraman ve Tuj reciprocal hybridization. East Anatolian Agricultural Congress. Erzurum, 14‐18 September, p:912‐921. Dayıoglu, H., Aksakal, V. Karaoğlu, M. Macit, M. and Esenbuga, N. (1999) The growth and development characteristics of purebred and hybrid lambs bred based on local gen resources. International Farm Animals Congress. İzmir, 21‐24 September. p:743‐747. Esenbuğa N. and Dayıoglu, H. (2002) The effects of some environmental factors on the growth and development of İvesi ve Morkaraman lambs. Turk J. Vet. Anim. 26:145‐150. Geliyi C. and İlaslan, M. (1978). Reproductive Traits, Milk And Wool Yields Of Red Karaman Sheep Raised İn Karacaören Village Of Kars Province (1). Experiment And Production Station Of Kars. Publication No: 4. Kars. Harvey, W.R. (1990). Users Guide For Lsmlmw Pc‐1 Version. Mixed Model Least‐Squares And Maximum Likelihood Computer Program. Ohio State University, Columbus, Usa. Karaca, O., Altın, T. and Okut, H. (1996). Karakaş sheep in village farms. Some parameter estimations regarding live weight gains. Y.Y.University. Agricultural Faculty Journal, 6 (3); 59‐72. Karakaş Ş.(1973). A comparison of Merinos and Morkaraman hybrids regarding productivity characteristics, TÜBİTAK Veterinary and Livestock Research Group. 23/51. Project final report.. Macit M., Karaoğlu, M., Dayıoğlu, H., Kopuzlu, S. and Esenbuğa, N.(1998) An investigation on purebred and hybrid Morkaraman, İvesi and Tuj lambs regarding feeding characteristics under semi intensive conditions. East Anatolian Agricultural Congress. Erzurum. 14‐18 September. Macit M., Karaoğlu, M. Esenbuğa, N. Kopuzlu, S. and Dayıoğlu, H.(2001) Growth Performance Of Purebred Awassi, Morkaraman And Tushin Lambs And Their Crosses under semi‐intensive Management in Turkey. Small Ruminant Research, 41, 177‐180. Macit M., Esenbuğa, N. ve Karaoğlu, M.(2002) Growth Performance And Carcass Characteristics Of Awassi, Morkaraman And Tushin Lambs Grazed On Pasture And Supported With Concentrate. Small Ruminant Research. 44, 241‐246. Meyer, K.(1989) Restricted Maximum Likelihood To Estimate Variance Components For Animal Models With Several Random Effects Using A Derivative‐Free Algorithm. Genet. Select. Evol. 21:317–340. Özcan L.(1990) A comparative research on capability. Fırat Univ. Vet. Fac. journal. Volume: Vıı. No: 1‐2. p: 203‐ 212. Roden, J.A. (1994) Review Of The Theory Of Open Nucleus Breeding Systems. In: Animal Breeding Abstracts. Vol. 62 No.3. Sas (1999) The Sas System. Version 8. Copyright (C) 1999 By Sas Institute Inc., Cary, Nc, Usa. Soysal M. İ.(2010) The genetic resources of local domestic animals in Turkey. Tekirdağ. p:34. Ulusan H.O.K. and Aksoy, A.R.(1996) The productivity performance of Tuj and Morkaraman sheep raised in Kafkas University, Veterinary Faculty Farm. 2. Growth and body sizes. Kafkas Univ. Vet. Fac. Journal. 2(2);139‐146. Kars. Yaprak M., Macit, M. and Emsen, H.(1996) The relations between hemoglobin types and some productivity rates in İvesi and Morkaraman sheep. Atatürk Univ. Agricultural Faculty Journal., 27(3);387‐397. FROM MILK PROTEIN POLYMORPHISMS TO BREEDING PRACTICES IN TURKEY H.DINC*, E. OZKAN1, E. KOBAN2, I. TOGAN3 1 Department of Animal Sciences, Agricultural Faculty, Namık Kemal University, 59030, Tekirdağ, Turkey 2 Genetic Engineering and Biotechnology Institute, TUBITAK‐MAM, Gebze, 41470, Kocaeli, Turkey 3 Department of Biological Sciences, Middle East Technical University, 06800, Ankara, Turkey * Corresponding author: Department of Biological Sciences, Middle East Technical University, 06800, Ankara, Turkey Abstract In this study, the genetic diversity of three milk protein genes namely beta‐casein, kappa‐ casein and beta‐lactoglobulin (BLG) was estimated in Turkish native cattle breeds: Turkish Grey (TG), Eastern Anatolian Red (EAR), Anatolian Black (AB) and Southern Anatolian Red (SAR). For the comparison, Turkish Holstein (TH) and Holstein Candidate Bulls (HCB) were also screened for the same loci. Analyses revealed that genetic similarity of the native breeds is in accordance with their native distribution of east‐west direction in Anatolia. TH and HCB are observed to be quite similar to each other as well as to TG. Comparative data from the literature suggested that milk of Turkish native breeds is suitable for cheese making especially due to high frequency of B allele of BLG. The kappa‐casein E allele, which has a negative effect on cheese quality, is absent in Turkish cattle breeds, except for Holstein Candidate Bulls. Beta‐casein A1‐like proteins which are claimed to have negative effects on human health also have low frequency in the EAR, AB and SAR. In order to keep high B allele of BLG, low A‐1 like protein and null kappa‐casein E allele frequencies in Turkey hybridization between Holstein must be limited or candidate bulls must be screened. Introduction DNA based methods have been used to screen both sexes with respect to milk protein polymorphisms in cattle (for instance: Jann et al., 2004). In some of these it was observed that B variants of beta‐casein (Heck et al., 2009), kappa‐casein (Hallen et al., 2008; Heck et al., 2009) and beta‐lactoglobulin (BLG) (Hallen et al., 2008) were associated with an increase whereas E variant in kappa‐casein (Hallen et al., 2008) was associated with a decrease in milk casein content and cheese yield/quality in various cattle breeds. Furthermore, in the last decade, a possible link between A1‐like variant of beta‐casein and some adverse effects on human health such as type‐I diabetes (Elliott et al., 1999), ischaemic heart disease (McLachlan, 2001), neurological disorders (Sun et al., 2003) have been suggested (Kaminski et al., 2007; Woodford, 2009). Purpose of this study is to expand the existing data on genetic diversity of Turkish cattle breeds in relation to beta‐casein, kappa‐casein and BLG loci. Moreover, results were expected to yield some realizations and proposals in relation to the milk properties of native cattle and breeding practices applied to native Turkish cattle breeds. Materials and Methods Total genomic DNA from 254 blood samples of cattle breeds and population in Turkey was isolated using the phenol‐chloroform‐isoamylalcohol method (Sambrook et al., 1989). DNA samples were screened for beta‐casein, kappa‐casein and beta‐lactoglobulin (BLG) milk protein gene variants. Beta‐casein gene variants were determined by SSCP (Barroso et al., 1999a, b) and ACRS (Lien et al., 1992) methods. In selected individuals (N=46), sequencing of beta‐casein gene was performed in accordance with Lien et al.’s (1992) and by automatic DNA sequencing machine (ABI 310). Kappa‐ casein gene variants were determined by RFLP method as described in Soria et al. (2003) and BLG gene variants were determined by RFLP methods as stated in Medrano and Aguilar‐Cordova (1990). th 172 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Results Table below presents observed allele frequencies, observed heterozygosities, the probability of deviations from Hardy‐Weinberg expectations for beta‐casein, kappa‐casein and BLG, within‐ population inbreeding estimates (Fis) based on all loci and their significance per population. Table. The studied cattle breeds and population (TG: Turkish Grey, EAR: Eastern Anatolian Red, AB: Anatolian Black, SAR: Southern Anatolian Red, TH: Turkish Holstein, HCB: Holstein Candidate Bulls), the number of animals (n), beta‐casein, kappa‐casein and BLG allele frequencies, observed heterozygosities, the significance of deviations from Hardy‐Weinberg expectations (H‐W e.), Fis values overall loci and their significance per population. Milk Protein Loci Beta‐ casein Breeds and Population TG EAR AB SAR TH HCB A1 0.426 0.118 0.132 0.117 0.485 0.278 A2 0.544 0.824 0.765 0.766 0.456 0.722 A3 0.000 0.000 0.000 0.000 0.029 0.000 B 0.029 0.059 0.103 0.117 0.029 0.000 A1‐like (A1+B) 0.455 0.177 0.235 0.234 0.514 0.278 Ho 0.441 0.294 0.382 0.467 0.765 0.556 Alleles H‐W e. Kappa‐ casein 0.206 NS 0.829 NS 0.804 NS 0.047 NS 0.245NS n 34 34 34 30 34 18 A 0.7021 0.6585 0.6548 0.6563 0.8061 0.7963 B 0.2979 0.3415 0.3452 0.3437 0.1939 0.1481 E 0.0000 0.0000 0.0000 0.0000 0.0000 0.0556 Ho 0.383 0.293 0.452 0.438 0.306 0.296 H‐W e. BLG 0.201 NS 0.505 NS 0.034 NS 1.000 NS 1.000 NS 1.000 NS 0.309NS n 47 41 42 48 49 27 A 0.5213 0.2195 0.3929 0.1875 0.4694 0.5455 B 0.4787 0.7805 0.6071 0.8125 0.5306 0.4545 Ho 0.489 0.390 0.310 0.292 0.449 0.546 H‐W e. n Overall Fis NS: non‐significant 1.000 NS 47 0.099 0.652 NS 41 NS 0.122 0.025 NS 42 NS 0.143 0.654 NS 48 NS ‐0.036 0.564 NS 49 NS ‐0.101 1.000NS 22 NS ‐0.196NS From Milk Protein Polymorphisms To Breeding Practices In Turkey 173 These observations indicated that there is no significant substructuring or inbreeding within the breeds or population because no deviation from Hardy‐Weinberg equilibrium and no significant Fis values were observed. B allele frequencies of beta‐casein, kappa‐casein and BLG loci were higher in Turkish native cattle breeds compared to TH and HCB. Yet, TG frequency values were in between the three other Turkish native breeds (EAR, AB, SAR) and TH‐HCB. Kappa‐casein E allele was observed only in HCB. Discussion Among native Turkish cattle breeds, EAR, AB, SAR are relatively different from TG based on beta‐casein, kappa‐casein and BLG genes. The relatively high B allele of BLG gene in EAR, AB, SAR, may be contributing to good quality cheese and yoghurt making in Anatolia. Hence, in managing EAR, AB, SAR cattle breeds this property must be remembered. Furthermore, their A1‐like protein content is low. Although differential health effects of A1 and A2 milk is still controversial and even though A1 beta‐casein may not have adverse health effects on humans, the existence of this probability should be a reason to keep A1 beta‐casein frequency at low levels in native cattle breeds (SAR, EAR and AB) and hence to prevent them from further receiving the A1 beta‐casein present in HCB of Turkey. Furthermore, when native and TH breeds are fertilized by Holstein bulls perhaps the sperm of bulls must be screened for E allele of kappa‐casein, which is known to have detrimental effects on cheese quality, as well as A1 allele of beta‐casein. REFERENCES Barroso, A., Dunner, S., Canon, J., 1999a. Technical Note: Use of PCR‐single‐strand conformation polymorphism analysis for detection of bovine beta‐casein variants A1, A2, A3 and B. J. Anim. Sci. 77, 2629‐2632. Barroso, A., Dunner, S., Canon, J., 1999b. A multiplex PCR‐SSCP test to genotype bovine beta‐casein alleles A1, A2, A3, B and C. Anim. Genet. 30, 322‐323. Elliott, R.B., Harris, D.P., Hill, J.P., Bibby, N.J., Wasmuth, H.E., 1999. Type‐I (insulin dependent) diabetes mellitus and cow milk: casein variant consumption. Diabetologia. 42, 292‐296. Hallen, E., Wedholm, A., Andren, A., Lunden, A., 2008. Effect of beta‐casein, kappa‐casein and beta‐ lactoglobulin genotypes on concentration of milk protein variants. J. Anim. Breed. Genet. 125, 119‐129. Heck, J.M.L., Schennink, A., van Valenberg, H.J.F., Bovenhuis, H., Visker, M.H.P.W., van Arendonk, J.A.M., et al., 2009. Effects of milk protein variants on the protein composition of bovine milk. Dairy Sci. 92, 1192‐1202. Jann, O.C., Ibeagha‐Awemu, E.M., Özbeyaz, C., Zaragoza, P., Williams, J.L., Ajmone‐Marsan, P., et al., 2004. Geographic distribution of haplotype diversity at the bovine casein locus. Genet. Sel. Evol. 36, 243‐257. Kaminski, S., Cieslinska, A., Kostyra, E., 2007. Polymorphism of bovine beta‐casein and its potential effect on human health. J. Appl. Genet. 48(3), 189‐198. Lien, S., Aleström, P., Klungland, H., Rogne, S., 1992. Detection of multiple β‐casein (CASB) alleles by amplification created restriction sites (ACRS). Anim. Genet. 23, 333‐338. McLachlan, C.N.S., 2001. β‐casein A1, ischaemic heart disease mortality, and other ilnesses. Med. Hypotheses. 56(2), 262‐272. th 174 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Medrano, J.F., Aguilar‐Cordova, E., 1990. Polymerase chain reaction amplification of bovine β‐ lactoglobulin genomic sequences and identification of genetic variants by RFLP analysis. Anim. Biotechnol. 1(1), 73‐77. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, second ed. vol.3. New York: Cold Spring Harbor Laboratory, Cold Spring Harbor, USA. Soria, L.A., Iglesias, G.M., Huguet, M.J., Mirande, S.L., 2003. A PCR‐RFLP test to detect allelic variants of the bovine kappa‐casein gene. Anim. Biotechnol. 14(1), 1‐5. Sun, Z., Zhang, Z., Wang, X., Cade, R., Elmir, Z., Fregly, M., 2003. Relation of β‐casomorphin to apnea in sudden infant death syndrome. Peptides. 24, 937‐943. Woodford, K., 2009. Devil in the milk: Illness, Health, and Politics of A1 and A2 Milk. Chelsea Green Publishing Company, USA. Acknowledgements. We thank Prof. Dr. İhsan Soysal for his help in the collection of samples. This work was supported by grant TOVAG 104V137 from The Scientific and Technological Research Council of Turkey (TÜBİTAK). SOME OF COMMON FEATURES OF EASTERN ANATOLIAN RED CATTLE, ITS LOCAL POSITION AND IMPORTANCE AS GENETIC RESOURCES Sadrettin YÜKSEL, Erdoğan SEZGİN, Sinan KOPUZLU Abstract Eastern Anatolian Red Cattle is a breed grown in Eastern provinces in Turkey, especially in the cities Erzurum and Kars. This breed which is middle but a strong body structure has well adapted to the harsh environmental and rearing conditions. It is strongly resistant to diseases and pests. It has three varieties, called Göle, Çıldır and Kars types. Current crossbreedings with exotic cattle breeds has caused a rapid decrease in population size and led gradually to its extinction. Keywords: Eastern Anatolian Red, animal genetic resources, cattle Introduction The scientific researches carried out have shown that the relations of human with animals is as old as human history. Animals have contributed to the life of man with their products such as meat, milk, egg, spring wool and young, manure as fuel and strength as pulling force for about 12000 years in the sense of agriculture , food and sociality (Anon, 2004). This process started with the hunting of wild animals has develpod into domestication of these animals in time (Macer and Yokoyama, 1998). Due to the rising and spreading of civilizations, the movement of human has increased, and as a result of it has leaded to the formation of new genotypes by means of taking breeds or species peculiar to a certain region to other regions. It is now known that about 4500 local race belonging to more than 40 species are kept by breeders living in rural areas (McCorcle, 1999). These animals which adapted the ecological conditions of the regions they originated whether lessened in number or disappeared because of various factors. However, these animals which have an important place from the point of biological balance, and affect the shaping of social life in their breeding areas have a vital importance fro the whole humanity in future. In this study, Eastern Anatolian Red Cattle breed, a local genetic source adapted ver well to the hard climate and nature conditions of esatern regions, will be handled from the point of its structural situation and genetic source in the region. a. Some General Characteristics of Eastern Anatolia Red Cattle Breed Our country, being one of the rare place of the world in terms of its floral diversity, water sources and geographical location in each region, shelters lots of animal species and breeds in it. Eastern Anatolia Red Cattle which is one of the biological varieties of Anatolian geography is a native cattle breed grown up in the eastern parts of our country, especially in Erzurum and Kars provinces. Though it has a meat and milk production peculiarity, it is also benefited for other different properties. For example, it has been the most favourable breed for years for quality pastrami production in Kayseri, pulling animal in Central Anatolia, retail slaughter production in grand centers like Istanbul and Bursa (Üresin, 1936). Eastern Anatolia Red Cattle Breeds are also seen in some parts of world such as many different regions of Germany, Poland, Russia, Southern Russia and Caucasia (Bilgemre, 1946). It is considered that this species, the past of which goes 700‐800 years back, even nearly 3000 years back according th 176 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) to a study, originates from Brachyceros breed and is the relative of Caucasia Red Cattle Breed (Bilgemre, 1940; Güven, 1972), and it is even indigenous to Southern Caucasia (Üresin, 1936). Both sexes have horns. Their skin is dark brown and the colour of their hair can change from the cinnamon to dark red. Dark colour is seen around the eyes, the tips of ears, the tips of horns, the point where the nails join the skin. This colour design of Eastern Anatolia Red Cattle Breed is accepted as the peculiarity of the species and it is considered as one of the distinctive pecularities. Nails are black and healthy. Besides its meat and milk, it is used for some spectacle activities because of their nature, strength and body structure. The origin of Eastern Anatolia Red Cattle has some varieties (Bilgemre, 1946; Güven, 1972; Üresin, 1936). However, these varieties have been largely combined and so it is accepted as a single species. i. Göle Type: Its teat structure and the amount of its milk are better than those of its own varieties. They have the most well‐built body structure among their varieties. Thus, their withers height is around 1‐1.25 m. Their colours are dark red or between red and purple, and only their abdomen are relatively light. Their feet, horns and tails are black. Their horns are crescent and jagged. Their foreheads are wide and medium‐sized. These pecuilarities are handled as a factor one by one in order to describe the animal rightly (Üresin, 1936). ii. Çıldır Type: This type has the pecularities of Göle Type in terms of general structure. The difference is that their feet are shorter but stronger, and the around of their breasts are wider and the depth of their breasts are deeper and so they have a more stronger form. Thus, because of these peculiarities, they have been used as harness cattles for years in the region (Üresin, 1936). iii. Kars Type: The colour of this type changes from clear yellow to cinnamon and red by showing variability. There is a general agreement that this type is indigenous to Southern Caucasia and it has the highest number of population in the region. Their milk production and harness peculiarities are between those of other types. Especially, it is indicated that red and cinnamon cattles seen in many parts of the Central Anatolian Region are from this type (Üresin, 1936). b. The regional condition of Eastern Anatolia Red Cattle Breed The practices, the infrastructures of which are not formed and the certain results and the effect extent of which are not considered, have started to threaten the nature and natural resources, and especially human life. The studies carried out show that one‐third of livestocks are under the risk of disappearance and nearly six races are at the edge of disappearance each month (Anon, 1998a). Nevertheless, biodiversity bears responsibility of shaping the life style of all the society. Putting domestic gene sources under constraint has been experienced to some extent presently as well as in the past. Wars, conquests, occupations and colonialism experienced throughout history have been influential on this matter. The dominating groups as a result of these events inclined to favour animals suitable for their society and order, and survived by protecting the animals suiting to their belief (McCorcle, 1999). Because of not following a systematic livestock policy in our country for years, Eastern Anatolia Red Cattle has been greatly affected. In reality, regional breeders got advantage of this cattle for years according to the conditions of time. However, uncontrolled applications of some decisions handled in a narrow frame have brought this cattle generation into a point of extinction. Since some of the studies carried out in the first year of republic were interrupted in the following years, a healthy inventory study could not have been achieved. When uncontrolled s carried out under the name of improvement programmes were added to the lack of knowledge mentioned above, it became inevitable that this breed lessened in number meaningfully. The unplanned practices that the regional breeders attempted without considering the results are another important matter to be handled. The breeders having sufficient suitable land and feed Some Of Common Features Of Eastern Anatolian Red Cattle, Its Local Position And Importance As Genetic Resources 177 production capacity in the region have inclined to European origin cultural cattle or crossbred of these animals because of their high yield, high marketing demand and high market prices. However, some breeders who do not have enough potential and sufficient infrastructure or conditions have inclined to such type animals in order to get high yield. Unfortunately, the results of such attempts are completely a failure. These failures have led to the weakening of the pastures, worsening of maintenance, feeding and housing conditions, not mating suitable time and age and thus causing theri bodily smallness. As a result, their body length fell from 138‐146 cm (Üresin, 1936) to 118‐135 cm, hearth girth from 155‐194 cm (Üresin, 1936) to 160 cm and height at with ers from 118 cm (Üresin, 1936) to 114 cm. Apart from these, the unqualified increase of family and regional population, the increase of needs, not giving education suitable to rural living conditions, spreading of attraction centers in crowded metropols and desire to live luxurious life have led to experiencing unqualified migrations causing the end of rural life, and as a result, all these greatly contributed to the extinction of Eastern Anatolia Red Cattle, one of our important sources. c)The Importance of Eastern Anatolia Red Cattle as a Gene Source Native animal breeds that can adapt the every condition of the area they live have the caharteristics of being an important income source to the breeders in respect to agricultural product and food supply. Since native breeds have a special breeding pecularities, it is estimated that they meet 30% of the human needs about agricultural and food necessities (Anon, 2004). The role of native cattle is not only limited to their agricultural and food contribution, namely their economic input. They also contribute greatly to the formation of social values and cultural richness and to transfer these to the next generations (Anon, 2004; Macer and Yokoyama, 1998). This is because the life style of societies are closely related with the types and amount of the animals they own. Moreover, the existing animal population of the regionis animportant source effecting the living style, clothing, nutrition and even the life of philisophy. Rapid rise of population brings the increase of needs together. Thus, intensification is aimed to increase the meat, milk, egg, wool and etc. obtained from unit amount upmost. While applying intensive methods, various methods and technological advantages are also benefited from. However, when it is thought that intensification can be applied to some degree (Ertuğrul et al., 2000), it is obvious that this method will not be enough to meet the needs alone. Indeed, since heavy intensification activities performed on breeds other than native ones in some parts of the world, resulted in failure, those living rural areas and animal breeders have inclined to a greater extent towards developing native genetic sources recently (McCorcle, 1999). Never having been regarded as a rival, but a supplemet to culture breeds which have an undisputable superiority from the point of productivity, native breed Eastern Anatolia Red Cattle bears great importance to form a branch of livestock application in the region. The region has a very sloping and suitable only for pasture land. Eastern Anatolia Red Cattle are ideal for the use of such rough land since they have a content speciality. Because of these pecularities, they are favourable for the use of poor quality plant cover, unproductive, rough marginal land and poor quality feed. On the other hand, their maintenance, feeding and breeding are very economical as they can survive in primitive stables. These peculiarities of Eastern Anatolia Red Cattle make it have an important place in respect to being a domestic gene source both for our country and especially for our region. However, wrong practices up to present leave its protection a chance. th 178 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Conclusion Of course, it can not be thought not to intervene the nature, natural sources and native animal genetic sources since it is a primary necessity to develop these sources. This development is a dynamic and developing process in the increase of new breeds and sometimes diversity forming from new genes (Anon, 1998b). This process is managed by human beings. However, this humanly influence related with biodiversity should be in balance. The intervenes suggested in the management of farm animals should be analysed primarily by taking into consideration the protection of known species and breeds by humans as well as the coordination conditions and the competition in production and marketing systems. This situation comprises social, cultural and moral values. Moreover, the intervenes should be managed in a manner that includes the preventive men who protect. These alive gene sources, manage and improve them for the sake of all humanity (McCorcle, 1999). This is because the awareness and protection of biodiversity are under the responsibility of all socities (Anon, 1998b). If an acknowledging and awareness about these existing sources are not created, extinction speed and ratio rise. REFERENCES Anoniymus, 1998a. NAO, North Atlantic Oscillation. Anoniymus, 1998b. Farm Animal Industrial Platform (FAIP), Biodiversity of Farm Animals, www.faip.info, www.sefabar.org Anoniymus, 2004. Evaluation Report of “The Study on the Relationship Between Indigenous Farm Animals and Humans in APEC Region.” The 8th Plenary Meeting of the Agricultural Technical Cooperation Working Group June 15‐18, Chiang Mai, Thailand Bilgemre K, 1940. Doğu Anadolu Sığırlarında Vücut Yapılışı. Ziraat Dergisi, Yıl I, Sayı 4‐5, Ziraat Mühendisleri Birliği Yayını, Ankara. Bilgemre K, 1946. Sığır Yetiştirmek. Türk Yüksek Ziraat Mühendisleri Birliği, İş Kitapları Sayı: 8, İstanbul. Ertuğrul M, Akman N, Dellal G, Goncagül T, 2000. Hayvan Gen Kaynaklarının Korunması ve Türkiye Hayvan Gen Kaynakları. Türkiye Ziraat Mühendisliği 5. Teknik Kongresi (2. Cilt) Yayın No: 38, Ankara. Güven Y, 1972. Göle ve Çıldır Yöresinde Yetiştirilen Doğu Anadolu Kırmızısı Sığırların Yetiştirme Şartları ve Irk Karakterleri. Atatürk Üniversitesi, Ziraat Kakültesi, Zootekni Bölümü, Doktora Tezi. Macer, D.R.J., Yokoyama, K., 1998. Human relationships with animals in Asia Pacific countries and bioethics. Bioethics in Asia, p:324‐337. McCorkle, C.M. 1999. Africans manage livestock diversity, COMPAS Newsletter ‐ October, USA. Üresin E.R, 1936. Kars Sütçülüğü Hakkında Tetkikler. T.C. Yüksek Ziraat Enstitüsü Çalışmalarından, Sayı: 14, s: 16, Ankara. AN INVESTIGATION ON THE CARCASS PERCENTAGE OF ANATOLIAN GREY BREED IN RAISED EDIRNE PROVINCE S. KÖK1, M. İ. SOYSAL2, E. K. GÜRCAN3 1 Assist. Prof. Dr. Trakya University, Keşan Vocational High School. mail:suleymankok_22@hotmail.com 2 3 Prof. Dr. Namık Kemal University,Faculty of Agriculture, Department of Animal Science. Assist. Prof. Dr. Namık Kemal University, Faculty of Agriculture, Department of Animal Science. 1.SUMMARY This study was aimed to investigate live weight and carcass traits of Anatolian Grey and Anatolian Grey x Brown Swiss crossbred in raised Edirne and Keşan. This study were occured 51 Anatolian Grey bulls, 22 Anatolian Grey heifers and 63 Anatolian Grey x Brown Swiss crossbred bulls. In totaly, 136 animal in 2‐3 years old were used present study. As a result, carcass percentage were found 60.57%, 46.84%, 56.87% and the correlation coefficient were calculated between live weight and carcass percentage 0.98, 0.80 and 0.94 for Anatolian Grey bulls, Anatolian Grey heifers and Anatolian Grey x Brown Swiss crossbred bulls, respectively. Key words: Anatolian Grey, Carcass percentage, Carcass weight, Meat yield, Correlation coefficient. 2.INTRODUCTION The Anatolian Grey breed is originate from Bos Taurus Primigenius and there are similar breeds in different country such as Ukraine, Romania, Hungary and Italy. This breed is named as Bozstep or Plevne breeds in Turkey, also. Especially, this breed is named as Podolion in Italy and Gray Steppe in English literature. In Turkey, this breed was seen widely in Trakya region, South Marmara, North Egean and West of Middle Anatolia. The Anatolian Grey is used to meat and milk production and power draft (Soysal et al.,2005; Kök,1992 and 1995). In 1950, there were nearly 1‐1.2 million head this breed in Trakya and Marmara region (Yarkın,1954). Unfortunately, there are estimated only 3000 head as pure breed in present time. The immunity sisytem of Anatolian Grey breed is vigorous and resistant against to parasitary illnes hence this breed is managed as extensive system (Kök,1992). This breed is seen the height above sea level and mountainous district of Trakya and Marmara region very limited amount. The environmental conditions and restricted feeding was reduced body measurement of this breed (Düzgüneş,1967). The Anatolian Grey is survived very difficult enviromental condition and showed resistance to illnes and pathogen from the other breeds. This breed can be lived as self sufficient in the natural environment without humankind. This breed is lived as free in the natural environment yearly round except bad winter season. The Anatolian Grey can assess to hay very well from the other breeds. The breeders of this breed is not spend a lot money for compound feed, veterinary and medicine charge (Kök, 1992). In generaly, female animals are used to product calf and female animal in 10‐12 years old and male animals in 2 years old are used to meat production. Meat producer feds male animals 6‐12 month. All animals sell to butchery or sacrificial animal at the end of this period. This breed has got low carcass percentage from the other breeds. The meat quality of this breed has low fat ratio and crisp, therefore this meat is preferred as sacrificial by some consumer. But the meat has dark colour of meat and yellow fat colour is not prefered by meat consumer because of the fact that this meat belong to old animal (Özdoğan et al., 2004). The meat of this classification is sold very difficult and th 180 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) low price, hence stockbreeder of this breed has got importand financial problem. As a result, these breeders want to cross over this pure breed with the other breed. Unfortunately, the number of this pure breed is declined very fastly in today. The government were taken some decision to support of animal breeder in 2004. According to this support carcass percentage must be 55 % and carcass weight must be 190 kg minimum. In this situation some stockbreeder of this breed were changed pure breed with crossbreed (Anonim, 2011a). The Anatolian Gray is native genetic resource of Turkey. Due to fact that the government policy must be support and protect this breed in natural life. The native breeds have got some selective avantage especialy, adaptation and genotype x environment interaction traits are more better than the other breeds. There are a lot of local breeds in the world. These breeds is well known special location. These breeds live very facile their location. For example, Kuri cattle in Cad lake, North Ronaldsay sheep in Scotland ( Ruane, 2010). For the protect to the Native Farm Animal Genetic Resources must be done some incentive precuation. Firstly, The products of these breeds must be familarize to consumer such as İberian pig meat (Anonim, 2007). Mozeralla cheese is very well known in the world. These cheese is made in only Water Buffaloe milk. This product is very valuable for Water Buffaloes and breeder of this animal. Amount of Water Buffaloes is related to this product. There are alot of local breeds in the world. These breeds want to protect like this precuation and special products as Gammelnnorsk Sau sheep, Utegangargeit goat in Norway (Raune, 2000). Global policy and Globalization is changed consumer behavier and effect on World Trade in the World. Only a few breeds is favourable for the breeder of cattle and poultry (Cohen, 1995). The Anatolian Gray has been used power draft animal for years. Present study was aimed to determine carcass percentage and carcass traits of this breed in present time. The carcass traits such as carcass weight, carcass percentage, meat/bone ratio, fat amount and fat ratio are not knowen very easy but only these parameters are estimated some equipment such as ultrason. Kendir et al., (1972), reported that fattening performance was investigated for 9 male Anatolian Gray in 16 week. Carcass percentage was estimated 57.3 % in this animal. Yücesan and Ergün (2000 a,b) were investigated fattening performance native and egzotic male animal in 2‐3 years old. The lowest carcass weight was estimated as164 kg in Native Black. This parameter was found 193.5 kg in the Anatolian Gray and bone/carcass weight ratio was found 21.2 % for this breed. The carcass weight and bone/carcass weight ratio were found 215.3 kg, 18.1 % and 243.1 kg, 18.9 % for Brown Swiss and Holstein Friesian breeds respectively. Kale (2008), was reported some carcass weight at different city (Adana, Diyarbakır, Bingöl, Erzurum, Sakarya, Van) and general carcass weight mean was found as 221 kg. Three groups were classified based on carcass weight. The live weight of three groups were found 330.9, 412.5 and 580.7 kg respectively. Hot carcass percentage were found 62.36 %, 62.44 % and 66.93 % for these groups respectively (Anonim, 2007). The fattening performance was investigated in the East Anatolian Red breed in 1.5‐2 years old along 112 days. All animals were grouped as three group and hot carcass percentage were detected as 58.92 %, 59.53 % and 59.5 % respectively (Akkılıç et al.,1976). Ulusan et al.,(1996) were found the mean of carcass weight 177 kg in 2 years old, 231 kg in 3 years old and 327 kg in 5 years old for Brown Swiss, respectively. The hot carcass percentage were found 60 %, 62 % and 60 % for the same animal respectively. For the Simmental in 3 years old was seen 343 kg carcass weight and 67 % hot carcass weight in Erzurum. The fattening performance was investigated 24 head male calf of Brown Swiss along 183 days. All animals were grouped as three group and carcass weights were detected as 600.1, 603.99 and 585.26 kg respectively and hot carcass percentage were detected as 56.64 %, 57.52 % and 57.35 % respectively (Özdoğan et al.,2005).The carcass percentage were found 58.6 % in Brown Swiss and An Investigation on the Carcass Percentage of Anatolian Grey Breed in Raised Edirne Province 181 carcass weight was found not importand to carcass percentage (Ekiz et al.,2005). The hot carcass weight and hot carcass percentage were found 179,7 kg and 55.46 % in Brown Swiss respectively ( Sağsöz et al., 2005). Akbulut and Tüzemen (1994) were investigated fattening performance at 10 head Brown Swiss, 6 head Holstein Friesian and 7 head Yellow Red. The all animals were in 8‐12 month old. The live weights were found 306.8, 338 and 324.1 kg respectively. The hot carcass weights were found 167.0, 178.6 and 175 kg and the hot carcass percentage were found 56.4 %, 54.5 and 56.1 % respectively. The live weight was found 508.71 kg, hot carcass weights were found 281.05 kg and the carcass percentage was found 55.25 in 7 head Holstein Friesian (Şahin et al.,2009). The carcass percentage was found 54.9 % in Holstein Friesian (Cooper and Willis,1984). The hot carcass percentage was found 56.60 %, 56.26 % and 55.62 % for three groups in Holstein Friesian respectively (Tunçer and Özbeyaz,2009). Altuntaş and Arpacık (2004) were studied 24 head of Yellow Red as three groups and hot carcass percentage were found 59.75 %, 60.02 % and 62.50 % respectively. These differents were found importand based on these groups (p<0.05). The hot carcass weights were found 279.80 and 315.30 kg for weak and heavy groups and carcass percentage were found 57.29 % and 57.97 % for these groups, respectively, to Holstein Friesian, (Koç and Akman, 2003). Koç ve Akman (2003) 1‐1.5 yaşlı 13 baş Siyah‐Alacalarda, 6 başı(Hafif ağırlıktakiler) 237.8 ± 3.54 gün, 7 başı (Ağır olanlar) 132.4 ± 3.61 gün yoğun besi sonunda H ve A gruplarında sıcak karkas ağırlığı ortalamaları sırasıyla 279.80 ± 22.10 kg ve 315.30 ± 10.70 kg olarak hesaplanmıştır. Karkas randımanı H ve A gruplarında sırasıyla %57.29 ± 0.94 ve %57.97 ± 0.81 olarak birbirlerine oldukça yakın bulunmuştur. 3.MATERIAL VE METHOD This study was aimed to investigate live weight and some carcass traits in Anatolian Gray, Anatolian Gray x Brown Swiss crossbred. Male and female animal were used together in Edirne and Keşan. The data were obtained from slaughterhouse in these province. Animal material was constituted from 51 Anatolian Grey bulls, 22 Anatolian Grey heifers and 63 Anatolian Grey x Brown Swiss crossbred bulls. In totaly, 136 animal were classified as three groups in 2‐3 years old in present study. All animals were cutted in 2009‐2010 years. The male animals were fed nearly 6‐12 month with grassland and concantrated feed and female animals were fed grassland very long time and fed concantrated feed with short period like 1‐2 month. Live weight were collected from all animals as kg. Water and feed were not restricted to all animals when measured live weight. %8 was not decreased from measured live weight. The carcass weight is weight of animal after slaugter and removal of most internal organs, head and skin. The carcass traits determined as carcass weight, carcass percentage, hot carcass percentage, hot carcass weight, carcass meat weight, carcass meat percentage. Hot Carcass Percentage (%)=[Hot Carcass Weight (kg) / Live Weight (kg)] x 100 Carcass Meat Percentage (%)=[Carcass Meat Weight (kg) / Hot Carcass Weight (kg)] x 100 The percentages were calculated as percent (%) and some statistics were calculated like mean, standard deviation (S), standart error (Se), coefficient of variation (CV) and coefficient of correlation (r). These statistics were calculated by Excel package programme (Microsoft Office Excel, 2003) 4.RESULTS VE DISCUSSION All results were given in Table 1. According to results , female animal were shown homogeneous structure from male animal based on coefficienth of variation to live weight and carcass weignt in Anatolian Gray. th 182 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The carcass weight based on 2009 statistics were found 178.47, 232.98, 196.64 and 257.89 kg for heifer, bullock, cow and bull respectively, in Turkey (Anonim 2011b). In the present study, the carcass weight of Heifers is lower than carcass weight of heifer and cow in Turkey. Smilarly, the carcass weight of bull is higher than bullock mean of Turkey but this value is lower than bull mean in Turkey. The anatolian Gray x Brown Swiss crossbred’s carcass weight is higher than all groups mean in Turkey. Table 1. The Some Statistics of Carcass Traits Based on Animal Groups Anatolian Gray Anatolian Gray Bull (n=51) Heifers (n=22) Anatolian Gray×Brown Swiss Bull (n=63) Mean±Standard Error Mean±Standard Error Mean±Standard Error Live Weight (kg) 446.375 ± 20.87 375.74 ± 12.92 508.29 ± 11.88 Hot Carcass Weight (kg) 248.74 ± 5.67 161.91 ± 4.57 265.98 ± 5.46 Hot Carcass Percentage (% ) 55.72 43.09 52.33 60.57 46.84 56.87 Carcass Meat Weight (kg) 204.31 ± 15.70 135.7 ± 7.43 230.77 ± 10.21 Carcass Meat Percentage (%) 82.14 83.81 86.76 Live Weight – Carcass Weight (r) 0.98 0.80 0.94 Live Weight – Carcass Meat weight (r) 0.94 0.757 0.96 Carcass Weight – Carcass Meat Weight (r) 0.968 0.974 0.99 Live Weight (CV) % 18.71 14.99 11.45 Hot Carcass Weight (CV) % 16.13 13.23 16.30 Carcass Traits Hot Carcass Percentage (%) (After % 8 decreased) Notice: r=correlation coefficient, CV= coefficient of variation The hot carcass percentage (without 8% decreased) were found 55.72%, 43.09% and 52.33% for Anatolian Gray bull, Anatolian Gray heifers and Anatolian x Brown Swiss crossbreed bull, respectively. The correlation coefficient were calculated between live weight and carcass meat weight as; 0.94, 0.757 and 0.96 for the same group respectively. The live weight were found 446.375 ± 20.87 and 508.29 ± 11.88 kg for Anatolian Gray bull and Anatolian gray x Brown Swiss crossbred bull respectively. But carcass percentage of Anatolian Gray bull was found higher than crossbred bull as 3.39%. The live weight and hot carcass percentage of heifers were found lower than bull groups. The hot carcass weight were found the highest as 265.98 kg for crossbred bull and the lowest as 161.91 heifers of Anatolian Gray . The carcass meat percentage was found 82.17 % at Anatolian Gray bull and this value were found the lower as 1.67 % than Anatolian Gray heifers. This parameter show us bone ratio in carcass of male animal is higher than female animal for Anatolian Gray. All correlation coefficient between traits were calculated as r > 0.75 and pozitive for whole groups. In generaly, using cattle to meat production are cutted at 300‐350 kg in Turkey (Arpacık, 1999). The mean of present study for this value is higher than 300‐350 kg. The hot carcass percentage (with 8% decreased from live weight) is better than result of Kendir et al.,(1972) but this trait (without 8% decreased from live weight) is lower than result of Kendir et al., (1972) as 2.1%. The carcass weight of Anatolian Gray bull is found 248.74 kg and this weight is heavier than result of Yücesan and Ergün (2000 a,b) in the same age (193.5 kg). The bone percentage is calculated as An Investigation on the Carcass Percentage of Anatolian Grey Breed in Raised Edirne Province 183 17.86% and this criteria is lower than result of Yücesan and Ergün (2000 a,b) (21.2%). The carcass traits is lower than result of Kale (2008). The hot carcass percentage was reported in East Anatolian Red by Akkılıç et al., (1976).This value is lower than Anatolian Gray bull and higher than crossbred bull and Anatolian Gray heifers. The hot carcass percentage was reported in Brown Swiss by Ulusan et al., (1996) in Meat and Fish Association (EBK). This value is similar with Anatolian Gray bull and higher than crossbred bull and Anatolian Gray heifers. The hot carcass percentage was reported in Brown Swiss by Özdoğan et al., (2005). This value is similar with crossbred bull. The result of Ekiz et al. (2005) is higher than crossbred bull and lower than Anatolian Gray bull. The hot carcass percentage was studied in Brown Swiss by Sağsöz et al (2005). This value is lower than Anatolian Gray and crossbred bull. The result of carcass percentage is found as similar with Akbulut and Tüzemen (1994). The hot carcass percentage in present study is higher than result of Şahin et al., (2009) and similar with result of Koç and Akman (2003), Tuncer and Özbeyaz (2009) and Altuntaş and Arpacık (2004).The hot carcass percentage in present study is lower than result of Ulusan et al.,(1996) and this parameter is higher than water buffaloe. This value was detected as 53.25 – 52.39 % at water buffaloe (İzgi et al., 1990). 6. CONCLUSIONS The Anatolian Gray can be used to produce healty and reliable product in Enez, Hisar mountain and around. These products are acceptable a Organic Product System. Furthermore, this product can be sold 30 % expensive from standard product (Soysal and Kök, 2006). At the same time, the meat of these animals can preferable to reared with concentrated feed animal continously (Özdoğan et al.,.2004). The conservation programmes can be protect amount of this breed to extinction like ex‐ situ an in‐situ. Especialy, the stockbreeder of this breed must obtained more avenue from this breed’s product. As a result, we have to make more study with the Anatolian Gray to show it’s meat quality, organic products and to improve it’s marketing strategies. LİTERATURE Akbulut, Ö., Tüzemen, N.,(1994). 8‐12 Aylık Yaşlarda Besiye Alınan Esmer, Siyah Alaca Ve Sarı Alaca Tosunların Besi Performansı, Kesim Ve Karkas Özellikleri. Atatürk Ü.Zir.Fak.Der.25(2),134‐144, Akkılıç, M.,Önder., E.Çetin, E., (1976).Kurutulmuş Kafes Tavuğu Gübresinin Besi Sığırı Rasyonlarında Protein Kaynağı Olarak Değerlendirilmesi. Lalahan Zootekni Araş. Ens.Dergisi. Ankara Altuntaş,M.,Arpacık,R.,(2004).Farklı Yaşlarda Besiye Alınan Simental Tosunlarda Besi Performansı ve Optimum Kesim Ağırlıkları.Lalahan Hayvancılık Araştırma Enstitüsü Dergisi,44(1):7‐16 Anonim, (2005). Hayvancılığın Desteklenmesi Hakkında 2005/8503 sayılı Bakanlar Kurulu Kararı Kararı Uygulama Esasları Tebliği (Tebliği no:2005/13) Tarım ve Köyişleri Bakanlığı Anonim, (2007). T.C. Resmi Gazete. 10.02.2007. sayı: 26430 Anonim, (2011a). http://rega.basbakanlik.gov.tr/eskiler/2007/02/20070210‐9.htm ‐ 29.2kb Anonim, (2011b). http://www.tuik.gov.tr/hayvancilikapp/hayvancilik.zul Anonymous, (2007).The State of The World’s Animal Genetic Resources for Food and Agriculture. İn Brief. FAO. Rome Arpacık, R., (1999).Entansif Sığır Besiciliği. 3. Basım. Şahin Matbaası. Ankara Cohen, J.E., (1995).Population Growth and Earth’s Human Growing Capacity. Science 269: 341‐346. Cooper M.McG, Willis, M.B., (1984).Profitable Beef Production. Farming Press LTD. U.K Düzgüneş, O., (1967) Hayvancılık. Tarım Bakanlığı yayınları.D‐III ANKARA Ekiz,B.,Koçak,Ö.,Yılmaz,A.,Güneş,H., (2005).Esmer Irk Danaların Entansif Koşullardaki Bazı Besi ve Kesim Özellikleri Üzerinde Araştırmalar. İstanbul Üniv. Veteriner Fak. Dergisi, 31(1):119‐128. th 184 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Excel, (2003). Microsoft Office Package Programme (Microsoft (R) Office Excel. Göğüş, A.K. (1986). Et teknolojisi. Ankara Ünv. Ziraat Fak. Yayınları no:991,Ders kitabı:291 Ankara. Kale, M.,C., (2008). Et Balık Ürünleri Anonim Şirketi Kombinalarında Sığır Etinin, Karkas Veya Parçalanmış Et Sürümünün İşletme gelirine Etkisi. Ankara Ünv. Sağlık Bilimleri Ens. Hayvan Sağlığı Ekonomisi Ve İşletmeciliği ABD. Doktora Tezi. Kendir,H.S., Şenel, S., Uludağ, N. (1972). İsviçre Esmeri, Bozırk ve Bunların İleri Melezlerinin Besi Kabiliyetleri ve Karkas Özellikleri. Lalahan Hay. Arşt. Enst. Dergisi, sayı: 12 , s: 39‐56. Ankara. Koç,A., Akman,N., (2003). Farklı Ağırlıkta Besiye Alınan İthal Edilmiş Siyah‐Alaca Tosunların Besi Gücü ve Karkas Özellikleri. Hayvansal Üretim 44(1): 26‐36, 26 Kök, S., (1992). Keşan‐İpsala ve Enez yöresi Bozstep Sığırı Yetiştiriciliği Üzerine Araştırmalar. Yüksek Lisans Tezi Trakya Üniversitesi Fen Bilimleri Enstitüsü Zootekni Anabilim Dalı‐EDİRNE Kök, S., (1995). Yerli Gen Kaynaklarımızdan Bozstep Irkının Korunmasının Önemi. Hasad Dergisi Sayı: 117 Şubat. İzgi, A.N., Asker, R., Çetinkaya, M., Şahin, M., Kılıç,A. (1990). Kastre Edilmiş ve Edilmemiş Genç Erkek Mandaların Besi Gücü,Kesim ve Karkas Özellikleri. Afyon Mandacılık Araştırma Enst.Yayın no:24 Özdogan, M., Bırıncıoglu, B., Önenç, A., Metın,K., (2005).Sığır Besi Rasyonlarında Kullanılan Farklı Yağ Kaynaklarının Etkılerı: I. Besı Performansı . ADÜ Ziraat Fakültesi Dergisi ; 2(1): 67 ‐ 72 Özdoğan, M., Önenç, A., Önenç, S.S., Köknaroğlu, H., (2004).Sığır Eti Kalitesi Üzerine Beslemenin Etkisi. 4. Ulusal Zootekni Bilim Kongresi, 1‐4 Eylül , Süleyman Demirel Üniv. Ziraat Fak. Zootekni Böl., Isparta. Cilt 1. Sözlü Bildiriler. 517‐523 Ruane,J.(2000) A Framework for Prioritizing Domestic Animal Breeds for Conservation Purposes at the National Level: A Norwegian Case Study. Conservation Biology, 14, 1385‐1393. Sağsöz,Y., Çoban,Ö., Laçin, E., Sabuncuoğlu, N., Yıldız, A., (2005) Esmer ve Şarole x Esmer Danaların Besi Performansı ve Karkas Özellikleri. Atatürk Üniv. Ziraat Fak. Derg. 36 (2), 163‐169, ISSN1300‐9036 Soysal,İ., Kök,S., Önal,R., (2005). Trakya Bölgesi Hayvancılığı. Trakya’da Sanayileşme ve Çevre Sempozyumu IV . 14‐15 Ekim .TMMOB Makine Mühendisleri Odası. EDİRNE Soysal,İ., Özder,M., Kök,S., Soysal,D.,(2005). Bozstep Sığırının Ekosistemindeki Yeri. Trakya’da Sanayileşme ve Çevre Sempozyumu IV.14‐15 Ekim.TMMOB Makine Mühendisleri Odası .EDİRNE Soysal,M.İ., (2004).Yerli Gen Kaynaklarımızın Korunması Sürecinde Proteomik ve Genomik Teknikler. FAO AnGR‐Tekirdağ. Şahin,A., Miran,B., Yıldırım.İ., Önenç.A., Alçiçek,A.,(2009). Fattening Costs of Beef Breeds Reared Under Controlled Conditions and the Determination of Optimum Fattening Period. Turk. J. Vet. Anim. Sci.; 33(6): 485‐492. Tunçer, Özbeyaz, (2009). Holştayn Sığırlarda, Pubertadan Sonra Farklı Sürelerde Sınırlı Yemlemenin Besi Performansı, Kesim‐Karkas Özellikleri Ve Besi Maliyetine Etkisi . Lalahan Hay. Araşt. Enst. Derg., 49(1) 1‐ 15 Ulusan,H.O.K., Solmaz,R., Ekici,Z.,(1996). Besi Sığırlarında Beden ve Karkas Özellikleri ile Aralarındaki İlişkiler.Kafkas Ünv. Veteriner Fak. Derg.Cilt:2 Sayı:1 s:7‐12 Yarkın,İ.,(1954).Türkiye’nin Çeşitli Bölgelerinde Yetiştirilen Bozstep Sığır Tipleri Üzerine Araştırmalar.Ankara Üniversitesi Ziraat Fakültesi yıllığı. Yıl:4 Fasikül:2 .ANKARA Yücesan,A., Ergün,Ö.,(2000a).Çeşitli Sığır Irklarımıza Ait Karkaslarda Değerli Et Preparatlarının Tespiti Ve Karkaslara Oranları Üzerine Araştırmalar. İstanbul Üniv. Vet. Fak.Derg.26(2), 345‐352,2000 Yücesan,A., Ergün,Ö.(2000b).Çeşitli Sığır Irklarımıza Ait Karkaslardan Kemik Ve Büyük Parça Kısımlarının Oranları Üzerine Araştırmalar.İstanbul Üniv. Vet. Fak. Derg.26(2), 483‐487, 2000 AUTOSOMAL AND MITOCHONDRIAL GENETIC DIVERSITY OF TURKISH NATIVE CATTLE BREEDS E. KURAR1*, Y. OZSENSOY1,3, M. DOGAN2, Z. BULUT2, V. ALTUNOK2, A. ISIK4, A. CAMLIDAG4, M. NIZAMLIOGLU2 Selcuk University, Faculty of Veterinary Medicine, Departments of 1Genetics and 2Biochemistry, 42031 Konya, 3 Bitlis Eren University, Bitlis, 4Cukurova Agricultural Research Institute, Adana, Turkey * Corresponding author: ekurar@selcuk.edu.tr Abstract As part of a national project titled “In vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources‐I (TURKHAYGEN‐I)”, genetic structures, evolutionary relationships and genetic diversities were investigated among six local cattle breeds in Turkey. For DNA isolation, 271 blood samples were collected from Anatolian Black, Anatolian Grey, South Anatolian Red, Southern Anatolian Yellow, East Anatolian Red and Zavot cattle breeds. A total of twenty microsatellite loci were selected from the FAO and International Society of Genetics (ISAG) panel and used for genotyping. Genetic diversities in the mtDNA control region were also investigated. A variety of statistical methods were used to asses the data for investigating diversity within and between the breeds. Phylogenetic analyses and observed genetic diversities were in agreement with evolutionary history and geographical origins of these breeds. Findings of this study may have rational application possibilities in development of conservation strategies of native cattle breeds in Turkey. Keywords: Cattle, microsatellite, mtDNA, diversity, TURKHAGEN‐I Introduction Several endemic animal breeds are totally extinct or endangered in Turkey. For example, it has been reported that fourteen local cattle breeds and types were recently lost (Ertugrul et al., 2000). Conservation of genetic resources therefore is critically important and accepted as one of the main concern. Molecular level dissection of animal populations is also important for development of conservation strategies. Molecular data for instance can provide information for estimating relatedness of animal populations. There has been great interest in molecular level genetic diversity studies in domestic animals. The previous studies based on the archaeological and genetic data have suggested that there were at least two domestication centers for cattle, sheep and goat (Loftus et al., 1994, Troy et al., 2001, Hiendleder et al., 2002, Luikart et al., 2001, Bruford and Towsend 2004). The Southwest Asia region including a part of Anatolia is accepted as the oldest domestication center where these species were spread from. Molecular genetics studies have indicated that the European cattle, sheep and goat breeds were originated and spread from Anatolia (Loftus et al., 1999, Luikart et al., 2001, Troy et al., 2001, Bruford and Towsend 2004, Cymbron et al., 2005). Since current Anatolian native animal breeds were the closest relatives of the first domesticated animals, their conservation and genetic characterization at the molecular level is critically important (Bruford amd Towsend 2004). Objective of this study was genetic characterization and determination of phylogenetic relationship of native cattle breeds in Turkey using microsatellite and mtDNA markers as part of a national project titled “In vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources‐I (TURKHAYGEN‐I)”. th 186 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Materials and methods A total of 271 blood samples were collected from Anatolian Black (AB), Anatolian Grey (AG), South Anatolian Red (SAR), Southern Anatolian Yellow (SAY), East Anatolian Red (EAR) and Zavot (ZAV) cattle. Genomic DNA samples were extracted by using a standard organic phenol/chloroform method (Sambrook et al., 1989). Microsatellite genotyping procedures were described elsewhere (Özşensoy et al., 2010). Briefly, 20 microsatellite loci were selected from a list (Hoffmann et al., 2004) suggested by FAO MoDAD and International Society of Genetics (ISAG). Primers were fluorescently labeled and three multiplex PCR systems were prepared. Each multiplex PCR was performed in 15 µl reaction volume including 1x Mg++ free PCR buffer, 0.125 mM dNTPs, 1.5 mM MgCl++, 0.375 units of Taq polymerase, 2‐15 pMol each primer and 50 ng of genomic DNA. A touchdown‐PCR profile (Don et al., 1991) was used with two steps. The first step was an initial denaturation at 95°C for 4 min, followed by 16 cycles of denaturation at 94°C for 30 sec, annealing beginning at 60°C and ending at 52°C for 30 sec and extension at 72°C for 1 min. The annealing temperature was decreased 0.5°C per cycle until it reached 52°C. At the second step, 25 cycles of 94°C for 30 sec, 52°C for 30 sec, and 72°C for 1 min was applied. The final extension of 72°C for 10 min was applied in all reactions. The resulting PCR products were prepared for capillary electrophoresis and loaded onto a Beckman Coulter CEQ‐8000 Genetic Analysis System. Allele sizes and genotypes were determined by fragment analysis. General population parameters were calculated and neighbour joining tree was drawn by using GenAlEx6 (Peakall and Smouse 2006), Population 1.2.28 (Langella 1999), TreeWiev (Page 1996), GenePop (Raymond and Rousset 1995) and GENETIX 4.0 (Belkhir et al., 1996) package programs. Breed differentiation was investigated using a Bayesian clustering approach by STRUCTURE program (Pritchard et al., 2000). Bovine mtDNA D‐loop region was amplified between positions of 15738 and 963 bp. PCRs were prepared in total volume of 60 l including 1x Mg++ free PCR buffer, 0.125 mM dNTPs, 1.5 mM MgCl++, 1.5 units of Taq polymerase, 100 ng of genomic DNA, 20 pMol forward (5’‐ CTGCAGTCTCACCATCAACC‐3’; Loftus et al., 1994) and reverse (5’‐AGGATATAAAGCACCGCCAAGTCC‐ 3’) primers. A touchdown‐PCR profile with 2 min extension was used as described above. The quality of resulting PCR products was controlled by agarose gel electrophoresis and cleaned using Bio101 Gene Clean Turbo PCR Kit (#1103‐600). The sequencing reaction was performed using Beckman Coulter DCTS Sequence Kit (#608000) according to the manufacturer’s directions. The cycle sequencing products were analyzed on a Beckman Coulter CEQ‐8000 Genetic Analysis System. DNA sequences were aligned using BioEdit v.7.09 (Hall, 1999) and analyzed by MEGA 5.0 (Kumar et al., 2008) programs. General population parameters were evaluated by DnaSP v5.0 (Librado and Rozas 2009) program. Results and Discussion In this study, autosomal diversity of Turkish local cattle breeds was implemented using 20 microsatellite loci. A total of 269 different alleles were detected. Twenty six different alleles were observed for TGLA122, but there were only 7 alleles for INRA005. In this study, the mean allele number was 9,81. The highest average observed (Ho) and expected (He) heterozygosity values were seen in EAR (0,768) and SAY (0,804), respectively. These findings were generally in agreement with studies of local (Özkan 2005, Altınalan 2005) and other (Martin‐Burriel et al., 1999, Schmid et al., 1999, Maudet et al., 2001, Beja‐Pereira et al., 2003, Radko et al., 2005) cattle breeds. The allele numbers observed in this study were generally higher than the cattle breeds located in Europe, Africa and India (MacHugh et al., 1997, Martin‐Burriel et al., 1999, Schmid et al., 1999, Maudet et al., 2001, Beja‐Pereira et al., 2003, Mateus et al., 2004, Altınalan 2005, Radko et al., 2005, European Cattle Genetic Diversity Consortium, 2006). These findings suggested that local cattle breeds of Turkey have higher genetic diversity (Loftus et al., 1999, Cymbron et al., 2005, Altınalan Autosomal And Mitochondrial Genetic Dıversity Of Turkish Native Cattle Breeds 187 2005, Özkan 2005, European Cattle Genetic Diversity Consortium, 2006). This higher genetic diversity may be the result of proximity to the domestication center (Loftus et al., 1999, Özkan 2005). Molecular data of different marker systems suggested that the cattle breeds located in Anatolia and Middle‐East region have greater genetic diversity than European, African and Indian cattle breeds (MacHugh et al., 1997, Loftus et al., 1999, Troy et al., 2001). Also, this higher genetic diversity is gradually decreased from Anatolia‐Middle East Region to Europe. A relatively lower allele numbers were observed in ZAV (Table 1), which can be the result of population characteristics and limited number of sample size used in this study. Genetic distances between the populations were calculated for evaluation of interbreed relationships among the six cattle breeds. Higher DA estimates (0,210) were observed between AG and ZAV populations however the lowest estimates (0,070) were between SAR and SAY populations (results not shown). Nei’s DA values were used to drawn Neighbor‐joining tree (NJT). NJT illustrated that SAY and SAR breeds were tightly clustered together as well as AB and EAR populations (Figure 1). However, tree of the phylogeny illustrated a clear separation of ZAV and AG from the other populations (Figure 2). Previous studies (Loftus et al., 1999, Cymbron et al., 2005) also reported that SAR, EAR and AB were clustered together. AG is positioned between European radiation and SAR‐ EAR‐AB cluster but proximal to the Anatolian populations. As typical steppe cattle, Anatolian Gray is believed to be introduced into Anatolia from Balkans. Similar steppe cattle breeds were located in Bulgaria, Romania and Greece; therefore, AG is accepted as the common cattle of the Balkans (Alpan and Aksoy 2009, Özşensoy et al., 2010). At the end of the 19th century, Russian cattle breeds were imported for upgrading beef characteristics of cattle populations located in Eastern Region of Turkey. It was also reported that Anatolian Gray cattle and Swiss Brown and its crosses were used for the same purpose in 1960s. Therefore, it is possible that influence of these breeds may affect genotypes of ZAV breed. Based on historical and morphological records, the phylogenetic tree (Figure 1) agrees with the relationship between these breeds. SAR (n=51) Na Ho He 13 0,902 0,868 10 0,686 0,737 10 0,843 0,803 13 0,843 0,854 11 0,824 0,874 11 0,529 0,769 9 0,608 0,731 12 0,804 0,797 8 0,760 0,760 13 0,725 0,847 8 0,667 0,781 18 0,804 0,875 10 0,745 0,864 5 0,745 0,707 8 0,706 0,725 19 0,765 0,820 6 0,804 0,760 12 0,843 0,847 6 0,706 0,738 8 0,843 0,836 10,5 0,758 0,800 Locus CSSM66 CSRM60 ETH03 INRA023 HEL9 ILSTS006 SPS115 ETH185 BM1818 ETH225 ETH10 TGLA53 BM2113 INRA005 HAUT27 TGLA122 TGLA126 TGLA227 BM1824 HEL13 Mean 10,6 0,761 0,803 Na 13 13 11 10 12 11 10 12 10 11 8 14 9 6 9 19 8 12 7 7 AB (n=51) Ho He 0,824 0,876 0,725 0,790 0,804 0,760 0,804 0,842 0,882 0,846 0,843 0,791 0,667 0,811 0,725 0,811 0,686 0,741 0,784 0,813 0,784 0,765 0,725 0,875 0,745 0,819 0,627 0,688 0,725 0,775 0,941 0,911 0,706 0,769 0,725 0,830 0,725 0,737 0,765 0,813 10,1 0,686 0,774 AG (n=54) Na Ho He 12 0,706 0,839 11 0,704 0,795 10 0,585 0,774 10 0,698 0,711 12 0,654 0,755 10 0,720 0,720 8 0,549 0,771 12 0,750 0,747 10 0,780 0,846 8 0,647 0,781 8 0,878 0,793 18 0,846 0,894 9 0,765 0,826 6 0,593 0,705 9 0,500 0,788 15 0,741 0,776 8 0,611 0,756 13 0,796 0,853 5 0,574 0,600 7 0,623 0,738 10,8 0,763 0,804 SAY (n=51) Na Ho He 13 0,900 0,881 12 0,784 0,759 11 0,804 0,810 11 0,820 0,823 14 0,824 0,857 9 0,620 0,750 9 0,700 0,781 13 0,745 0,803 11 0,755 0,804 9 0,706 0,817 9 0,647 0,761 19 0,863 0,892 12 0,745 0,826 4 0,706 0,695 8 0,549 0,711 17 0,824 0,874 9 0,784 0,829 13 0,902 0,873 5 0,804 0,715 8 0,780 0,813 Populations 9,1 0,768 0,786 EAR (n=45) Na Ho He 13 0,864 0,849 7 0,773 0,745 10 0,800 0,823 10 0,614 0,803 11 0,889 0,848 8 0,659 0,780 8 0,705 0,752 10 0,756 0,785 8 0,756 0,712 10 0,756 0,819 7 0,667 0,706 11 0,805 0,848 8 0,889 0,849 6 0,778 0,664 9 0,705 0,718 16 0,756 0,874 8 0,756 0,761 11 0,844 0,870 5 0,818 0,757 6 0,778 0,754 7,8 0,747 0,752 ZAV (n=19) Na Ho He 9 0,737 0,823 6 0,895 0,745 11 0,737 0,855 9 0,895 0,814 10 0,684 0,827 5 0,667 0,716 6 0,737 0,763 9 1,000 0,782 7 0,867 0,764 10 0,833 0,810 5 0,222 0,207 13 0,765 0,875 9 0,947 0,853 4 0,579 0,652 7 0,526 0,688 12 0,737 0,795 4 0,842 0,680 11 1,000 0,884 4 0,684 0,722 5 0,579 0,777 Table 1. Summary statistics showing number of observed alleles (Na), observed (Ho) and expected (He) heterozygosities th 188 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Autosomal And Mitochondrial Genetic Dıversity Of Turkish Native Cattle Breeds 189 AG ZAV SAR SAY AB EAR Figure 1. Neighbor‐joining dendrogram of genetics relationships among six cattle breeds SAR AB AG SAY EAR Figure 2. Population structure obtained by STUCTURE analyses (k=7) Figure 3. Neighbor ‐ joining tree constructed using mtDNA data ZAV th 190 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Genetic subdivision was further analyzed by model‐based clustering (Pritchard et al. 2000) using the entire data set. The most appropriate number of clustering was seven (k=7). Analysis at k=7 separated breeds into discrete clusters (Figure 2). With only a few exceptions, most of the breeds were clearly unified in their own cluster. However, AG cattle seem to be heterogeneous, resulting from presence of subpopulations based on factorial correspondence analysis (results not shown). A 415 bp part of mtDNA control region from 262 cattle were used for evaluation of general population parameters. A negative (‐2,61086) Tajima’s D value was determined (P<0,01), which suggested a population expansion in the past. Results of Fu’s F‐statistics (‐556,413) and also mismatch distribution graphs supported these findings. Phylogenetic trees were constructed using neighbor‐joining algorithm. Kimura‐2 parameter method and deletion model was used. Most individuals were closely assembled in their expected clusters (Figure 3). As a conclusion, both autosomal and maternal marker systems suggested that all the sampled breeds contained high level of genetic variability. Findings of this study indicated that current localization and historical background of these cattle breeds are in agreement with molecular data. Use of chromosome Y marker systems seems to be beneficial for characterization efforts of these cattle breeds. Acknowledgements This study and Y.Ö. were supported by TÜBİTAK‐KAMAG (106G005). REFERENCES Alpan, O. and Aksoy. A.R. (2009) Sığır yetiştiriciliği ve Besiciliği. 3. Baskı. Altınalan, A. (2005) Türkiye’deki yerli sığır ırklarının mikrosatellit DNA markırlarla genetik karakterizasyonu. Çukurova Üniversitesi Fen Bilimleri Enstitüsü, Doktora Tezi. Beja‐Pereira, A., Alexandrino, P., Bessa, I., Carretero, Y., Dunner, S., Ferrand, N., Jordana, J., Laloë, D., Moazami‐Goudarzi, K., Sanchez. A. and Canon, J. (2003) Genetic characterization of Southwestern European bovine breeds: a historical and biogeographical reassessment with a set of 16 microsatellites. Journal of Heredity 2:243‐250. Belkhir, K., Borsa, P., Chikhi, L., Goudet, J. and Bonhomme, F. (1996) GENETIX 4.00 WindowsTM software for sample genetics. Laboratoire Genome, Populations, Interactions, University of Montpellier, France. Bruford, M.W. and Towsend, S.J. (2004) Case studies in the genetics of animal domestication: sheep In: Zeder, M., Decker‐Walters, D., Bradley, D. and Smith, B.D. Eds: Documenting Domestication: New Genetics and Archaeological Paradigms, California University Press. Cymbron, T., Freeman, A.R., Isabel Malheiro, M., Vigne, J.D. and Bradley D.G. (2005) Microsatellite diversity suggests different histories for Mediterranean and Northern European cattle populations. Proceedings of the Royal Society of London B 272(1574): 1837‐1843. Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. and Mattick, J.S. (1991) Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acid Research 19(14): 4008. Ertuğrul, M., Akman, N., Dellal, G. and Goncagül T. (2000). Hayvan gen kaynaklarının korunması ve Türkiye hayvan gen kaynakları. http://www.tmmobzmo.org.tr/docs/11.doc. European Cattle Genetic Diversity Consortium. (2006) Marker‐assisted conservation of European cattle breeds: an evaluation. Animal Genetics 37(5): 475‐481. Hall, T.A. (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95‐98. Hiendleder, S., Kaupe, B., Wassmuth, R. and Janke, A. (2002) Molecular analysis of wild and domestic sheep questions current nomenclature and provides evidence for domestication from two different subspecies. Proceedings of the Royal Society of London B 269(1494): 893‐904. Autosomal And Mitochondrial Genetic Dıversity Of Turkish Native Cattle Breeds 191 Hoffmann, I., Marsan, P.A., Barker, J.S.F., Cothran, E.G., Hanotte, O., Lenstra, J.A., Milan, D., Weigend, S. and Simianer, H. (2004) New MoDAD marker sets to be used in diversity studies for the major farm animal species: Recommendations of a joint ISAG/FAO working group. 29th ISAG (International Society of Animal Genetics) Congress, 11‐16 September, 2004, Tokyo. Kumar, S., Dudley, J., Nei, M. and Tamura, K. (2008) MEGA: A biologist‐centric software for evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics 9: 299‐306. Langella, O. (1999) Populations 1.2.28 (12/5/2002): A population genetic software. CNRS UPR9034. http://www.pge.cnrs‐gif.fr/bioinfo/populations/index.php. Librado, P. and Rozas, J. (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451‐1452. Loftus, R.T., MacHugh, D.E., Bradley, D.G., Sharp, P.M. and Cunningham, E.P. (1994) Evidence for two independent domestications of cattle. Proceedings of the National Academy of Sciences, USA. 91: 2757– 2761. Loftus, R.T., Ertugrul, O., Harba, A.H., El‐Barody, M.A., MacHugh, D.E., Park, S.D. and Bradley, D.G. (1999) A microsatellite survey of cattle from a centre of origin: the Near East. Molecular Ecology 8: 2015‐2022. Luikart, G., Gielly, L., Excoffier, L., Vigne, J.D, Bouvet, J. and Taberlet, P. (2001). Multiple maternal origins and weak phylogeographic structure in domestic goats. Proceedings of the National Academy of Sciences, USA 98(10): 5927‐5932. MacHugh, D.E., Shriver, M.D., Loftus, R.T., Cunningham, P. and Bradley, D.G. (1997) Microsatellite DNA variation and the evolution, domestication and phylogeography of taurine and zebu cattle (Bos taurus and Bos indicus). Genetics 146: 1071‐1086. Martin‐Burriel, I., Garcia‐Muro, E. and Zaragoza, P. (1999) Genetic diversity analysis of six Spanish native cattle breeds using microsatellites. Animal Genetics 30: 177‐182. Mateus, J.C., Penedo, M.C., Alves, V.C., Ramos, M. and Rangel‐Figueiredo T. (2004) Genetic diversity and differentiation in Portuguese cattle breeds using microsatellites. Animal Genetics 35(2):106‐113. Maudet, C., Luikart, G. and Taberlet, P. (2001) Genetic diversity and assignment tests among seven French cattle breeds based on microsatellite DNA analysis. Journal of Animal Science 80: 942‐950. Özkan, E. (2005) Türkiye’de yetiştirilen yerli ve kültür sığır ırklarının genetik yapılarının mikrosatelitler ile incelenmesi. Trakya Üniversitesi Fen Bilimleri Enstitüsü. Doktora Tezi. Özşensoy, Y., Kurar, E., Doğan, M., Bulut, Z., Altunok, A., Işık, A., Çamlıdağ, A. and Nizamlıoğlu, M. (2010) Türkiye’de bulunan bazı yerli sığır ırklarının STR markörler ile genetik karakterizasyonu. Biyoloji Bilimleri Araştırma Dergisi 3(1): 163‐171. Page, R.D.M. (1996) TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12: 357‐358. Peakall, R. and Smouse, P.E. (2006) GenAlEx6: Genetic analysis in Excel, Population genetic software for teaching and research. Molecular Ecology Notes 6: 288‐295. Pritchard, J.K., Stephens, M. and Donnelly, P. (2000). Interference of population structure using multilocus genotype data. Genetics 155: 945‐959. Radko, A., Zyga, A., Zabek, T. and Słota E. (2005) Genetic variability among Polish Red, Hereford and Holstein‐ Friesian cattle raised in Poland based on analysis of microsatellite DNA sequences. Journal of Applied Genetics 46(1): 89‐91. Raymond, M. and Rousset, F. (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86:248‐249. Sambrook, J., Fritsch, E.F. and Maniatis T. (1989). Molecular clonning: A laboratory manual. Second Edition, Cold‐Spring Harbor, New York, USA. Schmid, M., Saitbekova, N., Gaillard, C. and Dolf, G. (1999) Genetic diversity in Swiss cattle breeds. Journal of Animal Breeding and Genetics 116: 1–8. Troy, C.S., MacHugh, D.E., Balley, J.F., Magee, D.A., Loftus, T.R., Cunningham, P., Chamberlain, A.T., Sykes, B.C. and Bradley, DG. (2001) Genetic evidence for Near‐Eastern origins of European cattle. Nature 410: 1088‐1091. ONE OF THE NATIVE ANIMAL GENETIC RESOURCES AND ITS IMPORTANCE IN ANIMAL HUSBANDRY: ZAVOT CATTLE Sadrettin YÜKSEL Erdoğan SEZGİN Sinan KOPUZLU Abstract: Zavot cattle is a native breed grown in the cities Kars and Ardahan, which is rearing for milk and meat production. It is obtained by crossbreeding between Simmental, Brown Swiss and Eastern Anatolian Red cattle breeds. Simmental and Brown Swiss cattle breeds were brought by German and Molokan families who settled in Kars‐Caucasia regions at the beginning of 18th century. The breed colour is white and white scale. The structure of their horn is curvy upward and exists both in genders. They have adapted perfectly to the climatic conditions of the region. Keywords: Zavot, cattle, animal genetic resources Introduction Raising livestock is an activity which has started since the hunting of wild animals(Macerand Yokoyama,1998), and has greatly contributed to human life both as a supply of meat, milk, egg, pulling force and as a support to the sociallife with wool, skin(leather) and hornsfor about 12000 years(Anon,2004). The level we have reached today shows that this importance will increase more since the increase in needs parallel to World population makes it a necessity to increase production and productivity. In order to survive human life and grow healthy generations, animal foodstuff is necessarily needed. However, researches show that 1/3 of the farm animals in the World are under the risk of extinction and that about six breeds are on the verge of disappearence each month(Anon,1998). In the process of development, by means of the effects of lots of factors such as climate,geography, economic opportunities, development level and consumption habits, various methods have been applied and a certain level has been reached in stock‐breeding. However, the rapid changes in social,political and economic life in the World started to restrict the production and thus increased suspicion of productivity loss. These worries has put forward the question whether the high productivity obtained as a result of intensification studies will be sustainable or not. Contrary to any negativeness to be experienced at present or in future, great hopes are set on domestic animal breeds. It is known that about 4500 local types belonging to more than 40 breeds are protected by breeders living in rural areas (McCorcle,1999). There are nativebreeds belonging to lots of types of cattle, sheep and winged animals which adapted to their environment in our country. One of these is Zavot cattle living in Kars and Ardahan provinces. In this study, Zavot cattle will be studied from different aspects. a. Past, living environment and definition of the breed Zavot Cattle is a native breed grown commonly in Kars and Ardahan provinces. It derived its name from the word Zavot meaning “milk factory” or “dairy”. Germans and Molokans who situated and involved in agricultural activities like dairy, milling, gardening and apiculture(Türkdoğan,2005) in Kars‐Caucaisa region at the begining of 18th. Century contributed greatly to the regional agriculture and animal raising. They hired the milk cows of the regional breeders in the dairies they established and manufactured world famous Gruyere and Kosher cheese by means of the milk they obtained from these cows. Besides, they mated these cows with the culture breed buls they brought together with themselves(Batu,1962). These crossbreedings were the first steps in the creation of Zavot Cattle though this was not a planned methodology. th 194 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) A great majority of German families who situated in Caucasia in 1817‐1819 because of their belief lived in villages and involved in farming (Bozkuş,2006). Begining from 1840, Molokan familiy from the inner parts of Russia(Türkdoğan,2005), and at the end of 1877‐1878 Ottoman‐Russia war, German families from the border of Estonia(Anonymous,2008) were situated in Caucasia region, primarily in Kars province, by the demand of Russian Government. German and Molokan families located in the region brought Simmental and Brown Swiss cattle together with them. As a result of crossbreeding of these cultural breeds with the domestic Eastern Anatolia Red Cattle hired by the dairies(Üresin,1936), Zavot Cattle was produced. It is thought that certain amount of blood of Podolya breed brought by Molokans mixed with crossbreeds(Batu,1962;Üresin,1936). These crossbreeds which did not have a pecularityat first, were defined as a breed obtained as a result of mixing of Simmental, Brown Swiss and native Eastern Anatolia Red Cattle and owned a characteristic. Zavot Cattle entered took its place in “Cattle Breeds of the World‐Index” and “European Association for Animal Production(EAAP),Breed Description” as a cattle breed obtained as a result of the crossbreeding of Simmental, Brown Swiss and Eastern Anatolia Red Cattle. Zavot Cattle, as understood from the meaning of its name, are improved primarily for milk production. Its milk production is higher than the other native breeds of the region. It gains great importance in the manufacture of Kars Gruyere cheese because of %4 of fat ratio in milk(Alpan,1990;Üresin,1936). Besides, this breed also has an important potential from the point of meat production. So, Zavot has been defined as a combined productive breed because of getting benefit from meat, milk and pulling force when needed. Its colours are white and white tints, with a light colour of skin and white hair. Dark or brown ones can also be encountered. However, the preferences in years and partial selection have made the dominant colour complete white and its tints fixed. In females, skin is softer and more elasticated than the other domestic breeds, and its nipple structure is more developed. The head forms a thin in nose part, and a flat line in horn part. The forehead is flat, and its very hairy in males. Both genders have a horn structure of black or light colour, twisted‐up horns. Upper lips black or light colour view. This breed which has a good constitution has a uniford body structure. It has a calm mood and a good maternity. Resistance to environmental conditions is a little bit lower than that of Eastern Anatolia Red Cattle, but fattening capability is better than Eastern Anatolia Red Cattle(Alpan,1990;Ilaslan and et al.,1983;Üresin,1936).On condition that the environmental conditions are improved, this breed can exhibit a high performance. It shows variations in some pecularities among the breeding regions. b. The Importance of Zavot Cattle b.1.As a Native GeneticResource Zavot bears an important value as a genetic source. However,uncontrolled matings, unconscious breeders, not taking under timely protection and dense migrations from the region, greatly lessened it in number and even brought it into extenction point. On the other side, some faults in practices have also been influential in this matter. For example, the best males of the breed forming the most part of the animal population of the region were used for their pulling force, that is as ox, and the most charming females were used for butchery until mechanization started in agriculture. In short, the best were wasted. Thus, the improvement of the breed individually, and the spreading as herd were prevented. It is difficult to anticipate what animals having which characteristics will be needed, which characters will emerge or which will not emerge in these animals,to what point intensification will reach, how the activities will go on in regions not intensified, in short what will happen to human kind(Ertuğrul et al.,2000). For these reasons, it is vital to protect and to transfer to the next generations the native breeds which are productive and survive for centuries despite all negative environmental conditions. The supply of roughage(natural feed) and intense feed(artificial feed) is on the verge of bottleneck because of changing atmospherical movements and differing climate One Of The Native Animal Genetic Resources And Its Importance In Animal Husbandry: Zavot Cattle 195 conditions due to these movements. Together with the increase of barrening and unyielding soil, the survival opportunity and productivity of high yielding culture breed animals will become more difficult. This difficulty will lead to the restriction and even the disappearance of human food such as meat and milk, and thus it will threaten the life of mankind considerably. Fort his reason, protection of native Zavot cattle as a geneticresource can be productive in every kind of negative environmental conditions and can survive in poor quality pastures and rough areas will help the formation of national animal policy, and will serve greatly to the social and cultural structure of the people in region. In fact, breeders have developed a model special to the region, and this model have formed an important part of their culture. Besides, if native animal breeds survive, their some characteristics not defined until now may be brought to light, and thus, it will contribute the human life (Ertuğrul et al.,2000). b.2.From The Point of Animal Raising Some measurement about Zavot Cattle grown in different establishments are given in Table 1, table 2 and table 3. Kars and Ardahan provinces, the living area of Zavot Cattle, are geographically situated on plateaus, high mountains, lakes and bumpy land. The plant cover mostly have a steppe characteristic. Besides, it is rich in meadow, pasture and plateau which are important sources of natural feed. Field agriculture can also be done to some extent. Cultivable lands were processed manually for years, and male Zavot Cattle having strong form were used. While there were totally 181.434 cattle in Kars in 1927, and 78212 of them, that is, about 43% of them were used as pulling animal (Üresin,1936). This situation continued up to the end of 1970’s, and partly continues today. This shows that Zavot replaced the machinery in agriculture of the region. The region has wide pastures. These areas can best and productively used for grazing. The slopped pastures which are not suitable for culture and crossbred breeds can easily be used by Zavot Cattle, and thus the most important need of the establishment as feed lessens. On the other hand, cereal planting forms the important part of field agriculture in region. For this reason, it is possible to see wheat straw in establishments in great amounts. It is used by Zavot Cattle though its nutritious value is poor and it is a poor quality feed. There is a half nomadic animal raising activity in the region. The animals released to pastures in spring are taken in the evening. In summer, youngbulls, heifers and calves are taken in completely, milked cows only in milking hours.Other time, they are all in plateaus.Shelters do not create a problem in summer, but in winter all animals are taken to the barns.These barns do not have enough illumination and air conditioning, and they are very simple and primitive.However, Zavot cattle can lead their lives without beinh affected by some harmful gases(Karademir,2004)in these barns. Worldfamous Gruyere cheese production is an important economical activity in Kars and Ardahan region.Though lessened in number recently, private establishments or villagers produce this cheese with special methods.Milk of Zavot is very important in the production of this cheese.The ratio of fat in their milk being 3.7‐4%(Alpan,1990;Üresin,1936) makes it important in the production.This ratio is higher than it is in culture animals.Besides, Zavot cattle, though not as much as the other native cattle Eastern Anatolia Red, are resistant to some diseases and poor environmental factors.These peculiarities lessen the expendutires in raising as well as make it easier. Conclusion a.It is necessary to put the application, models and methods into effect to ensure the promotion and marketing of the products provided from these animals, to make the raisers conscious about these matters by handling Zavot cattle breed seriously which has become a part of the social life and cultural structure of the region, without destroying the blood degree of the animal much more. th 196 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) b.The population of this breed, which do not necessitate a special maintenance, feeding and raising conditions, should be increased under control, and an inventory survey should be carried out. c.Some precaution should be taken against the bottlenecks in the process of intensification in the region. d.Planned animal raising programs should be applied fort his breed which can provide a great productivity if environmental conditions are improved. Table 1. Measurements in some periods of the Zavot cattle Male Female Birth weight (kg) 19‐28 17‐24 Adult body weight (kg) 400 ‐ 650 270‐500 Daily weight gain (g) 900‐1000 700‐850 Using the first of the age of breeding (ay) 24‐30 17‐27 Table 2. Body measurement of Zavot cattle for different times Birth Three month age Adult age Male Female Male Female Male Female Body length (cm) 61 60.5 85 86.1 127‐164 117‐143 Height at withers (cm) 59 59 85.3 87.3 122‐137 102‐130 Chest depth (cm) 19 18.6 38.4 39.7 69.4 65.10 Chest width (cm) 12.2 11.5 19 19.7 34.7 30.74 Hearth girth (cm) 63.1 62.5 99.5 102.2 189 160.5 Hindquarters height (cm) 63.6 63.5 92.3 92.2 134.4 119.2 Front shin girth(cm) 9.5 9.5 11.65 12.25 24 Table 3. Milk yield and the composition of milk in Zavot Cattles Factors Ratio Fat (%) 3.7‐4 Protein (%) 3.3‐3.4 Lactose (%) 4.76‐5.1 Ash (%) 0.80‐0.89 pH 6.30‐6.4 Without fat dry matter (%) 9.89‐10.5 Milk yield in lactation (kg) 2300‐2600 Lactation length (day) 275‐285 22 One Of The Native Animal Genetic Resources And Its Importance In Animal Husbandry: Zavot Cattle 197 REFERANCES Alpan O, 1990. Sığır Yetiştiriciliği ve Besiciliği. Medisan Yayın No: 3, 1. Basım, s: 45, Ankara. Anoniymus, 2004. Evaluation Report of “The Study on the Relationship Between Indigenous Farm Animals and Humans in APEC Region.” The 8th Plenary Meeting of the Agricultural Technical Cooperation Working Group June 15‐18, Chiang Mai, Thailand Anonim 2008. Kars Kent Rehberi. Kars. Batu S, 1962. Türkiye Sığır Irkları ve Sığır Yetiştirme Bilgisi. Ankara Üniversitesi Basımevi, 3. Baskı, s: 116‐117, Ankara. Deveci Bozkuş Y, 2006. Ermenistan'ın Demografik Yapısı ve Ermenistan'da Azınlıklar. Ermeni Araştırmaları, Üç Aylık Tarih, Politika ve Uluslararası İlişkiler Dergisi, Sayı 23‐24. Ertuğrul M, Akman N, Dellal G, Goncagül T, 2000. Hayvan Gen Kaynaklarının Korunması ve Türkiye Hayvan Gen Kaynakları. Türkiye Ziraat Mühendisliği 5. Teknik Kongresi (2. Cilt) Yayın No: 38, Ankara. İlaslan M, Geliyi C, Çakır A, 1983. DAK, Esmer X DAK, Simmental X DAK, F1, Zavot Erkek Danaların Besi Gücü ve Karkas Özellikleri Üzerine Araştırmalar. Deneme ve Üretme İstasyonu, Yayın No: 10, Kars. Karademir B, 2004. Kış Mevsiminde Kars Yöresinde Zavot Sığırlarının Genel, Yaş ve Cinsiyete Göre Venöz Kan Gazı Değerleri. F.Ü. Sağlık Bil. Dergisi, 18(1): 35‐39. Macer, D.R.J., Yokoyama, K., 1998. Human relationships with animals in Asia Pacific countries and bioethics. Bioethics in Asia, p:324‐337. McCorkle, C.M. 1999. Africans manage livestock diversity, COMPAS Newsletter ‐ October, USA. Türkdoğan O, 2005. Kars'ta bir etnik grup Malakanlar'ın toplumsal yapısı. IQ Kültür Sanat Yayıncılık. 1. Baskı. Üresin E.R, 1936. Kars Sütçülüğü Hakkında Tetkikler. T.C. Yüksek Ziraat Enstitüsü Çalışmalarından, Sayı: 14, s: 16, Ankara. DETERMINATION OF SOME MORPHOLOGICAL STRUCTURE, BODY SIZE AND GROWTH PROPERTIES OF HEMŞIN SHEEP GROWN IN ARTVIN E.SEZGİN1*, S. KOPUZLU2, S. YÜKSEL1, N. ESENBUĞA3, Ö.C. BİLGİN3 3 1 East Anatolian Agricultural Research Institute‐Erzurum‐Turkey 2 Atatürk University Narman Vocational School‐Erzurum Turkey Atatürk University Agricultural Faculty Animal Science Department‐Erzurum‐Turkey * Corresponding author: esezgin25@hotmail.com ABSTRACT This study aimed at increasing live weight, reproductive performance and survival rate of Hemşin sheep grown by local people in a breeding program in Artvin province between 2006 and 2010. During the breeding program, three groups of flocks were formed: elite, intermediate elite and base. In the first 5‐year period, birth weight, live weights at the beginning and end of pasture season, daily live weight gains, survival rate and some reproductive performance properties of the lambs were discussed. The effects of some agents such as gender, birth type, mother age and year on these factors were also examined. By determining the degrees of inheritance belonging to the properties in question and calculating the breeding values of the lambs in the fifth year, the study started to reserve male and ewe lambs for breeding according to their breeding values as well as morphologic properties. Key words: Hemşin, breeding, reproductive, growth, the degree of inheritance ÖZET Bu çalışma, 2006–2010 yılları arasında Artvin İlinde yetiştirilen Hemşin Koyun Irkının halk elinde ıslah programında canlı ağırlık, döl verimi ve yaşama gücünün artırılması amaçlanarak yürütülmüştür. Islah programında sürüler elit, ara elit ve üst sürüler oluşturulmuştur. İlk beş yılık periyot da kuzuların doğum ağırlığı, mera başı ve mera sonu yaşlardaki canlı ağırlıkları, günlük canlı ağırlık artışları, yaşama gücü özellikleri ve bazı döl verim özellikleri ele alınmıştır. Bu faktörler üzerine cinsiyet, doğum tipi, ana yaşı ve yıl gibi etmenlerin etkileri de incelenmiştir. İncelenen özelliklere ait kalıtım dereceleri tespit edilerek 5. yılda kuzuların damızlık değerleri hesaplanarak morfolojik özelliklerin yanı sıra damızlık değerlerine göre de erkek ve dişi kuzular damızlığa ayrılmaya başlanmıştır. Anahtar Kelimeler: Hemşin, ıslah, döl verimi, büyüme‐gelişme, kalıtım derecesi. INTRODUCTION The breeding studies in sheep husbandry have two basic purposes. The first is to breed new races appropriate for regional conditions by using indigenous and foreign races, and the second is to grow indigenous races as purebred and select the superior ones with regard to properties investigated (Kaymakçı ve Taşkın, 2008). According to data obtained from properties investigated in this field and registration system, the breeding studies were launched in Turkey a few years ago. The undisciplined breeding programs in all sheep races grown along with these studies were carried out within a particular program. Through this program, the indigenous races initially underwent a stage to get purebred samples. Then, the superior samples in each race in terms of outstanding features th 200 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) were selected and they were kept in the flocks. When the data obtained each year reached a considerable amount of stack, it was processed to achieve a selection in terms of offspring performance as well as achieve a phenotypic selection. Our sheep races grown by local people under different breeding models are losing their purebred degrees through uncontrolled hybridization day by day even though this losing process is in different degrees on the basis of races. However, it is possible to achieve a real yield capacity in indigenous purebred sheep races and increase the yield per sheep by considering the performance properties and growing traditions and designing appropriate breeding and growing programs. Within this context, the structuring required to improve the indigenous genetic resources was implemented and new projects were put into practice in growing areas with the participation of non‐ governmental organizations. Turkey has a total of 21.74 million sheep stock (TUİK, 2010). 20.7 million of this total is indigenous race (97% of the total) and 1.1 million is merino. Akkaraman and Morkaraman sheep make up our sheep stock. However, despite in small numbers, various sheep races and gene resources are grown in different regions. One of these indigenous gene resources is Hemşin sheep race with combined performance property, grown widely in North East Anatolia region. The total number of Hemşin sheep in its growing area is approximately 54.924 (Anonymous 2010). Hemşin sheep has also been under the effect of a quantitative decline in our country due to various reasons. Its number has started to decrease along years. This decline is a sign that substantial measures should be taken soon, as well as a sign that this race is in danger of extinction. This project aimed at launching breeding practices in flocks under grower conditions in Artvin province and providing the sheep growers in the region with superior quality breeding sheep and rams with regard to their growth and development properties. In addition, the project also intended to create registered flocks owned by local people and promote the establishment of this race‐specific growing union and finally increase the grower income and profit. MATERIAL AND METHOD Material 6000 ewes mated and 300 rams, Hemşin race grown by local people in the region, made up the animal material of the study. 5300 of the total was classified into base group (flock for breeding), 700 into intermediate elite and 300 into elite. All the records to be taken up in elite, intermediate elite and base flocks were managed by contracted technical staff according to a plan created by project implementers. Method Records and Live Weight Controls for Various Periods Plastic numeral labels were attached to both ears of study material sheep at the beginning of the project and lambs soon after their births. The lambs in all flocks were weighed on a 100 g sensitive scale within 24 hours following the birth. The features recorded were as follows: ear numeral of the mother, date of birth, age of mother, birth method and gender of the lambs, mating period, birth, live weights at the time of weaning or at the beginning and end of pasture season, live weight at one year and live adult weight, and the number of animals at the beginning and end of pasture season and the number of those reaching one year. The number of lambs born per ewe mated, twin reproduction rate or survival between beginning and end of pasture season and the live weight gains during these periods were determined. The lambs born were standardized according to their live weights at the end of pasture season (6 – 6.5 months), and macro environmental factors such as mother age, birth type, gender and operational factors. Then, the breeding values were determined according to the results of the performance obtained. For the inheritance degree to be used for determining the breeding value for live weight at the end of pasture season (Esenbuga, 2001), the inheritance degree to be determined Determination Of Some Morphological Structure, Body Size And Growth Properties Of Hemşin Sheep Grown In Artvin 201 in the flock as of second year was used. Manuel mating method was applied in elite and intermediate elite flocks during the mating period. In base flock, random and natural mating methods were applied. Search rams were used for determining the heat so that the manual mating could be carried out healthily. a) Results regarding the introduction of rams and lambing Twin reproduction rate (%) = twin lambing sheep / lambing sheep The number of lambs per ewe mated (Fecundity) = Lambs born / ewe mated The number of lambs per lambing sheep (Litter size) = Lambs born / lambing sheep b) Results regarding survival rate Survival rate at the beginning of pasture season (%) = the lamb at the beginning of pasture season / lamb born Survival rate at the end of pasture season (%) = the lamb at the end of pasture season / lamb born Statistical Analysis The data obtained from the records of the growers and the controls carried out in the scope of the project were statistically analyzed using SAS (1999) software. Harvey (1990) and DF‐REML (Meyer, 1989) software packages were used to estimate the basic parameters. The development of selection models was based on open nucleus breeding system (James, 1979; Roden, 1994). FINDINGS AND DISCUSSION The project was carried out with a total of 6300 animals (6000 sheep and 300 rams) and 22 growers in 3 provinces in 2006. It lasted for 5 years (Table 1). When table 2 is examined, it can be seen that the number of sheep lambing twins and the related twin reproduction rate increased from 2007 to 2009, however it decreased in 2010. This decrease was mostly seen in base flocks and it was also observed in the entire flocks significantly. The overall average of twin reproduction rate in all years was calculated as 4.6%. Table 1. The distribution of the number of growers and animal material with respect to counties Counties / The number of growers Sheep Ram Total villages ARDANUÇ 19 4830 250 5080 BORÇKA HOPA TOTAL 1 2 22 230 940 6000 10 40 300 240 980 6300 1.Some Mating and Reproductive Performance Properties While the number of total lambs born in the last two years yielded values close to each other, the number of lambs per ewe mated in 2010 was 99.2 and the number of lambs born per sheep lambing in 2009 was 109.43. The overall average of lambs per ewe mated in flocks was determined to be 97.1 % and the overall average of the lambs born per sheep lambing was found to be 105.3. When the lambs were 94.41 days old, they were taken to pasture and kept in the pasture for 69,96 days. While the survival rate at the beginning of the pasture season was the highest in 2007 with 99 %, it yielded quite close values in other years. The survival rate between the beginning and end of the pasture season yielded only a 0.9 % decline as few lambs died during this period. th 202 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. Some mating and reproductive performance properties for all flocks PROPERTY / YEARS 2007 2008 2009 2010 OVERALL The number of sheep 6000 6000 6000 6000 24000 The number of rams 300 300 300 300 300 The number of sheep lambing 5511 5529 5400 5712 22152 The number of sheep lambing twins 104 192 472 244 1012 Twin birth rate (%) 1,9 3,5 8,7 4,3 4,6 The number of lambs born 5718 5722 5909 5954 23303 Male 2951 2901 3060 3060 11972 Ewe 2767 2821 2849 2894 11331 The number of lambs per lambing sheep 103,8 103,5 109,43 104,2 105,3 95,4 95,4 98,5 99,2 97,1 The number of lambs per ewe mated The number of lambs dying (up to the beginning of pasture season) Survival rate % (up to the beginning of pasture season) The number of lambs dying (up to the end of pasture season) Survival rate % (up to the end of pasture season) 59 103 70 68 300 99,0 98,2 98,8 98,9 98,7 75 164 133 136 508 98,6 97,2 97,7 97,7 97,8 2.Live Weight 2.1 Birth weight The overall average birth weight was 3.57±0,026 kg. This average was determined to be 3.64±0,026 kg in male lambs and 3.51±0,026 kg in ewes. When the color factor was considered, the highest birth weight was determined in lambs born from sheep with pied color and the lowest was found in lambs born from sheep with black color. Regarding the flock type, the birth weight was determined as 3.96±0,030 kg, 3.46±0,027 kg and 3.30±0,026 kg in elite, intermediate elite and base flocks respectively. Twin and triplet births were observed in Hemşin sheep flocks. Regarding the birth weight, single born lambs yielded the highest value, whereas twin and triplet born lambs yielded birth weight values close to each other. Regarding the birth weights over the years, the highest value was obtained from births in 2010 (3.65± 0,026 kg). A 0.06 kg increase was observed in 2010 in comparison with the previous year. The effect of gender, mother age, color, flock type, birth type and years on birth weight was determined to be statistically highly significant (P<0.01). 2.2.Weight at the beginning of pasture season The overall average live weight in flocks up to the time (94,4 days) before going to pasture was determined to be 28.09± 0,085. The average live weight at the beginning of pasture season was found to be 28.41±0,089 kg and 27.79±0,089 in males and ewes respectively. While the weights of lambs from sheep having white and pied wool at the beginning of pasture season yielded similar results, the same value for lambs from sheep having black wool was the highest at the beginning of pasture season with 28.22 ±0,083 kg. Regarding this property, the highest live weight value was determined in intermediate elite flocks (29.28±0,102 kg) and the lowest was obtained from elite flocks (27.20±0,028 kg). Birth weight at the beginning of pasture season was determined the highest in single born lambs with 27.42±01,042 kg. Average live weight at the beginning of pasture season between 2007 and 2010 was found to be the lowest in 2009 (22.65 ± 0,1 kg) and it was the highest in 2010 (34,98± 0,09 kg). The low value determined in 2009 can be due to Piyeten disease animals caught because of mud in the barns caused by heavy precipitation along the year. The effect of gender, mother age, color, flock type, birth type and average live weight at the beginning of pasture season over years were found to be statistically highly significant (P<0,01). The variability observed in these weights stemmed from the improvement in care, feeding, and barn conditions. Determination Of Some Morphological Structure, Body Size And Growth Properties Of Hemşin Sheep Grown In Artvin 203 2.3. Weight at the end of pasture season While the overall average live weight at the end of pasture season (164.4 days) was determined as 39.27± 0.187 kg, this value was found as 39.95±0.190 kg and 38.58±0.190 kg in males and ewes respectively. The average live weight at the end of pasture season in lambs born from sheep with white wool was found as 39.39± 0.187 kg, which was higher than that of lambs born from sheep with black or pied colored wool. When the flock type is considered and the average weights at the end of pasture season are ranked in ascending order, the values are ranked as 37.96±0.143 kg in intermediate elite, 39.14±0.094 kg in elite and 40.72±0.497 kg in base flocks. The twin born lambs yielded the highest weight value (41.19± 0.194 kg) at the end of pasture season. They were determined to have 2.94 kg and 2.78 kg more live weight gains than single and triplet born lambs respectively. The average weights at the end of pasture season along the period from 2007 to 2010 were found to increase. This increase at the end of pasture season between 2007 and 2010 was highest in 2010 and lowest in 2009. The difference between the lowest and highest value was 5.22 kg. The increase was meaningful in achieving the goals of the breeding program. The differences between gender, mother age, color, flock and birth type and years and average weight at the end of pasture season were found to be statistically highly significant (P<0,01). 3.Daily Live Weight Gains 3.1 Daily Live Weight Gains up to the Beginning of Pasture Season Average daily live weight gains in overall flocks in sheep fold up to the beginning of pasture season was determined to be 266.38±1.311 g. It was 269.94±1.382 g and 262.81±1.385 g in males and ewes respectively; 269.90±1.307 g in lambs with white wool, 268.43±1.290 g in lambs with black wool and 260.80±2.054 g in pied colored lambs; 233.50±1.986 g, 311.4±1.572 g and 253.89±1.188 in elite, intermediate elite and base flocks respectively; 265.87±1.009 g, 253.89±2.189 g and 264.79±1.245 g in single, twin and triplet born lambs respectively; 226.97±1.626 g, 260.99±1.626 g, 254.01±1.549 g and 323.68±1.482 g in 2007, 2008, 2009 and 2010 respectively. The effect of factors influencing average daily live weight gains up to the beginning of pasture season was found to be statistically highly significant (P<0,01). Flock Type Overall 356 1489 3223 4631 4961 3327 2847 2367 23303 11972 11331 N c b c a 3,64±0,044 c 3,50±0,026 b 3,62±0,030 d 3,45±0,025 d 3,53±0,026 c b 3,57±0,027 b 3,56±0,027 c ** 3,57±0,026 a 3,64±0,026 b 3,51±0,026 ** b 3,57±0,028 344 1384 3022 4452 4858 3275 2769 2234 22402 11511 10891 b d 27,71±0,239 27,94±0,130 c cd 27,90±0,093 cd 27,87±0,080 bc 28,38±0,091 28,19±0,079 e b 27,49±0,096 28,91±0,105 a ** 28,09±0,085 a 28,41±0,089 b 27,79±0,089 ** 325 1277 2615 3897 4491 3128 2583 2134 20510 10442 10068 Average Weights for Different Periods (kg) BW WBPS N N X ± Sx X ± Sx b d 39,09±0,309 de 38,89±0,216 bc 39,39±0,192 c 39,17±0,186 c 39,26±0,187 39,51±0,193 bc de 38,64±0,196 a 39,84±0,203 ** 39,27±0,187 a 39,95±0,190 b 38,58±0,190 ** X ± Sx WPS 344 1384 3022 4452 4858 3275 2769 2234 22402 11511 10891 N f c 256,65±3,701 d b 269,07±1,446 c 266,86±2,009 d c 267,18±1,224 c 266,79±1,245 262,53±1,407 e d 257,70±1,487 a 282,91±1,631 ** 266,38±1,311 a 269,94±1,382 b 262,81±1,385 ** 325 1277 2615 3897 4491 3128 2583 2134 20510 10442 10068 f c 213,34±2,351 d 218,77±1,643 b 223,77±1,461 c 221,23±1,412 c 220,62±1,419 219,53±1,466 e cd 214,23±1,492 a 234,04±1,543 ** 220,64±1,423 a 225,22±1,442 b 216,05±1,445 ** 325 1277 2615 3897 4491 3128 2583 2134 20510 10442 10068 Average Daily Live Weight Gains for Different Periods (g) DLWGBPS DLWGEPS N N X ± Sx X ± Sx Sx 159,03±6,998 cd f g e 154,51±4,890 161,12±4,349 b 164,06±4,203 c 163,73±4,224 d 162,25±4,365 de 161,67±4,442 a 172,36±4,594 ** 162,48±4,237 a 170,16±4,292 b 154,79±4,302 ** ± DLWGDPS X 10> 68 3,72±0,087 64 28,49±0,535 60 39,59±0,607 64 267,71±8,282 60 220,18±4,611 60 163,58±13,727 COLOR ** ** ** ** ** ** ** b b a a a a White 10361 3,56±0,026 9941 28,04±0,084 9007 39,39±0,187 9941 269,90±1,307 9007 222,19±1,420 9007 165,80±4,226 b a b b b c Black 11317 3,55±0,026 10877 28,22±0,083 10008 39,29±0,187 10877 268,43±1,290 10008 220,76±1,418 10008 158,73±4,222 a b c c c b Pied 1625 3,62±0,031 1584 28,04±0,133 1495 39,11±0,219 1584 260,80±2,054 1495 218,95±1,661 1495 162,88±4,945 FLOCK TYPE ** ** ** ** ** ** a c b b c b Elite 1824 3,96±0,030 1796 27,20±0,028 1758 39,14±0,094 1796 233,50±1,986 1758 206,80±1,634 1758 164,83±4,864 b a c c a c Intermediate elite 3879 3,46±0,027 3712 29,28±0,102 3275 37,96±0,143 3712 311,74±1,572 3275 240,71±1,477 3275 155,93±4,395 c b a a b a Base 17600 3,30±0,026 16894 27,82±0,077 15477 40,72±0,497 16894 253,89±1,188 15477 214,39±1,418 15477 166,68±4,222 BIRTH TYPE ** ** ** ** ** ** a a c a b c Single 21206 3,91±0,014 20453 27,42±1,042 18841 38,25±0,215 20453 265,87±1,009 18841 217,89±0,715 18841 151,67±2,129 b c a c c b Twin 1983 3,40±0,020 1853 25,73±1,047 1582 41,19±0,194 1853 253,89±2,189 1582 213,25±1,089 1582 157,11±3,243 b b b b a a Triplets 114 3,41±0,067 105 26,76±1,120 87 38,41±0,187 105 264,79±1,245 87 230,76±3,755 87 178,65±11,177 YEARS ** ** ** ** ** ** b c b d d a 2007 5718 3,57±0,028 5659 24,78±0,105 5643 40,09±0,201 5659 226,97±1,626 5643 205,14±1,525 5643 185,91±4,541 c b a b c c 2008 5722 3,57±0,028 5619 29,99±0,105 4661 40,65±0,203 5619 260,99±1,626 4661 209,11±1,540 4661 172,70±4,585 d d c c b b 2009 5909 3,59±0,026 5541 22,65±0,100 5078 35,55±0,191 5541 254,01±1,549 5078 212,35±1,455 5078 174,53±4,330 a a a a a d 2010 5954 3,65±0,026 5583 34,98±0,096 5128 40,77±0,195 5583 323,68±1,482 5128 255,93±1,482 5128 116,80±4,412 ÖS: Insignificant; **:P<0.01; *: P<0.05, BW: Birth weight, WBPS: Weight at the beginning of pasture season, WPS: Weight at the end of pasture season, DLWGBPS: Daily Live Weight Gains up to the Beginning of Pasture Season, DLWGEPS: Daily Live Weight Gains up to the End of Pasture Season,DLWGDPS: Daily Live Weight Gains during Pasture Season, 9 7 8 5 6 3 4 OVERALL Gender Male EWE Mother age 2 Factors Table 3. Overall Average Weights and Average Daily Live Weight Gains for Different Periods in Flocks th 204 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Determination Of Some Morphological Structure, Body Size And Growth Properties Of Hemşin Sheep Grown In Artvin 205 3.2 Daily Live Weight Gains up to the End of Pasture Season Average daily live weight gains in the lambs up to the end of pasture season was determined to be 220.64±1.423 g. It was 225.22±1.442 g in males and 216.05±1.445 g in ewes; 222.19±1.420 g in white lambs, 220.76±1.418 g in black lambs and 218.95±1.661 g in pied colored lambs; 206.80±1,634 g, 240.71±1.477 g and 214.39±1.418 in elite, intermediate elite and base flocks respectively; 217.89±0.715 g, 213.25±1.089 g and 230.76±3,755 g in single, twin and triplet born lambs respectively; 205.14±1.525 g, 209.11±1.540 g, 212.35±1.455 g and 255.93±1.482 g in 2007, 2008, 2009 and 2010 respectively. The effect of factors influencing average daily live weight gains up to the end of pasture season was found to be statistically highly significant (P<0,01). 3.3 Daily Live Weight Gains during Pasture Season Average daily live weight gains in the lambs during pasture season was found to be 162.48±4.237 g. Male lambs had the highest live weight gains (170.16±4.292 g) in all flocks during the time (94,4 days) the lambs grazed in pasture. It was 154.79±4,302 g in ewes. While the highest live weight gains in pasture during grazing time was in lambs born from sheep with white wool (165.80±4.226 g), the lowest gains during this period was in lambs born from sheep with black wool (158.73±4.222 g). In elite and base flocks, this value was determined to be close to each other, whereas it was the lowest in intermediate elite flocks. While the average daily live weight gains in single born lambs during pasture period was 151.67±2.129 g, it was 157.11±3,243 g in twins and 178.65 ±11,177 g in triplets. The highest value regarding average daily live weight gains during pasture period was obtained in 2007 with 185.91±4,54 g and the lowest in 2010 with 116.80±4,41 g. The average daily live weight gains over years naturally yielded different values due to different pastures where the lambs grazed by years, different shepherds, the difference in grazing times and changes in the quality of pastures. The effect of gender, mother age, wool color, flock type, birth type and years on the time spent in pasture and daily live weight gains was determined to be statistically highly significant (P<0,01). Figure 1. Side view of Hemşin Ram and Sheep (black) 4. The Inheritance Degrees of the Properties under Investigation When table 6 is examined, it can be seen that the inheritance degree regarding birth weight was low, and the inheritance degrees regarding live weight at the beginning of pasture season, live weight at the end of pasture season, daily live weight gains between the birth and beginning of pasture season, daily live weight gains up to the end of pasture season and daily live weight gains during pasture season yielded high values. These values were used when breeding value was calculated. The inheritance degrees are presented in diagonally located cells. Those in cells above the diagonals represent genetic correlations and the ones in the cells below diagonals show the phenotypic correlations. th 206 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 2. Side view of Hemşin Ram and Sheep (white) Table 6: The Inheritance Degrees for the Parameters under Investigation and Environmental and Phenotypic correlations h2 BW 3 Months W 6 Months W BW‐ DLWGBPS BW‐ DLWGEPS DLWGB‐ DLWGDPS 0.213±0.114 ‐0.688 ‐0.505 ‐0.405 ‐0.396 0.607 3 Months W ‐0.141 0.385±0.119 ‐0.685 ‐0.394 ‐0.308 0.457 6 Months W ‐0.183 0.585 0.411±0.144 ‐0.702 ‐0.898 ‐0.042 BW‐DLWGBPS ‐0.237 0.691 0.555 0.402±0.136 ‐0.623 0.260 BW‐DLWGEPS ‐0.274 0.532 0.845 0.824 0.418±0.143 ‐0.016 DLWGB‐DLWGDPS ‐0.044 ‐0.389 0.470 ‐0.175 0.347 0.420±0.066 BW CONCLUSION This project was a good start for the protection of genetic potential of Hemşin sheep, making up a definite part of sheep stock in Turkey, under local conditions, and for the development and improvement studies to be implemented. Superior performance breeding rams and sheep were obtained and they were given to the breeders. A training program for the sheep breeders was launched and a registered breeding system was established. The related breeding unions were founded and structured. The live weights of the lambs increased as the reproductive performance of the sheep increased. A 10 kg increase at the beginning of pasture season and 1 kg at the end brought about an increase in the live weight per animal. Therefore, a certain progress was achieved from the beginning of the project to the end. Local people acquired registered Hemşin race flocks. By achieving an increase in the amount of product to be obtained per animal, the aim is to help the breeder gain more profit per animal. The farmers quitting sheep husbandry in the region were encouraged to grow sheep again. A considerable amount of data was collected for the race registration of Hemşin sheep and an article was composed from the data. REFERENCES Anonymous 2010. Artvin Provincial Directorate of Agriculture, Annual Data, www. artvintarim.gov.tr, Artvin Esenbuga, N., Dayıoğlu H. (2001) Minimum Error Variance in Biometric Properties. Natural Sciences Journal. Year: 2, 2 p: 31‐43. Harvey, W.R. 1990. Users Guide for LSMLMW PC‐1 Version. Mixed Model Least‐Squares and Maximum Likelihood Computer Program. Ohio State University, Columbus, USA. James, J.W., (1979) The Theory Behind Breeding Schemes. In: Sheep Breeding, Ed. by J.L. Tomes, D.E. Robertson and R.J. Lightfoot Muresk and Perth, Butterworth Co Ltd, p.205‐213. Australia. Kaymakçı, M., Taşkın,T., 2008. Hybridization Practices in Turkey Sheep Husbandry. Animal Production 49(2): 43,51‐ İZMİR Meyer, K. (1989) Restricted Maximum Likelihood to estimate variance components for animal models with several random effects using a derivative‐free algorithm. Genet. Select. Evol. 21:317–340. Roden, J.A. (1994) Review of The Theory of Open Nucleus Breeding Systems. In: Animal Breeding Abstracts. Vol. 62 No.3. SAS, 1999. The SAS System. Version 8. Copyright (c) 1999 by SAS Institute Inc., Cary, NC, USA. TUİK 2010 http://www.tuik.gov.tr/veribilgi. RESTORATION OF POLISH NATIVE BREEDS OF COLD‐BLOODED HORSES: CHALLENGES AND PROBLEMS G.M.POLAK, J. KRUPINSKI National Research Institute of Animal Production, National Focal Point for Animal Genetic Resources, Wspolna 30, 00‐930 Warsaw, Poland Abstract: The local varieties of Polish cold‐blooded horses were created in the early 20th century based on indigenous mares crossed with stallions imported from France, Belgium and Germany. After World War II, changes in the agricultural economy considerably limited their use in agriculture. The existing local breeds and types were standardized after the introduction of one stud book and breeding programme for all cold‐blooded horses in 1964. By early 2000, only Sokolski (lighter type) and Sztumski (heavier type) horses survived. The expansion of horse genetic resources conservation programmes has created an opportunity for the restoration of the remaining native cold‐blooded horse breeds: Sokolski and Sztumski. The present population of cold‐blooded horses under conservation consists of 680 Sokolski and 555 Sztumski mares. The general criteria for inclusion in the conservation programme are morphological conformation and pedigree. Key words: Cold‐blooded horses, conservation programmes, body measurements, genealogy Introduction Socio‐economic changes in Europe and the increased import of stallions from France, Belgium and Germany were contributing factors to the development of Polish types of cold‐blooded horses. Their crossing with the historic population of small, sturdy and primitive horses (known as mierzyn) on Polish lands has led to the creation of local types of cold‐blooded horses (Sokolski, Sztumski, Lowicki, Lidzbarski and Kopczyk Podlaski) in northern, central and eastern Poland. In the second half of the 20th century, the local types began to disappear and merge into other breeds as a result of changing breeding trends and the use of animals for slaughter. Two types of horses survived until today: the Sokolski horse (developed in the Podlasie region) and the Sztumski horse (developed on the fertile soils of Zulawy and Powisle). Sokolski horses, which were created with considerable contribution from Breton and Ardennes sires, were fast harness horses. They were characterized by low height, dry constitution, and versatile carriage and working performance. Originally they were less than 155 cm tall, with cannon circumference of about 21 cm in mares and 22 cm in stallions. Sztumski horses, which developed under the influence of Ardennes and Belgian horses, were considerably different from Sokolski horses in conformation and frame size. They were considered the heaviest type of cold‐blooded horses in Poland. By the middle of the 20th century, their height averaged 156 cm for mares and 155.6 cm for stallions, with cannon circumference of 23.7 and 25.3 cm, respectively, and body weights of about 630‐860 kg. Few typical horses of both breeds are currently found in the Pomorskie, Podlaskie and Lubelskie provinces in north‐eastern and eastern Poland. They survived in these areas because of their advantages: longevity, undemanding character, adaptation to local conditions, tradition and the devotion of breeders. The programmes for the conservation of cold‐blooded Sztumski and Sokolski horse genetic resources, which were introduced in 2008, in Poland, are aimed to preserve their unique traits: the adaptation to local environment, perseverance, resistance to disease, longevity, and willingness to cooperate with humans. 208 Sempozyum Mares of both types are placed in the conservation programme if the following conditions are met: 1. registration in the Stud Book of the Polish Cold‐blooded Horse; 2. at least 75% Sztumski/Sokolski ancestry; born in historical regions where the breed developed; 3. proper, typical conformation and dimensions; 4. no foreign breed ancestors in the pedigree up to the third generation. The Sokolski horse breed standard for genetic resources conservation programme This type should have a drier constitution compared to other cold‐blooded horses. It is used as a carriage horse and for light field work. The head should be of medium size, well formed, with lively, medium‐sized ears and well‐muscled neck. The trunk should be barrel‐shaped, longer than in other cold‐blooded horses. There is a large disproportion between strong and massive trunks and drier legs compared to other types of cold‐blooded horses. Stallions must be 155 – 162 cm tall with cannon circumference of 25 – 27 cm. The respective values for mares should be 148 – 162 and 24 – 26 cm. All body colours are acceptable, except grey, skewbald and leopard. The Sztumski horse breed standard for genetic resources conservation programme This type horse should have a large and heavy head in proportion to the body weight, with a straight or ram‐headed profile. The trunk should be strong and deep with a gently sloping, split croup, somewhat lymphatic legs, short cannon bone, and strong hooves. The coat should be slightly more abundant than for the Sokolski type. Stallions must be 160 – 168 cm tall with cannon circumference of 26 – 28 cm. The respective values for mares should be 155 – 165 and 25 – 27 cm. All body colours are acceptable, except skewbald and leopard. Breeders who want to join the programme must own at least two mares registered in the Stud Book. Horses from all over Poland are eligible to participate in the programme. Because of Poland’s participation in the Common Agricultural Policy, breeders who join the horse genetic resources conservation programme are entitled to receive a payment under the Rural Development Programme, financed from the European Agricultural Fund for Rural Development. Owners of mares are entitled to a payment of 1,500 zloty (about 370 EUR). Materials and methods The aim of the study is to summarize the results of four‐year implementation of the genetic resources conservation programme for Sztumski and Sokolski coldblooded horses, and to show the problems that emerged during the course of this programme, concerning: 1. breed standard; 2. typical area where these animals are found; and 3. qualification priorities. Both breeds were monitored for population size and distribution in Poland, changes in body dimensions, correctness of type, and compliance of conformation with the standard. Data for the study were obtained from: a) Volume I of the Cold‐blooded and Heavy Horse Stud Book, concerning 477 Sztumski horses (269 mares and 204 stallions) and 316 Sokolski horses (168 mares and 148 stallions) b) documentation of the Polish Horse Breeders Association on the mares registered with the conservation programmes in 2008‐2011, concerning the origin, body dimensions, coat colour, and the occurrence area. Restoration Of Polish Native Breeds Of Cold‐Blooded Horses: Challenges And Problems 209 Results and Discussion During the four years of the programme implementation, the number of mares in the programme increased from 320 mares in 134 herds, to 680 mares in 229 herds, for the Sokolski breed; and from 220 mares (83 herds) to 555 mares (147 herds) for the Sztumski breed. The dynamics of population growth was as follows: Tab. 1 The increase in mare numbers in populations in the conservation programmes 2008 2009 2010 2011 Number of Sztumski mares 220 278 421 555 Number of breeders 83 87 121 157 Average stud size 2.65 3.2 3.48 3.4 Number of Sokolski mares 320 370 564 680 Number of breeders 134 132 197 229 Average stud size 2.39 2.8 2.86 3 The Sokolski mares were especially found in very small studs, usually contained no more than two mares. Their distribution in Poland shows that the most typical animals are found in the historical north‐eastern regions of Poland: Sztumski horses in Pomerania, and Sokolski horses in Podlasie and the Lublin region. Fig. 1. The number of Sokolski and Sztumski mares participating in the conservation programme, by region of Poland Horses of foreign (often the same) breeds contributed to the creation of both types of horses: Ardennes and Breton stallions in the case of the Sokolski type, and Ardennes and Belgian stallions in the case of Sztumski horses, which resulted in their greater frame size. Horses were imported for many decades, first during the time when Sokolski and Sztumski horses were developed (early 20th century) and then after World War II, during the 1970s and 1980s. A total of about 600 lines derived from the stallions of these breeds were found in Poland. Sempozyum 210 Fig. 2 Sire lines descended from foreign stallions As a result of large imports, the basic measurements of Sztumski and Sokolski horses increased and their conformation (type) became much more uniform, although it is not very uniform within the types. Fig. 3 Mean withers height in Sokolski and Sztumski mares in 1962 and 2008‐2010 Today’s populations are so saturated with the blood of Ardennes and West German stallions that every animal participating in the conservation programme has a “foreign” ancestor between the third and ninth generation. Fig. 4 Sztumski and Sokolski stallions Restoration Of Polish Native Breeds Of Cold‐Blooded Horses: Challenges And Problems 211 It can be assumed that another factor contributing to the high similarity is that the criteria for selection of breeding stallions were not implemented by breeders association during the first years of the programme. As a consequence, the programme now includes a large number of sires of low breeding value, which fail to meet current pedigree criteria and the principle of “type separation”. Fig. 5 Number of sires and mares in cold‐blooded horse conservation programmes - sztumski ancestors Fig. 6 Pedigree of Sokolski stallion WENTYL Conclusions: 1. There is low variation between the populations of Sztumski and Sokolski horses and high variation within a each breed, which has resulted from the use of a large number of stallions of different breeds in the past. The main breeds used include: Ardennes, Belgian and Breton, and less used breeds, North Swedish, Russian, Døle, Mur Island, as well as single documented cases of Fjord and Canadian, Boulonnais and Jutland stallions. 2. The excessive number of stallions used for breeding of both types slows or prevents breed development, and delays the process of type restoration and consolidation. 3. It can be assumed that the spread of the population of both breeds across Poland will lengthen the process of type restoration because of the varied environmental impacts in different regions. Although Poland is mostly a lowland country, the differences in temperature and in the duration of winter and summer are considerable. Also the soil and the quality of pastures differ between eastern and western Poland, with poor and sandy (mostly acid) soils dominating in the east. Vegetation is lush but of lower nutritive value than on mineral soils that are more widespread in the 212 Sempozyum north (Pomerania). Due to the fact that environment was a strong contributing factor to the creation of both populations, it is appropriate to confine the conservation of both types to the regions of origin. Another argument for this solution is the human factor. Horses are evaluated by employees of regional horse associations, which are responsible for all breeds found in a given area. In Poland there are no breed associations (except Shetland Pony and Trakehner horses), which means that subjective opinions of the employees of a given association have significance. Another considerable hindrance to the process of breed restoration and qualification is the pressure from breeders, who strive to own the largest number of mares possible due to payments under the Rural Development Programme 2007‐2013. This process is particularly complicated given that both populations overlap in territory and sometimes have common ancestors. REFERENCES: 1. Chrzanowski Sz., Chachuła J., Szelagowska‐Wąsik U., Oleksiak., Wilczak J. (1989) Konie zimnokrwiste w Polsce środkowowschodniej i południowej. PWN, Warszawa. 2. Instytut Zootechniki – PIB (2009) Programy ochrony zasobów genetycznych koni rasy polski koń zimnokrwisty w typie sokolskim. 3. Instytut Zootechniki – PIB (2009) Programy ochrony zasobów genetycznych koni rasy polski koń zimnokrwisty w typie sztumskim. 4. Jastrzębska E. (2007) Historia hodowli koni sokólskich. Hodowca i Jeździec, 3(14). 5. Jastrzębska E. (2007) Historia hodowli koni sztumskich. Hodowca i Jeździec, 4(15). 6. Jastrzębska E. (2008) Historia hodowli koni sztumskich. Hodowca i Jeździec, 1(16). 7. Nozdrzy‐Płotnicki J. (1967) Koń sokolski. PWRiL, Warszawa. 8. Polak G. (2010) A preliminary analysis of conservation programme for cold blooded horses in Poland. EAAP, Heraklion, Greece. 9. Prawocheński R., (1922) Pochodzenie, pokrój i rasy koni. Księgarnia Rolnicza, Warszawa. 10. Pruski W. (1960) Hodowla koni. PWRiL, Warszawa. 11. Redakcja Ksiąg Stadnych (1964) I Tom Księgi Stadnej Koni Zimnokrwistych i Pogrubionych. PWRiL, Warszawa. 12. PZHK (1964) Księga Stadna Koni Zimnokrwistych i Pogrubionych (Kzp), Tom I, PWRiL, Warszawa. 13. PZHK (2006) Program hodowli koni rasy polski koń zimnokrwisty PZHK, Warszawa. 14. Sapuła M. (1988) Analiza cech biometrycznych i użytkowych oraz uwarunkowania genetyczne u ogierów sokólskich. Annales Universitas Mariae Curie‐Skłodowska Lublin – Polonia, Vol VI, 22. LOCAL BREEDS, DISPERSION AND ECONOMIC ROLES IN THE NORTHEAST OF IRAN Zakizadeh, S1*, J. Bokaian1, H.R. Monazami2 1 Hasheminejad high education center, Kalantari Highway, Mashhad. Iran. 91769‐94767 2 Improvement of animal production organization, Mashhad, Iran *Corresponding author: Sonia Zakizadeh, sonia_zaki@yahoo.com ABSTRACT The role of local breeds is obvious in rural societies. Recently, National Breeding Center has started to evaluate performance traits of local breeds in Iran. The aim of this study was to identify potential roles of local breeds in livelihood of rural villages in northeast of Iran. Data were collected by interview of 96 farmers to record phenotypes, productions, feeding, reproduction, disease management, and housing systems. Most of farmers were not/or well educated with averagely 6 members who were breeding animals. Women were 45% of family workers and they were all over 12 years. Eighty three percent of families had up to 5 cattle; at least with one dairy cow or more. Dominant cattle were indigenous with coat colors black or black‐white and 93% of them had short/long horns. Average longevity observed in different villages was about 9.97 year (+1.39). Dairy cow produced 13.02 (+6.35) kg/day milk with one calf annually. Sixty four percent of farmers were breeding sheep and goat simultaneously and 88% were occupied by agricultural tasks such as irrigating or sowing rice, as well. Cows were being mainly milked twice daily by hand and most of families were consuming their own milk or milk products. Main dairy products included yoghurt, butter, cheese, Kashk, yoghurt drinking and the other sour dairy product named Ghorut. Frequent feedstuffs were straw, hay and bran and fewer farmers could provide wheat, concentrate or barley, which were fed two or three times, daily. Forage was supplied by farmer’s agriculture, by‐products or it was bought regarding to its quality. Animals were housed in places, where floors were not in good conditions, although light, ventilation and water had moderate quality. The most frequent disease was tylerios and diarrhea. Reproduction was 53% natural with shared males. There was not any separated place for calving. The first service of females was around 15th month and males could mate around 2 years old. Most farmer expenditures were for buying cows, improving housing system, buying feedstuffs and transition attempts to industrial transformation, respectively. Regarding to importance of living in special geographical uphill regions, sustainable livestock system would be possible, if primarily needs could be fulfilled. Key word: local breed, Iran, cattle INTRODUCTION Animal genetic resources exist in the form of vast variety of breed populations located and adapted to the range of environmental conditions over many centuries (Ali, 2010). The pressure of selection imposed by climate, altitude, availability of food supply, endemic diseases and parasites have resulted to specific genetic resources, which were suitable for their niche. Livestock make an essential contribution of food and agriculture and rural development. They produce majority of required animal origin protein demands of humankind through products such as meat, milk and eggs. In addition, human still use the other services like draught power, manure for fertilizer and fuel. There is no doubt that the importance of livestock is increasing as a result of human population growth, rising incomes and urbanization in developing countries (FAO, 2010). Unfortunately, we have lost plenty of valuable local species so far. According to FAO annually report (2000) thirty percent of animal genetic resources are in danger of extinct. Local breeds of developing countries are the precious genetic resources, which can ensure them to have a food security for future. Hence, th 214 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) authorities and small livestock keepers should take this subject into consideration and drastic measures should be taken for any sustainable improvement programs. Sustainable livestock production aims at maintaining economical high yielding animals and inputs on long‐term basis with least deterioration in natural resources (Vohra and Charkravanty, 2011). Reports indicate that the vast majority of developing countries have not been successful in sustaining animal improvement in their livestock population, because of lack of adequate technical and operational capacities. So, a desirable strategic and logistical approach to sustainable livestock development is required, which could involve livestock keeper as the direct beneficiary in planning and developing genetic improvement program (FAO 2010). MATERIAL AND METHODS National Breeding Center (NBC) has recently started to evaluate performance traits of local breeds in Iran since 6 years ago. In continuing the last studies, which had been performed in the Northeast of Iran, this project was conducted for screening the local breeds spreading in the boarder line of Iran and Turkmenistan. The villages of this area under the centrality of city zone, named Daregaz, were considered for this study. This area is located in 37°N latitude and 59°E longitude, which has different climate in mountain regions or in farmlands (Fig. 1). The average of altitude is 500 meters and it has 350 mm precipitation annually. Majority of people are occupied by animal husbandry or agricultural tasks such as irrigating or sowing rice. The aim of this study was to identify potential roles of local breeds in livelihood of rural villages in northeast of Iran. Data were collected by a questionnaire‐based interview design from 96 farmers who had participated in this survey to record phenotypes, productions, feeding, reproduction, disease management, and housing systems. Daregaz Turkmenistan Afghanistan Fig 1: Geographical map of Khorasan Razavi province and studied area Local breeds, dispersion and economic roles in the Northeast of Iran 215 RESULTS AND DISCUSSION Most of farmers were not/or well educated with averagely 6 members who were breeding animals. Women were 45% of family workers and they were all over 12 years. The crucial and unavoidable role of women was especially associated with animal management and milking, as well. They were expected to clean the milk bin and produce dairy products. Dairy cow produced 13.02 (+6.35) kg/day milk with one calf annually. Cows were being mainly milked twice daily by hand and most of families were consuming their own milk or milk products. Main dairy products included yoghurt, butter, cheese, Kashk, yoghurt drinking and the other sour dairy product named Ghorut. Eighty three percent of families had up to 5 cattle; at least with one dairy cow or more. Sixty four percent of farmers were breeding sheep and goat simultaneously, as well. Dominant cattle were indigenous with coat colors black or black‐white, as well as, 93% of them had short/long horns. For several years, it was being suggested that straight‐bred or cross‐bred populations, would be the best substitution for local ones (FAO, 2010). Experiences especially in this region have shown that the adaptability of cross‐bred (mainly with Holstein) had serious limitation and such an animal could not be able to climb the mountain for grazing. In terms of introducing local high potential males, NBC has started to identify recording system for local or cross‐bred populations to distinguish and enter them in a progeny test program and using the best ones for artificial insemination. Average longevity observed in different villages was about 9.97 year (+1.39). Frequent feedstuffs were straw, hay and bran and fewer farmers could provide wheat, concentrate or barley, which were fed two or three times, daily. Forage was supplied by farmer’s agriculture, by‐products or it was bought regarding to quality. The most frequent disease was tylerios and diarrhea. Animals were housed in places, where floors were not in good conditions, although light, ventilation and water had moderate quality. Reproduction was 53% natural with shared males, although there was not any separated place for calving. The first service of females was around 15th month and males could mate around 2 years old. Considering multiple purposes of low‐to medium‐input production system, it is very beneficial for livestock keepers to use all aspects of their animal, such as longevity, low‐demand feeding requirements or resistance against parasites. On the other hand, production in high‐input systems focuses just only on one or at most two primary outputs (FAO, 2010). The livestock keepers in these regions certainly have breeding goals and exploit local knowledge to pursue them, but most of local breeds are not subject to structured genetic improvement programs. Regarding to importance of living in special geographical uphill regions, sustainable livestock system would be possible, if primarily needs could be fulfilled. Most farmer expenditures in this study were for buying cows, improving housing system, buying feedstuffs and transition attempts to industrial transformation, respectively. Taking advantages from national/international opportunities, which would be offered to develop animals, help the livestock keeping communities to meet the needs and supply the products that consumer demand (FAO, 2010). REFERENCES Ali, S. 2010. Practical animal breeding. Arise Publishers & Distributors. INDIA. FAO. 2010. Breeding strategies for sustainable management of animal genetic resources. http://www.fao.org/DAD‐IS Vohra, V., A.K. Chakravarty. 2011. Sustainable breeding in Cattle & Buffalo. Satish Serial Publishing House. INDIA. THE IMPORTANCE OF FIBER PRODUCTION FOR CONSERVATION OF NATIVE SHEEP AND GOAT BREEDS AND SILKWORM LINES IN TURKEY G. DELLAL1*, Z. ERDOĞAN2, E. PEHLİVAN1, F. SÖYLEMEZOĞLU2, A. YANAR2 1 2 Department of Animal Sciences Faculty of Agriculture, Ankara University, Ankara, Turkey Department of Handicraft, School of Home Economics, Ankara University, Ankara, Turkey * Corresponding Author: gdellal@agri.ankara.edu.tr Abstract In Turkey, studies devoted to conservation of animal genetic resources are carried out by general directorate of agricultural research (TAGEM) under the ministry of food, agriculture and livestock. 9 sheep breeds, 3 goat breeds and 3 silkworm lines which produce animal fiber have been put under conservation by TAGEM since 1996‐1997 (Soysal, 2010). A considerable amount of these genotypes are preserved as in situ. The success of this conservation method is directly associated with economically making the best of these genotypes which are preserved. Hence, making the most of fiber production alongside meat and milk production would make a great contribution to their conservation. In this announcement, the ways to make the most of the breeds and lines preserved to produce fiber are emphasized. Keywords: Sheep, goat and sikworm genetic resources, conservation, fiber production. 1. Introduction According to 2009 year datum, the number of sheep and goat are respectively 21.749.508 and 5.128.285, and the number of silkworm boxes are 5.683 (TURKSTAT, 2009). In turkey, the number of sheep and goat are composed of local breeds. The number of local silkworm lines is low. On the other hand, these genetic resources make a contribution to folkloric culture including production of handicraft depends to animal fibers and to national economy at a high level. The fact that the contributions to folkloric culture are higher than chicken and cattle breeds increases the significance of our genetic resources. Besides, in turkey, local genetic resources of sheep, goat and silkworm have been decreasing for many years. Decrease in sheep and goat occurred very fast especially in some breeds and these breeds encountered with the danger of extinct. Therefore, silkworm lines have been put under protection besides some sheep and goat breeds by general directorate of agricultural research (TAGEM) under the ministry of food, agriculture and livestock since 1996‐1997 (Soysal, 2010). There are 2 methods as ex situ and in situ devoted to conservation of animal genetic resources in the world. Executions devoted to utilization of available efficiency of livestock breeds protected as in situ because of the danger of extinct (particularly the production of special products) make a contribution at a high level to the protection of genetic resources. This situation makes fleece, whose basic efficiency is fiber, more important for Angora goat, Cashmere goat, silkworm lines and Angora rabbit. In USA, studies devoted to benefit from sheep, goat, Angora rabbit and South American Camelids to produce thin fiber have been intensified recently. In these studies, it has been given weight to elaborating fibers produced in the company to traditional and new handicraft products. Thus, contribution of production of fiber to company’s economy increases. Therefore, in Turkey, benefiting from the fibers acquired from silkworm lines and angora rabbit besides local sheep and goat breeds whose number decrease more effectively will make a major contribution to protection of genotype and thereby to company’s economy. th 218 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 2. Local sheep, goat and silkworm genetic resources in Turkey 2.1 Sheep In Turkey, a considerable part of sheep population is composed of local breeds. According to 2009 year statistics, sheep number in Turkey is 21.749.508 and nearly 95 percent of this is composed of local breeds (TURKSTAT 2009). In table 1, local sheep genotypes of turkey and their risk situation are demonstrated. As can be seen in the table, 2 of these genotypes are extinct, 3 are under severe threat of extinction, 9 are under threat and 6 aren’t under threat of extinction (Ertugrul et al. 2010). Table 1. Turkey local sheep breeds and types (Ertugrul et al. 2010) Breed and type not under threat of extinction Akkaraman X Morkaraman X Güney Karaman Ulaş (Kangal) Akkaraman X X X Tuj X Kıvırcık X X Sakız İmroz Hemşin X X X Ödemiş X Karakaçan X Karakaş X Çine Çaparı X Halkalı X Norduz Karya extinct X Herik Karayaka under severe threat X Dağlıç İvesi under threat X X 2.2. Goat According to 2009 year statistics, goat existence in Turkey is 5.128.285 and 4.981.299 of the population is Hair goat and 146.986 is Angora goat (TURKSTAT 2009). Nonetheless, local goat genotypes, called Kilis, Honamli and Norduz, are counted as Hair goats because their number is low. In Turkey, local goat genotype number has been decreasing in parallel with many factors and some of these genotypes are under threat of extinction (Table 2). The Importance Of Fiber Production For Conservation Of Native Sheep And Goat Breeds And Silkworm Lines In Turkey 219 Table 2. Turkey local goat breeds and types (Ertugrul et al. 2010) Breed and type not under threat of extinction under threat Angora Goat under severe threat X Hair Goat X Kilis Goat X Malta Goat X Norduz Goat X Honamlı Goat X 2.3 Silkworm Turkey local silkworm lines are Bursa Beyazı Alaca, Bursa Beyazı and Hatay Sarısı. These lines are preserved by TAGEM (Soysal, 2010). 3. Conservation studies In Turkey, studies for conservation of animal genetic resources are carried out. Studies are carried out by general directorate of agricultural research (Tagem) under the ministry of food, agriculture and livestock. Conservation studies are done in primarily 3 ways as ex situ in vivo (in research institutes), ex situ in vitro (in genbanks) and in situ (in dorves). Protected sheep breeds are Sakız, Çine Çaparı, Gökçeada, Kıvırcık, Herik, Karagül, Hemşin, Norduz and Dağlıç, on the other hand goat breeds are Angora, Kilis and Honamlı. Local silkworm lines are Bursa Beyazı Alaca, Bursa Beyazı and Hatay Sarısı (Soysal, 2010). 4. Fleece, goat fibers and silk production in Turkey Fleece, mohair, goat top layer hair and production of silk fiber are done commercially in Turkey. Nevertheless, Angora rabbit wool and cashmere production are done at a low level at certain times (Dellal et al. 2010). Table3. Animal fiber production in Turkey (TURKSTAT, 2009) Animal fibers production (ton) 1991 1995 50 777 2000 Change (%) 2005 43 141 46 175 2009 40 270 1991‐2009 Fleece 60 492 ‐ 33.4 Mohair 1 379 797 421 302 174 ‐ 87.4 Hair 3 955 3 397 2 697 2 654 2 002 ‐ 49.4 cocoon 4 353 271 60 157 136 ‐ 96.9 As seen from table 3, according to the data acquired in 2009 Turkey produces about 40 thousand tones of dirty fleece from sheep a year. When the 18 year interval of 1991 and 2009 is analyzed it can be seen that there is a steady decrease in fleece production and this decrease reached approximately % 33.4 in 2009. There was also a significant decrease in mohair production between the years 1991‐2009. This fiber’s production having decreased by % 87.4, only yielded 174 tones. The main source of Cashmere cannot be exploited to its fullest extent, despite the fact that the main sources of Cashmere in Turkey are the local hair goats. Due to this, it was not possible to find more data about the Cashmere fiber production (Dellal et al. 2010). th 220 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The most important source of goat top coarse hair is once again the hair goat. A constant decline in top coarse hair can be observed between the years 1991‐2009, and the precise value of production decrease of this fiber is % 49.4. The yield in 2009 was only 2.002 tones (Table 3). Despite silk production having an important place in Turkish history, there was a major decrease in damp cocoon production between the years 1991‐2009 (%96.9). The production amount of damp cocoons in 2009 was 136 tones (Table 3). 5. Studies Related to Increasing Fleece and Goat Fiber Production in the World and European Union In recent years, there has been an important increase in interest towards natural fibers due to developments in organic agriculture. Along with this, there are several various studies taking place on an international scale to decrease the negative effects caused by the global economic crisis on the existing rivalry of synthetic fibers between business’ economical livelihoods that depend on production of natural fibers, which includes animal fibers. Therefore, in order to draw attention to the importance of natural fibers, the FAO, industrial and several other manufacturers declared 2009 the international natural fiber year (FAO 2009). There are still important studies being carried out in order to develop thin animal fiber production to aid small family businesses economically and evaluating non‐agriculturally suitable countries in the European Union (EU) (Russel 1993; Saul et al. 1993; Hopkins 1993: Dellal et al. 2010). Projects and models that support changes in the EU agricultural policies for production hold an important place. Due to this, there have been changes in EU animal fiber production policies that could be considered important over the past few years and along with the existing fiber production continuation, studies related to thin fiber production development have gained emphasis. Although animal fiber has been produced in EU at present one of the most important factors caused this policy change is a great majority of fibers produced are composed of medium and bad quality to be regarded as thin fiber and the other one is; EU has a significant level of land resources which is proper to develop different kinds of animal fiber productions. This situation would make a contribution to benefiting from non arable land resources particularly mountain regions, so EU goes towards production of thin animal fibers as thin fleece, cashmere, mohair and Angora rabbit and Alpaca hair, in terms of animal fiber production policies (Russel, 1993; Saul et al., 1993; Hopkins, 1993: Dellal et al. 2010). 6. The importance of fiber production in the protection of local Turkish sheep, goat and silkworm lines Since the animals are being taken advantage of economically, and the animal’s productivity will be used to benefit profit margins, the protection of Local farm animal’s genetic resources in situ will affect the protection activity in a positive way. Despite the fact that the main benefits are gained from meat and milk productivity from the sheep races (Sakız, Çine Çaparı, Gökçeada, Kıvırcık, Herik, Karagül, Hemşin, Norduz, Dağlıç) taken under protection from TAGEM in 2005, fleece production is not evaluated economically. Whilst the meat and milk production is emphasized on the once again protected goat races Kilis and Honamlı, along with their low level of meat and milk production, the Ankara goats are mainly reared for their mohair production. However, the silkworm lines that have been taken under protection (Bursa Beyazı Alaca, Bursa Beyazı and Hatay Sarısı) are used for their silk production. Over the past few years, there has been a decline in sheep and goat numbers, with causes stemming from reasons such as economical, sociological and structural, along with many others. However this situation should be expected to negatively affect the protected sheep and goats too. Despite the fact that the meat and milk productivity being increased in order to ensure that agricultural businesses that have opened up space for the protected sheep and goats to lay claim on The Importance Of Fiber Production For Conservation Of Native Sheep And Goat Breeds And Silkworm Lines In Turkey 221 them, excluding the support that TAGEM provided, other factors related to direct production being improved and made permanent will provide important contributions. One of the factors that should be emphasized upon is the fibers obtained from these races being used in a more efficient and profitable way. Just as the rest of the world, within the past 40‐50 years, despite the induced stress brought about by the natural animal fibers in Turkey being used in the textile industry, the interest in these fibers has begun to increase over the past 5 years. Thus, as stated above, plans involving the development of animal fiber production and rural development in the EU have gained importance. Due to this, Turkey abiding the following methods to protect the fiber producing animals protected by TAGEM being evaluated more effectively will contribute to the continuation of the protection efforts: 1. Excluding Kıvırcık, the sheep races Sakız, Çine Çaparı, Gökçeada, Herik, Karagül, Norduz, Dağlıç fleeces being suitable for carpet and rug production, should be evaluated as they have been for the past few centuries in their local area they were raised in. Because of this, the fleeces of these sheep races should be prioritized for carpet and rug production, whilst simultaneously designing new models related to handicraft production evaluation and marketing. 2. Beneficial research for using the Karagül lambs in the production of astrakhan should be started immediately. 3. Since the Ankara goats main productivity stems from its mohair, these sheep desire a higher level of importance in comparison to the other sheep races. On the other hand, due to many factors, the inability to take advantage of the mohair production and Turkey exporting a significant amount of mohair which the textile industry requires. Therefore, alongside emphasizing genetic and environmental efforts, efforts should be made for the current acquired mohair to be evaluated for use in handicraft production. (Yıldırım 1989; Dellal et al. 2010). 4. The top fiber (hair) and thin lower fiber (cashmere/down fiber) are produced from the protected Kilis and Honamlı goats. Despite the fact that the cashmere production of both of these goats is considerably low, the attributes of the cashmere of the Kilis goats has been deemed suitable for use in the textile industry (Altınbaş 1978). Therefore, efforts should be made to use the cashmere obtained from Kilis and Honamlı goats to be used in the textile industry and for handicrafts. Again, the obtained top coarse hair should be evaluated for use in handicraft production. The importance of the obtained cashmere being used in handicraft production is increasing in there are of origin in the Mediterranean region due to the fact that local tourism of this area is very developed. 5. Just like the Ankara goat, the silkworm is also a fiber animal. Due to this reason, the lines of the protected silkworms should be protected more efficiently in order to make silk production more profitable. Due to this, the silk obtained from these lines should initially be used for carpet production and then for special handicraft products and should be marketed in an efficient way. 6. Especially in the business in which it is produced, Just as the value of the handicrafts is increased when silk from the protected races of animal fibers is incorporated in the handicrafts, it should contribute to women’s employment. Efforts to use fleece, mohair and silk in handicrafts can be seen in accordance to its identification. (Yıldırım, 1989; Söylemezoğlu, 1995). While taking advantage of these efforts, attempts to develop the production of traditional and new handicrafts should be emphasized. Along with the working upon certain handicraft models (e.g. color, pattern, product type, and marketing methods) production and marketing methods becoming possible, the products must include information indicating which race or line the fibers were obtained from. th 222 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Altınbaş, E.T. (1978). Obtained from Kilis goat down fiber technologic some properties on research. Ankara University Faculty of Agriculture Yearbook, 28 (2); 598‐619. Dellal, G., Eliçin, A., Tuncel, E., Erdoğan, Z., Taşkın, T., Cengiz, F., Ertuğrul, M., Söylemezoğlu, F., Dağ, B., Özder, M., Pehlivan, E., Tuncer, S.S., Kor, A., Aytaç, M., Koyuncu, M. (2010). Present and Future of Animal Fiber Production in Turkey. TMMOB Ziraat Chamber of Agricultural Engineering. VII. Technical Congress, Proceedings‐2, 735‐757. 11‐15 Jan 2010. Ankara. Ertuğrul, M., Dellal, G., Elmacı, C., Akın, A.O., Pehlivan, E., Soysal, M.İ.., Arat, S. (2010). Conservation of Farm Animals Genetic Resources and Sustainable Usage. TMMOB Ziraat Chamber of Agricultural Engineering. VII. Technical Congress, Proceedings‐1, 179‐198. 11‐15 Jan 2010. Ankara. FAO, 2009. Common fund for commodities. Proceedings of the symposium on natural fibers. Technical Papers No: 56, Rome. Hopkins, H.W. 1993. Speciality fibers and markets. In: Alternative Animals for fibre production (Edited by A.J.F. Russell). Commission of the European Communities, Brussels, 5‐10. Russel, A.J.F. 1993a.The role of fine fibre production animals in European Agriculture. Fine Fiber News. No 2, page: 1‐7. Saul, G.R., Russel, A.J.F. and Sibbald, A.R. 1993. The potential for increasing income from wool in hill and upland sheep flocks in the UK. Agricultural System, (39); 273–287. Soysal, M.İ. (2010). (Edt.) Native animal genetic resources of Türkiye. ISBN: 978‐9944‐5405‐5‐1, Tekirdağ, Türkiye. Söylemezoğlu, F. 1995. Research on the quality of silkworm cocoons and some technological properties of silk fibers produced in Antalya district. Ph. D. Thesis. Ankara University Graduate School of Natural and Applied Science, Department of Home Economics. TURKSTAT, 2009. http://www.tuik.gov.tr/hayvancilikapp/hayvancilik.zul, Connection Date: 05.07.2011. Yıldırım, Z. 1989. A research on some physical properties and utilization of principal mohairs produced in Ankara and Bolu districts. Ankara University, Graduate School of Natural and Applied Sciences, Department of Home Economics, Master Thesis, 92 s. (unpublished) (in Turkish). POSTER ASSOCIATION OF INSULIN‐LIKE FACTOR BINDING PROTEIN 2 GENE WITH BODY COMPOSITION TRAITS IN IRANIAN COMMERCIAL BROILER LINES A. JAVANROUH ALIABAD1, H.R. SEYEDABADI1, B. TAHERI DEZFULI2* 1. Department of Biotechnology, Animal Science Research Institute of Iran, Karaj, Iran. 2. Agriculture and Natural Resources Research Center of Khuzestan, Ahwaz, Iran. * Bahareh_tah2003@yahoo.com Abstract The IGF are important regulators in stimulating growth, protein synthesis, and cell proliferation. In serum of different species, over 99% of IGF molecules circulate as complexes to at least 7 specific and high affinity‐binding proteins, which regulate bioactivity of IGF. The chicken IGFBP2 gene spans approximately 38 kb and is located on chromosome 7 and consists of 4 short exons and 3 long introns. The current study was designed to investigate the association of IGFBP2 gene polymorphism with chicken body composition traits. Genomic DNAs were extracted from 400 chickens from four different commercial broiler lines. Genotyping for the IGFBP2 gene by using PCR‐ RFLP method and Eco72 I restriction endonuclease showed a mutation in 527‐bp fragment located in intron 2 of the IGFBP2 gene. Additionally, genotyping of IGFBP2 gene was confirmed by DNA sequencing. Data were analysed using the MIXED precedures of SAS with genotype (G), Line (l) and sex (S) as fixed effects. Polymorphism in IGFBP2 gene was significantly (P<0.1) associated with wing weight, drumstick weight, percentage of drumstick weight and percentage of carcass weight. The broiler chickens have undergone intensive breeding with many objectives that should be simultaneously considered to reduce costs, improve health and product quality. So, several traits such as growth and body composition traits have been included in selection indices. In addition to difficulty of measurement of these traits, the correlations among of them are complex. MAS can be an ideal option to improve selection programs. This research suggests that IGFBP2 gene could be a candidate gene that can affect some body composition traits in chickens. Keywords: IGFBP2 gene, broiler line, body composition, Iran. Introduction Although traditional selection for phenotypic values of broiler chickens has made significant improvements in growth rates and meat yields during the past half century, but now, the high selection intensity for growth rate has caused many physiological disorders such as obesity, ascites, and leg problems, as well as a reduction in overall immunocompetence (Deeb and Lamont, 2002). Molecular marker‐assisted selection may be required. The combination of traditional genetic selection and modern molecular methods may be preferred for breeding chickens in the future (Hui et al., 2003). To simultaneously improve production and fitness traits, molecular markers associated with one or both sets of traits may be useful. Understanding the genetic control of growth in chickens will provide an opportunity for genetic enhancement of production performance and physiology (Li et al., 2003). The IGF are important regulators in stimulating growth, protein synthesis, and cell proliferation and differentiation in a variety of cell types (Scanes et al., 1999). Insulin‐like growth factor binding proteins (IGFBP) regulate the biological functions of IGF, and IGF may stimulate the growth of multiple tissue cell types (Clemmons, 1998). So far, 7 IGFBP have been identified, and they were named IGFBP 1 to 7 (Shimasaki and Ling, 1991; Oh et al., 1996). The IGF‐binding protein th 226 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) type II (IGFBP‐II) is sensitive to dietary protein level and may play an important role in the modulate the growth promoting effect of circulating IGF‐I by making the IGFIBP complex in ruminant and chicken (Kita et al., 2002; Lee et al., 2005). The structure of the IGFBP2 gene is conserved among mammalian and avian species (Ehrenborg et al., 1991; Schoen et al., 1995). The chicken IGFBP2 gene spans approximately 38 kb and is located on chromosome 7 (Schoen et al., 1995). It consists of 4 short exons and 3 long introns, encoding a 275‐amino acid polypeptide hormone and is regulated by growth hormones (Schoen et al., 1995). Association between different SNP of IGFBP‐II and some growth traits were reported in several chicken populations (Nie et al., 2005; Lei et al., 2005). According to Nagao et al. (2001), in several tissues the concentration of IGFBP2 expression in fed chickens is lower than that of the chickens fasted for 2 d, showing that chicken IGFBP2 expression is different in different nutritional states. Besnard et al. (2001) reported that IGFBP2 expression increases in the processes of growth arrest and apoptosis in lung epithelial cells. Forty SNP were identified while scanning 3,578 bp of available sequence of the chicken IGFBP2 gene in 4 divergent populations of Leghorn, White Recessive Rock, Taihe Silkies, and Xinghua chickens by denaturing high‐performance liquid hromatography (Nie et al., 2005). The main goal of the current work was to identify single nucleotide polymorphisms (SNP) in the IGFBP2 gene, develop PCR‐RFLP methods to detect those DNA polymorphisms in Iranian commercial broiler lines, and evaluate associations between IGFBP2 SNP and growth and fatness traits. Materials and methods Four different Iranian commercial broiler lines were used in the current study. All birds had free access to feed and water. The individuals were raised in floor pens and fed comercial corn‐ soybean diets that met NRC requirements. The fifteen generation individuals (n=400) was used in the present study. Live body weight was measured at 6 wk of age. Chickens were slaughtered, carcasses were eviscerated and dissected. Carcass weight (CW), breast muscle weight (BMW), drumstick weight (DW), back weight (BAKW), wing weight (WINW) and abdominal fat weight (AFW) traits were determined. All traits were also expressed as percentage of BW at 6 wk of age. Whole blood samples were collected from 400 chickens at 6 weeks of age. They were obtained from four different commercial broiler lines, which were selected for production and reproduction traits for 15 generations. Genomic DNA were extracted using salting‐out method with some modifications (Javanrouh et al., 2006). The G729T primers (5 ' GGGCATTTATATCTGAGGAACAC 3'; 5' GGCAAAGAGCAACCCAACAC 3') were chosen based on the primers design by Lei et al. (2005) to ampify a 379bp corresponding to the intron 2 of the chicken IGFBP2 gene. The C1032T primers (5' TTTGGTTGAGTCCTAGGCTTG 3'; 5' GGCGTACTACACTGCAGAGG 3') were chosen based on the primers design by Lei et al. (2005) to ampify a 527bp corresponding to the intron 2 of the IGFBP2 gene. Two single nucleotide polymorphism (SNP) of the IGFBP2 regions were detected by digesting 10 μl of the PCR product with PvuI and Eco72I restriction endonucleases at 37oC overnight. Restriction patterns were visualized by agarose gel electrophoresis and ethidium bromide staining. After the gel electrophoresis process, the amplicons of 379 and 527 bp were purified using a Qiamp Mini Kit (QIAGEN, Valencia, CA, U.S.A.). The purified samples were sequenced by a big dye terminator chemistry on an ABI 3130‐Avant DNA sequencer (Applied Biosystems, Foster City, CA, U.S.A.). The DNA sequences were analyzed using the Sequencing Analysis Software Version 3.3 (Applied Biosystems, Foster City, CA, U.S.A.). Data were subjected to the MIXED precedures of SAS (SAS Inst. Inc., CARY, NC) with genotype (G), line (L) and sex (S) as fixed effects according to the models: yijkl = μ + Genotypei + Sexj + Linek+ Sire(Line) + dam (Line Sire) + eijkl. In the formula, Y was the response variable, µ represents population mean and e stands for the random error. Statistical significance threshold was deternined as P<0.1, unless otherwise specified. Association Of Insulin‐Like Factor Binding Protein 2 Gene With Body Composition Traits In Iranian Commercial Broiler Lines 227 Results The genotype and allele frequencies at IGFBP2 loci calculated by PopGene.S2 software, are shown in Table 1. The B allele was more frequent than A allele in three broiler lines (A,B,D). The BB genotype was more frequent than other genotypes in three broiler lines (A,B,D). The Chi‐square test (P<0.05) indicated that the genotype distributions were not in Hardy–Weinberg equilibrium (Table 1). Disagreement of the genotype frequencies with the Hardy–Weinberg equilibrium expections tested indicated that IGFBP2 gene frequency was significantly different (P<0.05) among lines.The transversion of G into T SNP at base 729 at intron 2 of the IGFBP2 gene creates a restriction site for PvuI endonuclease. The 379‐bp fragment was digested with PvuI restriction enzyme. The restriction enzyme PvuI‐digested PCR product had fragment only 379bp for AA homozygotes. In addition, the IGFBP2 genotype was verified by DNA sequencing and it was presented in figure 1. The result showed that there wasn’t any polymorphism in this loci.The transition of C into T SNP at base 1032 at intron 2 of the IGFBP2 gene creates a restriction site for Eco72I endonuclease. The 527‐bp fragment was digested with Eco72I restriction enzyme. The restriction enzyme Eco72I‐digested PCR product had fragment of 527 for AA homozygotes, fragments of 527, 477 and 50bp for AB heterozygotes and 477 and 50 bp for BB homozygotes. In addition, the IGFBP2 genotypes were verified by DNA sequencing and they were presented in figure 2. There was a single nucleotid polymorphism of C1032T. According to sequencing, AA bands represented C1032C, AB bands represented C570T, BB bands represented T570T. TABLE 1. Genotype and gene frequency of IGFBP2 gene in chicken population. Genotype frequency Population Chi‐square test (χ2) Gene frequency AA AB BB A B Line A 0.29 0.03 0.68 0.3 0.7 Line B 0.46 0.05 0.49 0.49 0.51 Line C 0.61 0.017 0.37 0.62 0.38 Line D 0.12 0. 3 0.58 0.27 0.73 p< 0.05 0.00 TABLE 2. Effects of IGFBP2 genotype on growth and body composition (least squares means) BB AB AA P‐value Trait 2502.02± 51.42 a 2547.7± 20.65a 2500.4± 25.47 a 0.33 BW6(g) 1764.4± 12.7 a 1755.7± 14.66 a 1727.2± 18.2a 0.36 CW(g) 568.8±12.7 a 578.7± 5.2a 579. 4± 6.48a 0.53 BMW(g) 528.1± 4.21 a 506.3± 4.9 b 485± 6.12c 0.08 DW(g) 195.7± 4.21 b 203.86± 1.3 a 200.6± 19.35ab 0.09 WINW(g) 380.4± 9.76 a 390.6± 3.9 a 380.54± 4.8 a 0.18 BAKW(g) 25.7± 2.2 a 26. 5± 0.9 a 26.8± 1.02 a 0.68 AFW(g) 71.25± 0.94 a 68.97±0.38 b 68.82± 0. 46 b 0.039 %CW 22.74± 0.001 a 22.76± 0.15 a 23.02± 0.2 a 0.19 %BMW 20.7± 0.1 c 19.9± 0.12 b 19.42 ± 0.15 a 0.003 %DW 7.9± 0.1 a 8± 0.05 a 8.05± 0.06 a 0.55 %WINW 15.6± 0.3 a 15.3± 0.1 a 15.22± 0.04 a 0.32 %BAKW 0.93± 0.08 a 0. 96± 0.03 a 1.04± 0.04 a 0.25 %AFW a,b Means with no common superscripts differ significantly (P<0.05) 1 BW6(g)= Body Weight at 6 week; CW= carcass weight ; BMW= breast muscle weight; DW= drumstick weight; WINW= Wing weight; BAKW= back weight , AFW= abdominal fat weight, %CW= carcass weight as percentage of BW at 6 wk of age, %BMW= breast muscle weight as percentage of BW at 6 wk of age, %DW= drumstick weight as percentage of BW at 6 wk of age, %WINW= Wing weight as percentage of BW at 6 wk of age, %BAKW= back weight as percentage of BW at 6 wk of age, %AFW= abdominal fat weight as percentage of BW at 6 wk of age th 228 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) G729G Figure 1. According to sequencing, AA bands represented G729G Discussion Growth is a comprehensive reflection of development of various parts of a chicken body, and its final expression is the result of interaction among genetic, nutritional, and environmental factors (Scanes et al., 1999). Growth is under complex genetic control, and uncovering the molecular mechanisms of growth will contribute to more efficient selection for growth in broiler chickens (Deeb and Lamont, 2002). The IGFBP2 gene affected the growth and fat metabolism of animals (Rajaram et al., 1997; Hoeflich et al., 1999). The current study found two G/T and C/T SNP at base 729 and 1032 respectively in the second intron of the IGFBP2 gene. The χ2 test results showed that there were significant differences in allele frequency among 4 distinct populations (P<0.05) and the allele frequency distribution was related to populations. This may be due to the high selection program done in population as meat chicken with similar gene frequency. Lei et al. (2005), reported two G/T and C/T mutations in the second intron of the IGFBP2 gene. They founded that a polymorphism of this SNP was related (P<0.05) with BW at 49 d in a commercial line chicken. Our genotypes were the same, but we didn’t obtain any association between genotypes and BW(6). The current study, there were significantly higher DW, %CW and %DW in birds that were of the BB genotype than those of the AA and AB genotypes and there was higher WINW in birds that were of the AB genotype than those of the AA and BB genotypes. This finding was similar to result of Khadem et al. (2009). A previous study has shown that the QTL for fat deposition was mapped between marker brackets LEI0064 and ROS0019 (75 kb to 27 Mb) on GGA7 in the chicken linkage map (Ikeobi et al., 2002), which covers the chicken IGFBP2 gene (23 to 24 Mb). It was reported that IGFBP2 could modulate adipocyte development by regulating the biological activities of IGF‐I and transforming growth factor β (Butterwith and Goddard, 1991; Richardson et al., 1998). All evidence above indicates that IGFBP2 is a reasonable candidate gene for fatness traits in chicken. However, we didn’t obtain any association between genotypes and AFW trait. A comparison of the mean values for all three genotypes suggests that IGFBP2 mainly acts in a dominant fashion on body composition traits, with allele B contributing to higher DW, %DW and %CW traits. There were no significant associations (P>0.1) between the SNP and BW6, CW, BMW, BAKW, AFW, %BMW, %WINW, %BAKW and %AFW. This finding was similar to result of Lei et al. (2005). Association Of Insulin‐Like Factor Binding Protein 2 Gene With Body Composition Traits In Iranian Commercial Broiler Lines T1032T T1032C C1032C Figure 2. According to sequencing, AA bands represented T1032T, AB bands represented T1032C and BB bands represented C1032C 229 th 230 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Conclusion In summary, the broiler chickens have undergone intensive breeding with so many objectives that should be simultaneously considered to reduce costs, improve health and product quality. So, several traits such as growth and body compositin traits have been included in selection indices. In addition to difficulty of measurement of these traits, the corrolations among of them are complex. marker‐assisted selection (MAS) can be an ideal option to improve selection programs. The results from the current study indicated that a SNP marker in the IGFBP2 gene was associated with body composition traits in chickens growing to market weight and is, therefore, a potential marker for molecular MAS programs in commercial broiler lines in Iran. References Besnard,V., Corroyer,S., Trugnan,G., Chadelat,K., Nabeyrat,E., Cazals, V. and Clement,A.(2001).Distinct Patterns Of Iinsulinlike Growth Factor Binding Protein (IGFBP)‐2 And IGFBP‐3 Expression In Oxidant Exposed Lung Epithelial Cells. Biochimica et Biophysica Acta,,1538:47–58. Butterwith,S.C. and Goddard,C.(1991).Regulation Of DNA Synthesis In Chicken Adipocyte Precursor Cells By Insulin‐Like Growth Factors, Platelet‐Derived Growth Factor And Transforming Growth Factor‐β. Journal of Endocrinology,131:203–209. Clemmons,D.R.(1998).Role Of Insulin‐Like Growth Factor Binding Proteins In Controlling IGF Actions. Molecular and Cellular Endocrinology,140:19–24. Deeb,N. and Lamont,S.J.(2002).Genetic Architecture Of Growth And Body Composition In Unique Chicken Populations. Journal of Heredity,93:107–118. Ehrenborg,E., Vilhelmsdotter,S., Bajalica,S., Larsson,C., Stern,I., Koch,J., Brondum‐Nielsen,K. and Luthman,H.(1991).Structure And Localization Of The Human Insulin‐Like Growth Factorbinding Protein 2 Gene. Biochem. Biochemical and Biophysical Research Communications,176:1250–1255. Hui,L., Deeb,N., Zhou,H., Mitchell,A.D., Ashwell,C.M and Lamont,S.J.(2003).Chicken Quantitative Trait Loci For Growth And Body Composition Associated With Transforming Growth Factor‐β Genes. Poultry Science, 82:347–356. Ikeobi,C.O., Woolliams,J.A., Morrice,D.R., Law,A., Windsor,D., Burt,D.W. and Hocking,P.M.(2002).Quantitative Trait Loci Affecting Fatness In The Chicken. Animal Genetics, 33:428– 435. Javanrouh,A., Banabazi,M.H., Esmaeilkhanian,S., Amirinia,C., Seyedabadi,H.R. and Emrani,H.(2006).Optimization On Salting Out Method For DNA Extraction From Animal And Poultry Blood Cells. The 57th Annual Meeting of the European Association for Animal Production. Antalya, Turkey. Khadem,A., Hafezian,H. and Rahimi‐Mianji,G.(2010).Association Of Single Nucleotide Polymorphisms In IGFI, IGF‐II And IGFBP‐II With Production Traits In Breeder Hens Of Mazandaran Native Fowls Breeding Station. African Journal of Biotechnology, 9: 805‐810. Kita,K., Nagao,K., Taneda,N., Inagaki,Y., Hirano,K., Shibata,T., Yaman,M.A., Conlon,M.A. and Okumura,J.(2002).Insulin‐ Like Growth Factor Binding Protein‐2 Gene Expression Can Be Regulated By Diet Manipulation In Several Tissues Of Young Chickens. In The Journal of Nutrition, 132:145–151. Lee,H.G., Choi,Y.J., Lee,S.R., Kuwayama,H., Hidari,H. and You,S.K.(2005).Effects Of Dietary Protein And Growth Hormone‐Releasing Peptide (GHRP‐2) On Plasma IGF‐1 And IGFBPs In Holstein Steers. Domestic Animal Endocrinology, 28:134–146. Lei,M.M., Nie,Q.H., Peng,X., Zhang,D.X. and Zhang,X.Q.(2005).Single Nucleotide Polymorphisms Of The Chicken Insulin‐Like Factor Binding Protein 2 Gene Associated With Chicken Growth And Carcass Traits. Poultry Science, 84:1191‐1198. Li,H., Deeb,N., Zhou,H., Mitchell,A.D., Ashwell,C.M. and Lamont,S.J.(2003).Chicken Quantitative Trait Loci For Growth And Body Composition Associated With Transforming Growth Factor‐Beta Genes. Poultry Science, 82:347–356. Association Of Insulin‐Like Factor Binding Protein 2 Gene With Body Composition Traits In Iranian Commercial Broiler Lines Oh,Y., 231 Nagalla,S.R., Yamanaka,Y., Kim,H.S., Wilson,E. and Rosenfeld,R.G.(1996). Synthesis And Characterization Of Insulinlike Growth Factor Binding‐Protein (IGFBP)‐7: Recombinant Human Mac25 Protein Specifically Binds IGF‐I And IGF‐II. Journal of Biological Chemistry, 271:30322–30325. Rajaram,S., Baylink,D.J. and Mohan,S.(1997).Insulin‐Like Growth Factor‐Binding Proteins In Serum And Other Biological Fluids: Regulation And Functions. Endocrine Reviews, 18:801–831. Richardson,R.L., Hausman,G.J. and Wright,J.T.(1998).Growth Factor Regulation Of Insulin‐Like Growth Factor (IGF) Binding Proteins (IGFBP) And Preadipocyte Differentiation In Porcinestromal‐ Vascular Cell Cultures. Growth Development & Aging, 62:3–12. Nagao,K., Yaman,A.M., Murai,A., Sasaki,T., Saito,N., Okumura,J. and Kita,K.(2001).Insulin Administration Suppresses An Increase In Insulin‐Like Growth Factor Binding Protein‐2 Gene Expression Stimulated By Fasting In The Chicken. British Poultry Science, 42:501–504. Nie,Q., Lei,M., Ouyang,J., Zeng,H., Yang,G. and Zhang,X.(2005).Identification And Characterization Of Single Nucleotide Polymorphisms In 12 Chicken Growth‐Correlated Genes By Denaturing High Performance Liquid Chromatography. Genetic Selection Evolution, 37:339–360. Scanes,C.G., Proudman,J.A. and Radecki,S.V.(1999).Influence Of Continuous Growth Hormone Insulin‐Like Growth Factor I Administration In Adult Female Chickens. General and Comparative Endocrinology, 114: 315–323. Schoen,T.J., Mazuruk,K., Waldbillig,R.J., Potts,J., Beebe,D.C., Chader,G.J. and Rodriguez,I.R.(1995).Cloning And Characterization Of A Chick Embryo cDNA And Gene For IGF‐Binding Protein‐2. Journal of Molecular Endocrinology, 15:49–59. Shimasaki,S. and Ling,N.(1991).Identification And Molecular Characterization Of Insulin‐Like Growth Factor Binding Proteins (IGFBP‐ 1, ‐2, ‐3, ‐4, ‐5 and ‐6). Prog. Growth Factor Res, 3:243– 266. THE PHENOTYPIC AND GENETIC CORRELATIONS BETWEEN MILK AND REPRODUCTIVE TRAITS IN HOLSTEIN CATTLE A. Sahin1*, Z. Ulutas1, E. Sirin, Y. Aksoy1 1. * Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey Correspondence: Dr. A. Sahin, Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey; e‐mail: azizsahin@gop.edu.tr Abstract The purpose of the study was to calculate the genetic and phenotypic correlations between milk production traits (actual milk yield, lactation lenght, dry period) and reproductive traits (service period, calving interval) in Holstein cows reared at Polatlı State Farm, located in Ankara province. The total usable records were 1806 produced by 534 cows during the period from 1997 to 2006. Phenotypic and genotypic correlations were estimated for some milk and reproductive traits. Highly positive genetic correlations of lactation length with actual milk yield and 305 day milk yield and service period with calving interval obtained. Key Words: Holstein, correlation, milk yield, reproductive traits. Introduction Animal breeding, the first step is to determine the current status of the herd. Yields of farm animals are the results of the combined effects of genotype and environmental conditions. Economically important traits are determines by more than one gene pair. In selection, more than one traits should taken into account, the relationship between these traits need to be determined. Appropriate use of selection methods, with emphasis on knowledge of possible correlations between features. Knowledge of the heritability, repeatability and genetic correlations among various productive and reproductive traits can help to improve the production potential in the future breeding herd through selection. Dairy cattle breeding, milk yield and reproductive traits are taken into account. In selection, the relationships (genetic and phenotypic correlation) between these traits must be taken into consideration. Genetic correlations are very important in selection where changes in one trait are induced by selection on another trait between which there is genetic correlation. If genetic correlation between the two traits is high, the selection for one trait would result in an improvement/deterioration for the other trait as a correlated response. The phenotypic correlation is an expression of observed relationship between the phenotypic performance of different traits while the degree of association between genes responsible for the additive variance of different traits is measured through genetic correlation. The genetic correlations give the information that genes affecting one trait also affect the other traits. The effectiveness of selection and genetic progress can be measured when selection is made for more than one trait. Many studies have shown that relationship between milk yield and fertility traits are antagonistic (Bagnato and Oltenacu, 1993; Pryce et al., 1997; Dematawewa and Berger, 1998; Haile‐Mariam et al. 2003). This antagonistic relationship between milk production and reproduction is becoming more important for dairy breeders, because the maximum level of milk production is nearly achieved. Generally, selection for increased milk yield reduces reproductive performance and this could affect culling rates and reduce the genetic gain from primary traits (Grosshans et al., 1997; Pryce, 1997; Dematawewa and Berger, 1998, Haile‐Mariam et al. 2003). Many authors have stated that the main reason for this antagonistic relationship is assumed to be influenced by the level of production and management systems (Nebel and McGillard, 1993, Grosshans et al., 1997; Damatawewa and Berger, 1988, Pryce, 1997). On the other hand, relationships between milk yield and fertility traits were assumed to be that cows produce milk at a maximum level when they are expected to show th 234 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) oestrous and conceive (Haile‐Mariam et al. 2003). The present investigation was made to explore the phenotypic and genetic correlations between milk yield and some fertility traits in Holstein cattle. Material and Methods Data Data of the present study were obtained from the Holstein cattle kept, at the Polatlı State Farm. The total useable of records were 1806 produced by 534 cows during to period from 1997 to 2006. Prior to analyses, abnormal records affected by diseases or abortion and animals having calving interval less than 310 and greater then 650 days, and lactation length less then 220 and greater then 550 days were excluded from the data set. Additionally, parities more than 5 were also removed form the data set due to less number of observations. The calving months were grouped into 4 seasons: Winter (December to February), Spring (March to May), Summer (June to August) and Autumn (Sebtember to Nowember). Milk records were preadjested for 305‐day lactation length. Productive traits studied were 305 day milk yield (305‐day MY), lactation length (LL), dry period. Reproductive traits were service period (SP) and calving interval (CI). Characteristics of the data set are given in Table 1. Table 1. Characteristics of the data set used for genetic and phenotypic correlations estimates Description Total Records in data 1806 Cows in data 534 Dams in data 420 Sires in data 107 Year (1997‐2006) 11 Seasons 4 Parity 5 Statistical analyses Preliminary analyses were conducted for milk yield and reproductive traits to identify the significant effects. The General Linear Model Procedure in Minitab‐Version 12 (1998) was used for analyses. The model included the random effects animal, sire and dam. The effects taken into the model were calving year (fixed), calving season (fixed) and parity (fixed) and age of calving as a covariate for all traits. Estimates of genetic correlations between milk yield and fertility traits were obtained by Restricted Maximum Likelihood (REML) fitting animal model and utilising all pedigree information using the program MTDFREML (Boldman et al., 1995). The statisitcal models used to correlations described below was fitted to each trait: Model 1 (305‐day milk yield) Yijklmn = Fijk + al + Pm + eijklmn Yijklmn : is the observation of cow milk yield (305‐day milk yield), a l : the direct additive genetic effect of Ith animal, Pm : permanent environmental effect of animal, eijllmn : the random residual error, The Phenotypic and Genetic Correlations Between Milk and Reproductive Traits in Holstein Cattle Fijk 235 (fixed effects): bmi+byk+lnj+b1A, bmi : the effects of calving season (1‐4), by k : the effects of calving year (1997‐2006), ln j : the effects of parity (1‐5), b1 A : the linear effect of calving age on milk yield ( b1 ) regresyon coefficiency, Model 2 (lactation length, dry period, service period and calving interval) Yijklm = Fij + al + Pk + eijklm Yijkl : aj : is the observation of traits the direct additive genetic effect of Ith animal, Pk : permanent environmental effect of animal, Fij (fixed effects): byi+lnj+b1A, ln j : the effects of parity (1‐5), (dry period, calving interval, service period) by i : effects of calving year (1997‐2006), (lactation length, dry period, calving inteval, service period) b1 A : the linear effect of calving age on observed traits ( b1 ) regresyon coefficiency, (dry period, calving interval, service periyodu) eijkl : random error term, Results and Discussion Estimates of Correlations Milk yield traits Phenotypic correlation between actual milk yield and 305‐dMY each of LL was positive except DP. This indicated that the average 305‐day MY will increase with the increase of LL. The phenotypic correlations between actual milk yield and 305 dMY, LL were 0.96, 0.64, respectively. The phenotypic correlations (0.96 and 0.67) as obtained in the present study was positive and high. These findings are in agreement with those of Tuzemen et al. (1999) who found high and positive phenotypic correlation between this traits in Holstein cattle. Estimates of genetic and phenotypic correlations (rg and rp, respectively) among the four milk yield traits studied are presented in Table 2. th 236 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. The correlations between some milk yield traits of Holstein cows AMY (kg) 305 dMY (kg) AMY (kg) 0,97 305 dMY (kg) 0.96 LL (day) 0.64 0.47 DP (day) ‐0.60 ‐0.058 LL (day) DP (day) 0,95 ‐0,28 0,93 ‐0.53 ‐0,80 ‐0.006 The upper triangle of genetic and the lower triangle of phenotypic The correlation between milk yield (actual and 305 dMY) and dry period was negative. Negative phenotypic correlations (rp ) between 305‐day MY and DP indicate that cows with shorter DP will produce more milk. Estimates of rp obtained in this study for the same traits are also followed similar direction in the most of the reported studies (Demataweva and Berger, 1998; Khattab and Atil, 1999). Similarly, Atil et al. (2001) reported negative phenotypic correlation between 305 dMY and dry period in Holstein cattle. Genetic correlations between DP and each of 305‐day MY, AMY and LL were negative, whereas the correlation between LL and each of 305‐day MY and AMY are positive. Negative genetic correlations (rg ) between DP and each of 305‐day MY, AMY and LL indicates that selection for these traits will also increase milk yield. The genetic correlations between actual milk yield and 305 day milk yield as obtained in the present study pozitive (0.97) and high. These findings are similar to the finding (0.94) as reported by Duru and Tuncel (2004) in Turkey Holsteins. Fertility traits Estimates of genetic and phenotypic correlations (rg and rp, respectively) among the two fertility traits studied are presented in Table 3. Table 3. The correlations between some fertility traits (calving interval and service period) Calving Interval (day) Calving Interval (day) Service Period (day) Service Period (day) 0,98 0,99 The upper triangle of genetic and the lower triangle of phenotypic Genetic correlation between SP and CI was positive and being 0.98. Veerkamp et al. (2001) reported that SP was positively correlated with CI. Kadarmideen et al. (2000), Wall et al. (2003) have also reported positive and high genetic correlation between SP and CI, being 0.88 and 0.76 respectively. The estimates of genetic correlation (rg) suggested that selection for reduced SP would result in reduced CI (Kadearmideen et al, 2003; Khattab and Atil, 1999). The phenotypic correlation between calving interval and service period was estimated to be 0.99 in the present investigation. These findings are substantiated by those of Dematawewa and Berger (1998), who reported a phenotypic correlation of 0.93 between the two traits in Holstein cattle. Similarly, Gonzalez Recio et al. (2006) reported positive phenotypic correlation between the two traits in Holstein cattle. Finally, estimates of genetic and phenotypic correlations were in agreement with the most of earlier reports. Selection for short dry period, service period and calving interval will lead to increase in milk production. The Phenotypic and Genetic Correlations Between Milk and Reproductive Traits in Holstein Cattle 237 References Ahmad. M., J. H. J. Van der Werf and K. Javed, 2001. Genetic and phenotypic correlations for some economic traits in dairy cattle. Pakistan Vet. J., 21(2): 81‐86. Atil, H., Khattab, S.A., Yakupoğlu, Ç., 2001. Genetic Analysis For Milk Traits İn Different Herds of Holstein‐ Freisian Cattle İn Turkey. On Line Journal of Biological Sciences 1 (8): 737‐741. Bagnato A., Oltenacu P.A. (1993): Genetic study of fertility traits and production in different parities in Italian Friesian cattle. J. Anim. Breed. Genet. 110: 126‐134. Boldman KG, Kriese LA, Van Vleck LD, Kacman SD: Amanual for use of MTDFREML USD‐ARS, Clay Center, Nebraska, USA, 1995. Dematawewa C.M.B., Berger P.J. (1998): Genetic and phenotypic parameters for 305‐day yield fertility and survival in Holsteins. J. Dairy Sci. 84:266‐275. Duru, S, Tuncel, E., 2004. Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu Ve İlkine Buzağılama Yaşı İle Bazı Süt Verim Özellikleri Arasindaki İlişkiler, Ulud. Üniv. Zir. Fak. Derg., (2004) 18(1): 69‐79. Gonza´Lez‐Recio, O., Alenda, R. , Chang, Y. M., Weigel, K. A. , Gianola, D., 2006. Selection For Female Fertility Using Censored Fertility Traits And İnvestigation of The Relationship With Milk Production, J. Dairy Sci. 89:4438–4444. Grosshans T., Xu Z.Z., Burton L.J., Johnson D.L., Macmillan K.L. (1997): performance and genetic parameters for fertility of seasonal dairy cows in New Zealand. Livest. Prod. Sci. 51:41‐51. Haile‐Mariam M., Bowman P.J., Goddard M.E. (2003): Genetic and environmental relationship among calving interval survival persistency of milk yield and somatic cell count in dairy cattle. Livest. Prod. Sci. 80:189‐ 200. Kadarmıdeen, H.N., Thompson, R., Sımm, G., 2000. Linear And Hreshold Model Genetic Parameters For Disease, Fertility And Mil Production İn Dairy Cattle. Animal Science, 71:411‐419. Kadarmideen, H. N., Thompson, R., Coffey M.P., Kossaıbatı, M.A., 2003. Genetic Parameters And Evaluations From Single And Multiple‐Trait Analysis of Dairy Cow Fertility And Milk Production. Livestock Production Science 81:183‐195. Khattab, A.S., Atıl, H., 1999. Genetic Study of Fertility Traits And Productive İn A Local Born Friesian Cattle İn Egypt, Pakistan Journal of Biological Sciences, 2 (4):1178‐1183. Minitab. (1998): “Minitab reference manual. Release 12 for Windows”. Minitab Inc. Nebel R.L., McGillard M.L. (1993): Interactions of high milk yield and reproductive performance in dairy cows. J. Dairy Sci. 76:3257‐3268. Pryce J.E. (1997): Genetics of health and fertility in dairy cattle. PhD thesis. The University of Edinburg UK. Tüzemen, N., Yanar, M., Aydin, R., Akbulut, Ö., Yüksel, S., Turgut, L., Bayram., B., Güler, O., 1999. Atatürk Üniversitesi Ziraat Fakültesi Çiftliğinde Yetiştirilen Siyah Alaca sığırlarin süt verim özelliklerine ilşkin genetik ve fenotipik Parametre tahminleri, Uluslar arası Hayvancıılık ’99 Kongresi 21‐24 Eylül, İzmir. Veerkamp, R. F., Koenen, E. P. C. De Jong†, G., 2001. Genetic Correlations Among Body Condition Score, Yield, And Fertility In First‐Parity Cows Estimated By Random Regression Models, Journal of D. Sci. Vol. 84, No. 10, 2327‐2335. Wall, E., Brotherstone, S., Woolliams, J. A., Banos, G., Coffey, M. P., 2003. Genetic Evaluation of Fertility Using Direct And Correlated Traits, J. Dairy Sci. 86: 4093‐4102. ESTIMATES OF PHENOTYPIC AND GENETIC PARAMETERS FOR MILK YIELD AND REPRODUCTIVE TRAITS OF HOLSTEIN CATTLE IN TURKEY USING AN ANIMAL MODEL A. Sahin1*, Z. Ulutas1, E. Sirin, Y. Aksoy1 1. * Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey Correspondence: Dr. A. Sahin, Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey; e‐mail: azizsahin@gop.edu.tr Abstract The present research was conducted to estimate variance components and genetic parameters for milk yield traits (actual milk yield, 305 day milk yield, lactation lenght and dry period) and fertility traits (service period, calving interval, gestetion length and number of service per conception) in Holstein cows raised at Polatlı State Farm located in Ankara province. Data were collected on 536 milk yield and reproductive records of Holstein cows during the period from 1997 to 2006. Variance components and genetic parameters were estimated by using Multiple Traits Derivative Free Restricted Maximum Likelihood (MTDFREML) using animal model. Heritabilitiy estimates were, 0.33, 0.32, 0.07, 0.06, 0.08, 0.015, 0.02 and 0.01 of actual milk yield (AMY), 305 day milk yield (305 dMY), lactation length (LL), dry period (DP), calving interval (CI), service period (SP), gestation lenght (GL) and number of service per conception, respectively. Results indicate that the heritability of calving interval, number of service per conception, gestation lenght, lactation lenght and dry period in dairy cattle is lower than the other economically imported milk traits. Key words: Brown Swiss, heritabilities, milk yield, dry period, lactation lenght Introduction Holstein cows are one of the most desirable breed in Turkey, having a capacity for high milk production. The importance of animal products for the nourishment of population at each age is well known by breeders. It is necessary to increase the quality and the quantity of animal product as a parallel to increased population of the world. A lot of breeding programme has been done with the aim of increasing yields since the declaration of republic by which there were planned attempts to breeding in Turkey (Akman, 1998). At the result of breeding, the proportion of culture, cross bred and domestic cattle reached to 34.72%, 41.09% and 24.19% in the cattle population of Turkey. Total milk production in Turkey is 12 542 186 ton, of which 92.35% from cattle. Milk production from cows in Turkey was not satisfactory with average of 2802 kg per year (Anonymous, 2010). There are several reasons for this production. Firstly, effect of environmental conditions such as feed availability and poor housing systems and veterinary care. Secondly, effective selection programmes for the breed have not been adopted with little emphasis in quantitative genetic evaluation. In order to increase milk production per head is necessary to improve environmental conditions and genetic structure. Improvement of performance through selection is largely dependent on the effective use of additive genetic variation and accurate estimation of genetic parameters for the traits to be selected. These genetic parameters are essential tool in animal breeding research and in the design and application of practical breeding programme (Tosh and Kemp, 1994; Kumlu, 2003). The objective of this study was to estimate the covariance components and genetic parameters for milk and fertility traits of Holstein cows which are raised in Polatlı State Farm. th 240 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) MATERIAL AND METHOD Data Data of the present study were obtained from the Holstein cattle kept, at the Polatlı State Farm. The total useable of records were 1806 produced by 536 cows during to period from 1997 to 2006. Prior to analyses, abnormal records affected by diseases or abortion and animals having calving interval less than 310 and greater then 650 days, and lactation length less than 220 and greater than 550 days were excluded from the data set. Additionally, parities more than 5 were also removed form the data set due to less number of observations. The calving months were grouped into 4 seasons: Winter (December to February), Spring (March to May), Summer (June to August) and Autumn (Sebtember to Nowember). Milk records were preadjusted for 305‐day lactation length. Productive traits studied were actual (AMY) and 305 day milk yield (305 dMY), lactation length (LL), dry period. Reproductive traits were service period (SP), gestation lenght (GL), number of service per conception and calving interval (CI). Characteristics of the data set are given in Table 1. Table 1. Characteristics of the data set used for genetic and phenotypic correlations estimates Description Total Records in data 1806 Cows in data 534 Dams in data 420 Sires in data 107 Year (1997‐2006) 11 Seasons 4 Parity 5 Statistical analyses Preliminary analyses were conducted for milk yield and reproductive traits to identify the significant effects. The General Linear Model Procedure in Minitab‐Version 12 (1998) was used for analyses. The model included the random effects animal, sire and dam. The effects taken into the model were calving year (fixed), calving season (fixed) and parity (fixed) and age of calving as a covariate for all traits. Estimates of genetic correlations between milk yield and fertility traits were obtained by Restricted Maximum Likelihood (REML) fitting animal model and utilising all pedigree information using the program MTDFREML (Boldman et al., 1995). The statisitcal models used to correlations described below was fitted to each trait: Model 1 (305‐day milk yield) Yijklmn = Fijk + al + Pm + eijklmn Yijklmn : is the observation of cow milk yield (305‐day milk yield), a l : the direct additive genetic effect of Ith animal, Pm : permanent environmental effect of animal, eijllmn Fijk : the random residual error, (fixed effects): bmi+byk+lnj+b1A, Estimates of Phenotypic and Genetic Parameters for Milk Yield and Reproductive Traits of Holstein Cattle in Turkey Using an Animal Model 241 bmi : the effects of calving season (1‐4), by k : the effects of calving year (1997‐2006), ln j : the effects of parity (1‐5), b1 A : the linear effect of calving age on milk yield ( b1 ) regresyon coefficiency, Model 2 (lactation length, dry period, service period and calving interval) Yijklm = Fij + al + Pk + eijklm Yijkl : aj : is the observation of traits the direct additive genetic effect of Ith animal, Pk : permanent environmental effect of animal, Fij (fixed effects): byi+lnj+b1A, ln j : the effects of parity (1‐5), (dry period, calving interval, service period) by i : effects of calving year (1997‐2006), (lactation length, dry period, calving inteval, service period) b1 A : the linear effect of calving age on observed traits ( b1 ) regresyon coefficiency, (dry period, calving interval, service periyodu) eijkl : random error term, Results and Discussion Genetic parameters Milk yield traits The heritability (h2) and the ratio of the permanent environmental variance (c2) due to animal and (co)variance components for milk and reproductive traits from single traits are given in Table 3 and Table 4. Heritabilities about (milk yield traits) actual milk yield, 305 day milk yield, lactation length and dry period were estimated 0.33, 0.32, 0.07 and 0.06. Estimates of heritability for dry period, lactation length, calving interval, service period, gestation length and number of service per conception were lower than actual and 305 day milk yield. th 242 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. Variance components and genetic parameters for milk yield traits Traits Parameters 2 Phenotypic variance (σ P ) Additive genetic variance (σ2A) Permanent environment variance (σ2PEA) 2 Residual variance (σ E) 2 Heritability ( h ) Permanent environmental variance as a AMY (kg) 305 dMY (kg) LL (day) DP (day) 2552157.307 2671237.158 4078.192 2620.463 853425.027 863991.104 292.401 146.767 27.607 26.752 242.103 <0.001 1698704.672 1807219.301 3543.688 2473.695 0.33 0.32 0.07 0.06 <0.001 <0.001 0.059 <0.001 2 proportion of phenotypic variance ( c ) Table 3. Variance components and genetic parameters for fertility traits Traits Parameters 2 Phenotypic variance (σ P ) 2 Additive genetic variance (σ A) Permanent environment variance (σ2PEA) Residual variance (σ2E) 2 Heritability ( h ) Permanent environmental variance as a CI (day) SP (day) GL (day) Gbst (number) 5468.839 7152.222 46.564 0.980 460.723 1077.502 0.968 0.008 0.006 0.023 <0.001 0.030 5008.110 6074.698 45.596 0.942 0.08 0.07 0.02 0.01 <0.001 <0.001 0.059 0.031 2 proportion of phenotypic variance ( c ) Heritability estimates for actual milk yield was 0.33 (Table 4). Estimates of heritability for dry period and lactation length were lower than actual and 305 dMY. In the research, the heritability for the actual milk yield was found at low level than Bakır and friend’s findings (1998), but it was found closer to the value which Pe’Rez‐Cabal et al. (2006) declared. The finding of the research which Holstein yield record was found higher than some of the research result (Wall et al., 2003; VanRaden et al., 2004; Atil and Khattab, 2005), it was found closer to Campos and friend’s findings (1994). Makgahlela et al. (2007) evaluated the yield record of Holstein cows, declared that heritability about actual milk yield as 0.33. In this study, the estimated heritability value (0.32) about 305 day milk yield is higher than estimated values in different studies (Erdem, 1997; Tuzemen et al., 1999; Ulutas et al., 2002; Sahin, 2009), was found lower than some literatures (Kadarmideen et al., 2000; Veerkamp et al., 2001; Chonkasikit, 2002). Ptak et al. (2001) determined heritability about 305 day milk yield as 0.24 in the research of dairy cattle. In the same way, Unalan and Cebeci (2004) determined the heritability for 305 milk yield in Holstein cattle as 0.29. According to the moderate heritability estimates for actual and 305 dMY, it can be concluded that the genetic improvment in milk yield can be achived through selective breeding programme. In the research, the heritability value (0.07) for the lactation length is consistent with the values which Ojango and Pollott (2001) determined in Holstein cows, also with the values which Ilatsia et al. (2007) determined in Sahiwall cattle. Research result is lower than Atıl et al. (2001) findings, is higher than the values of Ertuğrul et al. (2002) and Sahin, (2009). In the research done in Kore (Sang et al., 1986), the lactation records of Holstein cows were examined and heritability about actual milk yield and lactation length changed as 0.10‐0.27. Estimates of Phenotypic and Genetic Parameters for Milk Yield and Reproductive Traits of Holstein Cattle in Turkey Using an Animal Model 243 The heritability estimate of dry period was 0.06. The present estimate is closer to Khattab and Atıl (1999) and Erdem (1997) findings. Higher estimates of heritability for dry period were also reported by many authors that ranged from 0.04 to 0.28 (Erdem 1997; Sahin and Ulutas, 2010). However, Deshpande et al. (1992), Wall et al. (2003), Gonzalez and Alenda (2005), reported low heritability for dry period ranged from 0.03 to 0.08. The major parth of the variation in lactation length and dry period is due to non genetic factors and rapid response could be expected by improving environmental conditions such as feeding regime and management systems. Therefore, improving the managerial technique should lead to a considerable decrease in length of dry period. Makuza and McDaniel (1996) suggested that the low heritability for dry period indicated that temporary environmental influences were much greater than genetic influences or permanent environmental effects. Khalil et al. (1994) concluded that due to low heritability for lactation intervals (actual milk yield and 305 dMY etc.) selection index based on paternal half sister groups did not allow lactation intervals play a major role in selection programs. The heritability of some milk yield (lactation length and dry period) traits in dairy cattle is lower than many other economically important traits (actual and 305 dMY). The low heritability of this traits indicates that a major part of variation in these characters were environmental and selection would be not effective in bringing about genetic improvement better management can therefore play an imported role in improving such trait. This was also reported by Atıl et al. (2001). In this research, the heritability for the first lactation length, actual and 305 day milk yield is in the middle level. So, if it is paid attention to do first lactation, actual and 305 day milk yield, it will be better than yield characteristics heritability is estimated lower. But, it is not true to say that genetic development is satisfied. As increasing the heritability in herd, it is profited by the systems that increase genetic variance, also genetic improvement. Dry period, heritability about lactation length that was examined from milk yield characteristics was found lower in the most of literatures. It is not possible to be noticeably genetic development by the selection which these characteristics that heritability was determined lower. In the research, it shows that for the some milk yield characteristics, the heritability was lower. The finding heritability lower for the some milk yield characteristics shows that the variances in this state is source of differences in the environmental conditions than genetic differences. In this case, according to individual data set in the selection possible success is not too much. In the state, in the selection that is taken into account, relative yields of animal must be taken into account besides personal yields. For the low heritability characteristics that are seen in unique sex, using sperms of tested bulls in insemination will be helpful to increase genetic variance in herd. Fertility Traits The heritability estimate for service period (SP) was 0.07 (Table 3). This result was in agreement with the findings of Gonzalez Recio and Alenda (2007), who found that heritability for service period was 0.07. Hansen et al. (1983), Seykora and McDaniel (1983), Hayes et al. (1992), Marti and Funk (1994), Atıl (1999) and Atıl et al. (2001) reported similar h2 estimates for SP (between 0.00 and 0.09) although there were marked differences in data sets, breed types, estimation models and procedures among researches. The heritability estimate for calving interval (0.08) in this study (Table 3) was lower than those reported Methekar et al. (1993) and Zulkadir and Boztepe (2003). Also, Atıl and Khattab (2005), reported that heritability for calving interval was 0.09. However, Chonkasikit, (2002), Pyrce et al. (2002), Olorı et al. (2002), Ulutas et al. (2002) and Biffani et al. (2005). reported lower heritability estimates for calving interval than this study, ranged 0.01 to 0.06. Campos et al. (1994) found that heritability for calving interval 0.021. th 244 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The heritability of gestation length reported here was close to 0.02 reported by Erdem (1997), but lower than 0.05 reported by Zulkadir and Boztepe (2003). However, Deshmukh et al. (1992) and Sahin (2009) reported higher heritability estimates for gestation length than this study, ranged 0.06 to 0.17. A heritability estimate of (0.01) was obtained for number of service per conception (Table 3). Heritability estimates for gestation length (0.016) in this study average the same as those of Kadarmideen et al. (2000), Veerkamp et al. (2001) and Chonkasikit (2002). The heritability estimates for same trait was lower than those in the current literatüre (Chagunda et al., 2004; Sahin 2009; Biffani et al., 2005) found that heritability for number of service per conception 0.02. The heritability of fertility traits in dairy cattle is lower than many other economically important traits. The low heritability of fertility traits indicates that a major part of variation in these characters were environmental and selection would be not effective in bringing about genetic improvment better management can therefore play an imported role in improving such trait. This was also reported by Kadarmideen et al. (2000). The specific characteristics of heritability with which genetic variance increase or decrease environmental variance can be increased. There is a direct relationship between selection yield and heritability. Consequently, when the heritability is increased, satisfying genetic development will be possible in the following selection. In the low heritability characteristics, the point will be lower in the selection by which animal will be searched for phenotypic values. In the low heritability characteristics, instead of doing a selection by taking these characteristics into account, it is suggested that it should be behaved more carefully in the herd management. References Akman, N., 1998. Pratik Sığır Yetiştiriciliği, 1‐6, Türk Ziraat Mühendisleri Birliği Yayını, Ankara, 1998. Anonymous, 2010.TUİK‐Türkiye İstatistik Kurumu Hayvancılık İstatistikleri. http://www.tuik.gov.tr/PreHaberBultenleri.doid=1979PreistatistikTablo.doistab_id=140, 141 ve 487. Erişim tarihi: 05.12.2010. Atıl, H., 1999. Genetic Relationship Between Days Open and Days Dry With Milk Yield in a Herd of Holstein Friesian Cattle. Pakistan Journal of Biological Sciences, 2(1), 60‐64. Atıl, H., Khattab, S. A., Yakupoğlu, C., 2001. Genetic Analysis for Milk Traits in Different Herds of Holstein Freisian Cattle in Turkey. On Line Journal of Biological Sciences, 1 (8), 737‐741. Atıl, H., Khattab, A. S., 2005. Estimation of Genetic Trends for Productive and Reproductive Traits of Holstein Friesian Cows in Turkey. Pakistan Journal of Biological Sciences, 8 (2), 202‐205. Bakır, G., Yener, S. M., Kaygısız, A., 1998. Siyah Alaca Sığırların Süt Ve Döl Verim Özelliklerine İlişkin Genetik Parametre Tahminler. II.Ulusal Zootekni Bilim Kongresi, 22‐25, Bursa. Biffani, S., Canavesi, R, Samore, A. B., 2005. Estimates of Genetic Parameters for Fertility Traits of Italian Holstein Friesian Cattle. Udk 636.082 Izlaganje Sa Znanstvenog Skupa Conference Paper, Stocarstvo, 59 (2), 145‐153. Boldman, K. G., Kriese L. A., Van Vleck L. D., Kacman S. D., 1995. Amanual for use of MTDFREML USD‐ARS, Clay Center, Nebraska, USA. Campos, M. S., Wilcox, C. J., Becerril C. M., and Dız, A., 1994. Genetic Parameters for Yield and Reproductive Traits of Holstein and Jersey Cattle in Florida, J.Dairy Sci., 77, 867‐873. Chagunda, M. G. G., Bruns, E. W., Wollny, C. B. A. and King, H. M., 2004. Effect of Milk Yield Based Selection on Some Reproductive Traits of Holstein Friesian Cows on Large Scale Dairy Farms in Malawi. Livestock htp://ftp.sunet.se/wmirror/www.cipav.org.co/ Research for Rural Development, 16(7). lrrd/lrrd16/7/chag16047.htm#Livestock Research for Rural Development 16 (7) (03.08.2008). Chonkasikit, N., 2002. The Impact of Adaptive Performance on Holstein Breeding in Nothern Thailand. (Phd. Thesis),Georg August University, Göttingen, Germany. Estimates of Phenotypic and Genetic Parameters for Milk Yield and Reproductive Traits of Holstein Cattle in Turkey Using an Animal Model 245 Deshpande, K. S., Deshpande, A. D., Deshpande, K. S., 1992. Studies on Lactation Lenght and Dry Period in Jersey Cows. Indian J. of Dairy Sci., 45 (7), 353‐355. Deshmukh, B.V., Sakhare, P.G., Despande, K. S., 1992. Factors Affecting Service Period and Calving interval of Jersey Cows. Indian J.Dairy Sci., 45 (7), 388‐389. Erdem, H., 1997. Gökhöyük Tarım İşletmesinde yetiştirilen Siyah Alaca Sığırların süt ve döl verim özellikleri ve bu özelliklere ait bazı parametrelerin tahmini üzerine bir araştırma. (Doktora Tezi), Ondokuzmayıs Üniv, Zootekni Bölümü, Samsun. Ertuğrul, O., Orman, M. N., Güneren, G., 2002. Holstain Irkı İneklerde Süt Verimine Ait Bazı Genetik Parametreler. Turk J Vet Anim. Sci., 26, 463‐469. Gonzalez Recio, O., Alenda, R., 2005. Genetic Parameters for Female Fertility Traits and a Fertility Index in Spanish Dairy Cattle. J. Dairy Sci., 88, 3282‐3289. González Recio, O., Alenda, R., 2007. Genetic Relationship of Discrete‐Time Survival With Fertility and Production in Dairy Cattle Using Bivariate Models. Genet. Sel. Evol., 39, 391‐404. Hansen, L. B,.Freeman, A. E., Berger, P. J.. 1983. Variances, repeatabilities, and age adjustments of yield and fertility in dairy cattle. J. Dairy Sci., 66, 281‐ 292. Hayes, J. F., Cue, R. I., Monardes, H. G., 1992. Estimates of Repeatability of Reproductive Measures in Canadian Holstein. Journal of Dairy Science, 75 (6), 1701‐1706. Ilatsia, E., Muasyan, T. K., Muhuyi, W. B., Kahi, A. K., 2007. Genetic and Phenotypic Parameters and Annual Trends for Milk Production and Fertility Traits of The Shawial Cattle in Semi Arid Kenya. Trop Anim. Health Prod., 39,37‐48. Kadarmideen, H. N., Thompson, R., Simm, G., 2000. Linear and threshold Model Genetic Parameters for Disease, Fertility and Milk Production in Dairy Cattle. Animal Science, 71, 411‐419. Khalil, M. H., Abdel Glil, M. F., Hamed, M. K., 1994. Genetic aspects and adjustment factors for lactation traits of Friesian cattle raised in Egypt. J.Aim. Prod., 31, 65. Khattab, A. S., Atil, H., 1999. Genetic Study of Fertility Traits and Productive in a Local Born Friesian Cattle in Egypt, Pakistan Journal of Biological Sciences, 2 (4), 1178‐1183. Kumlu, S., 2003. Hayvan Islahı, 2. Baskı, 27‐33, Türkiye Damızlık Sığır Yetiştiricileri Merkez Birliği Yayınları, Ankara, 2003. Makgahlela, M. L., Banga C. B, Norris, D., Dzama, K., Ngambi, J. W., 2007. Genetic correlations between female fertility and production traits in South African Holstein cattle, S Afr J Anim Sci, 37 (3), 180‐188. Makuza, S. M., Mcdanıel, B. T., 1996. Effects of Days Dry, Previous Days Open on Milk Yields of Cows in Zimbabve and North Carolina. J.Dairy Sci., 79, 702‐709 Marti, C. F., Funk, D.A., 1994. Relationship between production and days open at different levels of herd production. J. of Dairy Sci., 77, 1682‐1690. Methekar, K. U., Despande, A. D., Deshpande, K. S., 1993. Factors Affecting Service Period and Calving interval in Jersey Cows. Indian Journal of Dairy Science, 46 (10), 496‐497. Minıtab, 1998. Minitab Reference Manuel For Windows. Release 12. Stage College, Pennsylvania, Minitab Inc. Ojango, J. M. K, Pollott G. E., 2001. Genetics of Milk Yield and Fertility Traits in Holstein Friesian Cattle on Large Scale Kenyan Farms. Journal of Animal Science, 79 (7), 1742‐1750. Olorı, V. E., Meuwıssen, T. H. E., Veerkamt, R. F., 2002. Calving interval and Survival Breeding Values as Measure of Cow Fertility in a Pasture Based Production System With Seasonal Calving. J.Dairy Sci., 85, 689‐696. Pe´Rez‐Cabal, M. A., Garcıa, C., Gonzalez Recio, O., Alenda, R., 2006. Genetic and Phenotypic Relationships Among Locomotion Type Traits, Profit, Production, Longevity, and Fertility in Spanish Dairy Cows. J. Dairy Sci., 89, 1776‐1783. Pryce, J. E., Coffey, M. P., Brotherstone, S. H., Wollıams, J. A., 2002. Genetic Relationships Between Calving interval and Body Condition Score Conditional on Milk Yield, J.Dairy Sci., 85 (6):1590‐1595. Ptak, E., Bus, M., Morec Kopec, M., Zarnecki A., 2001. Estimates of genetic parameters of milk traits using REML and Gibss sampling. J Anim Feed Sci, 10 (4): 559‐567. th 246 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Sahin A., 2009. Genetik and Phenotypic Parameter Eestimation of Fertility and Dairy Production Traits of Different Dairy Cattle Breeds Reared at State Farms in Turkey. Ph.D. Thesis (Unpublished). Sahin A., Ulutas, Z., 2010. Genetic Parameters of Milk production and reproduction traits of holstein Cattle at A Tahirova State Farm Conditions. Kafkas üniv. Vet. Fak. Derg. 16 (6):1051‐1056. Sang, B. C., Cho, Y. Y., Chee, B. C., 1986. Estimates of Heritability and Genetic Correlation Form Milk Production Traits in Holsteins Cattle, Korean Journal of Animal Sciences, 28 (4), 179‐183. Seykora, A. J., Mcdanıel, B. T., 1983. Heritabilities and Correlations of Lactation Yields and Fertility for Holsteins, J. Dairy Sci., 66, 1486‐1493. Tosh, J. J., Kemp, R. A., 1994. Estimation of variance components for lamb weights in three sheep populations. J. Anim. Sci. (72): 1184‐1190. Tuzemen, N., Yanar, M., Aydın, R., Akbulut, O., Yuksel, S., Turgut, L., Bayram., B., Guler, O., 1999. Atatürk Üniversitesi Ziraat Fakültesi Çiftliğinde Yetiştirilen Siyah Alaca Sığırların Süt Verim Özelliklerine İlişkin Genetik ve Fenotipik Parametre Tahminleri. Uluslar arası Hayvancıılık ’99 Kongresi 21‐24 Eylül, İzmir. Ulutaş, Z., Akman, N., Akbulut, O., 2002. Estimates of Genetic and Environmental (Co)Variances for 305‐Day Milk Yield and Calving interval in Holstein Cattle. 7th World Congress On Genetics Applied To Livestock Production, August 19‐23. Montpellier, France. Unalan, A., Cebeci, Z., 2004. Siyah Alaca Sığırlarda ilk üç Laktasyon Süt Verimine Ait Genetik Parametreler ve Korelasyonların REML Yöntemi ile Tahmini. Turk J Vet Anim Sci, 28 (6): 1043‐1049. VanRaden, P. M., Sanders, A. H. , Tooker, M. E. , Miller, R. H., Norman, H. D., Kuhn, M. T. , Wiggans, G. R., 2004. Development of A National Genetic Evaluation For Cow Fertility. J. Dairy Sci., 87, 2285‐2292. Veerkamp, R. F., Koenen, E. P. C. De Jong†, G., 2001. Gene c Correla ons Among Body Condi on Score, Yield, And Fertility In First‐Parity Cows Estimated By Random Regression Models, Journal of D. Sci. Vol. 84, No. 10, 2327‐2335. Wall, E., Brotherstone, S., Woolliams, J. A., Banos, G., Coffey, M. P., 2003. Genetic Evaluation of Fertility Using Direct And Correlated Traits, J. Dairy Sci. 86: 4093‐4102. Zulkadır, U., Boztepe, S., 2003. Konuklar Tarım İşletmesinde Yetiştirilen Esmer Sığırların Bazı Verım Özelliklerinin Fenotipik ve Genetik Parametreleri II. Genetik Parametreler. S.Ü. Ziraat Fakültesi Dergisi, 17 (32), 74 ‐78. USE OF IMAGE ANALYSIS FOR INDIRECT ESTIMATES OF THE CARCASS MEASUREMENTS OF KIVIRCIK AND TURKGELDI SHEEP BREEDS Ahmet Refik ÖNAL, Yahya Tuncay TUNA, Ertan KÖYCÜ, Muhittin ÖZDER Namik Kemal University, Faculty of Agriculture, Dept. of Animal Sci., 59030, Tekirdag, Turkey ABSTRACT The aim of study was evaluated to determine some measurements of sheep carcass by image analysis such as Buttock Depth, Buttock Length, Rump Width, Thoracic Depth and Thoracic Width for Kivircik and Turkgeldi sheep breed. By this purpose four male Kivircik and six male Turkgeldi lambs carcass measure points determined by traditional (TT) ‐image processing (DIA) methods and both methods compared statistically. The lowest and highest difference values were 1.1‐6.9% for thoracic width and Buttock depth respectively for Kivircik lambs and 0.8‐3.4% for Buttock Length and Buttock Depth for Turkgeldi lambs. The results indicate that it is possible to estimate some measurements of carcass by digital image analysis methods. In order to improve accuracy of the results by image processing the numbers of carcass for per breed have to increase. Keywords: Image analysis, Carcass measurements, Kivircik, Turkgeldi, Sheep INTRODUCTION Many studies were conducted to linear regression models by using carcass measurements can be used for to predict meat yield of lamb carcasses (Stanford et al., 1997; Wolf et al., 2006; Cadavez 2009). The accuracy of the linear measurement techniques is direct effect to increase the degree of accuracy of the model to predict meat yield. The predict method of the carcass measurements should be accurate, fast, and automated. Image analysis methods has been used in many studies to predict linear body measurements (Kuchida et al.,1996; White et al., 2004; Onal and Ozder 2008; Negretti et al., 2008). The aim of this study was evaluated to possibilities of determinate sheep carcass measurements by image analysis. MATERIAL AND METHODS The results of four male Kivircik and six male Turkgeldi lambs carcass measurements which measured by Traditional (TT) and image analysis methods (DIA) were analysed in this study. The five measure points of carcass evaluated in this study; Buttock Depth, Buttock Length, Rump Width, Thoracic Depth and Thoracic Width of carcass measure points evaluated (Onal et al. 2009). Constant Scale Method used for measure of carcass measurements as image analysis method (Onal and Ozder 2008; Onal et al. 2009). However, carcass measured by Traditional Method and both methods compared statistically. The images got by a digital camera and transferred to computer. Carcass measurements obtained from images by using of reference points on the carcass surface by Image Pro‐plus 4.5 © (Media Cybernetics Inc. MD‐USA. 1995‐2001) software (Figure 1). th 248 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 1.Details of recording scene Digital camera Object Images Measuring Measurements Process by Text computer The results obtained from both method and descriptive statistical values evaluated by SPSS statistical software (1993). RESULTS AND DISCUSSION The results for each carcass measurements are represented by a mean and standard error for both sheep breeds in Table 1 and Table 2. The mean for buttock depth, buttock length, rump width, thoracic depth and thoracic width were 15.73, 27.75, 21.83, 29.43 and 22.45 by TT respectively and by DIA 16.90, 26.28, 20.92, 27.64 and 22.21 respectively for Kivircik sheep breed. Table 1. Descriptive Statistics of carcass measurements for both methods in Kivircik Breed (cm) Buttock Depth Buttock Length Rump Width Thoracic Depth Thoracic Width Methods N Mean±SE SE St.Dev Min. Max. TT 4 15,73 0,74 1,49 14,00 17,40 DIA 4 16,90 0,79 1,59 15,05 18,93 TT 4 27,75 0,60 1,19 26,50 29,00 DIA 4 26,28 0,73 1,47 25,01 28,38 TT 4 21,83 0,36 0,72 20,90 22,60 DIA 4 20,92 0,58 1,17 19,51 21,93 TT 4 29,43 0,57 1,14 28,00 30,80 DIA 4 27,64 0,26 0,51 27,34 28,40 TT 4 22,45 1,02 2,04 19,40 23,70 DIA 4 22,21 0,47 0,93 20,81 22,70 % Diff. 6,9 5,6 4,3 6,5 1,1 TT: Traditional Method DIA:Digital Image Analysis Measurements carcass of Turkgeldi sheep breeds were evaluated; 16.03, 28.00, 22.08, 28.33 and 21.75 respectively by TT and 16.60, 27.78, 22.28, 22.02 and 22.16 by DIA for buttock depth, buttock length, rump width, thoracic depth and thoracic width. Use Of Image Analysis For Indirect Estimates Of The Carcass Measurements Of Kıvırcık And Turkgeldi Sheep Breeds 249 Table 2. Descriptive Statistics of carcass measurements for both methods in Turkgeldi Breed(cm) Buttock Depth Buttock Length Rump Width Thoracic Depth Thoracic Width Methods N Mean±SE SE St.Dev Min. Max. TT 6 16,03 0,27 0,67 15,00 16,70 DIA 6 16,60 0,43 1,05 15,27 17,90 TT 6 28,00 0,56 1,38 26,50 30,00 DIA 6 27,78 0,83 2,02 25,43 30,44 TT 6 22,08 0,63 1,53 20,00 23,50 DIA 6 22,28 0,41 0,99 21,01 23,70 TT 6 28,33 0,31 0,75 27,00 29,00 DIA 6 28,02 0,24 0,58 27,23 28,75 TT 6 21,75 0,28 0,69 21,00 23,00 DIA 6 22,16 0,31 0,77 20,83 22,88 % Diff. 3,4 0,8 0,9 1,1 1,8 TT: Traditional Method DIA:Digital Image Analysis The percentile difference between values was in the range of 1.1 and 6.9% for Kivircik sheep breed, 0.8 and 3.4% for Turkgeldi sheep breed. The minimal difference was calculated for thoracic width by 1.1 and the maximal was 6,9 for buttock depth for Kivircik sheep breed. The differences for Turkgeldi sheep breed were evaluated as, minimal difference was calculated for Buttock length by 0.8 and the maximal was 3.4 for Buttock Depth. Digital image analysis method can be used to indirect estimate carcass measurements of Kivircik and Turkgeldi sheep breeds. The more study by DIA method in different breeds This study indicates that it is possible to estimate some measurements of carcass by digital image analysis methods. In order to improve the accuracy of the results, the numbers of carcass for per breed have to be increased. REFERENCES Cadavez, V. A. P. (2009). Prediction of lean meat proportion of lamb carcasses. Archiva Zootechnica, 12(4):46– 58. Kuchida K., Hamaya S., Saito Y., Suzuki M., Miyoshi S., (1996). Development of a body dimension measurement method for dairy cattle by computer image analysis with video camera. Ann. Sci. and Tech., 67, 878‐881. Negretti P, Bianconi G, Bartocci S, Terramoccia S, Verna M (2008). Determination of live weight and body condition score in lactating Mediterranean buffalo by visual image analysis. Livestock Science, 113:1–7. Onal, A.R., M. Ozder, E. Köycü, T. Sezenler (2009). A Visual Image Analysis Method For Estimating Sheep Carcass Traits. 4th Joint Meeting of the Network of Universities and Research Institutions of Animal Science of the South Eastern European Countries, p.432‐434, Stara Zagora, 14‐16 May 2009 Onal, A.R., M. Ozder (2008). The Effectiveness Of A Visual Image Analysis System For Estimate Body Measurements Of Turkgeldi Sheep, New trends for Innovation in the Mediterranean Animal Production, 6‐8 November 2008, Corte‐France SPSS. (Statistical Package For Social Sciences) for Windows copyright ©, spss, inc. 1993. Stanford, K. , Woloschuk, C. M., McClelland, L. A., Jones, S. D. M. and Price, M. A.(1997). Comparison of objective external carcass measurements and subjective conformation scores for prediction of lamb carcass quality. Canadian Journal of Animal Science, 72, 217–223. White R.P., Schofield C.P., Green D.M., Parson D. J., Whittemore C.T., (2004). The effectiveness of a visual image analysis (VIA) system for monitoring the performance of growing/finishing pigs. Anim. Sci. 78, 409‐418. Wolf, B. T., Jones, D. A. and Owen, M. G. (2006). In vivo prediction of carcasscomposition and muscularity in purebreed Texel lambs. Meat Science, 74, 416–423. BODY MEASUREMENTS OF THE KALOFER LONG‐HAIRED GOAT BREED IN BULGARIA ATANAS VUCHKOV¹, DOYTCHO DIMOV¹, SIDER SEDEFCHEV² 1. Agricultural University – Plovdiv, Department of Animal Science 12, Mendeleev St, 4000 Plovdiv, e‐mail: a_vu@abv.bg 2. Association for Autochthonous Goat Breeds in Bulgaria Pernik, e‐mail: aagbbg@gmail.com Abstract Kalofer long‐haired goat breed is a Bulgarian authohtonous goat breed kept in mountain area of Central Balkan (region of the city of Kalofer), that became popular between farmers in connection with demand of furs for mummer’s suits. As a result of this interest is created a herds in Blagoevgrad region based on typical specimens purchased from the original range. Six herds from Kalofer region and six herds from Blagoevgrad region were visited and 109 does and 39 bucks were chosen for the purposes of the study. Abundant long coat is special feature of Kalofer longhair goat breed, whose length vary between 30.13 cm and 33.69 cm at males, respectively at wither and rump. Different color of the coat can be found in the population – grey, black, black and white, red, red and white. In the population of the Kalofer region most common is gray color of coat – 33%. In the population of the Blagoevgrad region in the most common color is black color of coat – 61%. Kalofer longhair goat breed can be classified as medium size breed having height at withers 71.60 cm and 81.85 cm for female and male respectively. Diagonal body length as measurement were very similar to height at withers, which create impression of square shape of the body. Hearth girth were 88.88 cm at females and 101.06 cm at males. Sloping rump and bang at forehead were special features of Kalofer longhair goat breed. More of the goats have horns but it can be found also hornless does and bucks. Key words: body, measurements, coat, goat, breed. Introduction Local goat breeds in Bulgaria are poorly investigated and fully detailed data about their exterior and productive qualities are scarce. A number of authors who studied local goats in the past described them as low‐productive and of heterogeneous exterior. The investigations were initiated mainly because of the opportunity for crossbreeding with highly productive introduced breeds (Kadijski 1958, Balevska and Tjankov 1981, Solomonov, Kadijski and Lazarov 1984, Tjankov et al. 1996, Krastanov, 2003 ). In most of the papers the different local goat populations are mentioned under the collective term autochthonous goats. However, surviving populations are still to be found in some regions of the country, possessing characteristic and steadily transferred exterior traits. That fact calls for their separate study and description. Local long‐haired goats of specific exterior traits are found in the region of the town of Kalofer which have been preserved as a result of a purposeful farmers’ selection and the climatic, geographical and topography specifics of the region. Over the last years those animals have become highly popular with farmers in relation to the demand for mummer suit furs, typical of South‐ Western Bulgaria. As a result many animals of value have been purchased from the region of Kalofer and some of them have been liquidated for their furs while others have been used for stockbreeding, mainly in the district of Blagoevgrad. On the other hand, the restrictive measures imposed by the Central Balkan National Park Management Plan 2001‐2010 have a negative effect on the goat th 252 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) population in the Kalofer region by banning grazing within the Park. Those are the main factors that have led to the mass liquidation of valuable brood animals of exceptionally abundant hair as well as to limiting the population size of the Kalofer Long‐haired in its natural habitat. As a result of the purposeful breeding activities with animals purchased in the Kalofer region, lots of herds of this local breed were initiated in the Blagoevgrad District. Currently the greater part of the population is localized in South‐Western Bulgaria. The Association for Autochthonous Goat Breeds in Bulgaria was set up in 2009. The population of the Kalofer Long‐haired goats numbered 461 according to the Association data in 2009. Just one herd of 60 goats was registered in the breed natural area – Kalofer. The rest of the population was found predominantly in the district of Blagoevgrad. The aim of the present study is to carry out exterior measurements of the local Kalofer Long‐ haired goat in herds from the Kalofer region and the district of Blagoevgrad. To achieve that aim the following tasks were set: - trace down herds in the Kalofer region and the district of Blagoevgrad, in which typical long‐ haired goats are found; - carry out thorough body measurements of fully grown‐up bucks and does; Materials and methods In order to achieve the aims of the investigation 6 goat herds in the Kalofer region and 6 herd in the Blagoevgrad District were called on. A sample of 109 does and 39 bucks of the Kalofer Long‐ haired goat was defined. Grown‐up does and bucks above 3 years of age came into the sample. The investigation was carried out in the period 2010‐2011. In order to perform the body measurements the following tools were used: cane of Lidtin, compasses of Wilckens and a measuring band while Harvey’s (1990) statistical package was used for the data processing. Results and discussion The abundant and long‐haired coat is a characteristic trait of the Kalofer Long‐haired (Fig. 1 and 2). That feature is basic in the process of selection breeding carried out by farmers in the two areas of breed distribution. The hair of the studied goats was long, straight or slightly wavy, the average hair length at buck withers was 30.13 cm, and at the rump – 33.69 cm (Table 3). Coat coloration varied – black, gray, black‐and‐gray, red and red‐and‐white were observed (Table 1). A clearly pronounced trend was noticed pointing to black and black‐and‐white as the predominant coloration in the Blagoevgrad goat population – a total of 76% of the sample. In the region of Kalofer the predominant coloration was gray and white‐and‐gray – a total of 52% of the sample. The obtained results were logical, bearing in mind the fact that the farmers in the Blagoevgrad District preferred the black and black‐and‐white coloration because of the high demand for furs of that coloration. The large‐scale buying up of animals of that colour in the region of Kalofer led to its percentage decrease in the local population. A similar type of coloration – basic white with a black head and heart girth is also found in the Swiss long‐haired breed Valais Blackneck (Mason, 1996). The local Kalofer long‐haired goats are of a compact frame. The obtained results, given in Tables 2 and 3, show that the local Kalofer goats possess an almost quadratic body frame, the height at the buck withers being 81.85 cm and the diagonal body length – 81.52 cm. A similar format was observed in the females with a slight trend of elongation of the shape. Their height at withers was 71.60 cm and the diagonal body length – 73.99 cm. There is a statistically proven trend of goats from the Kalofer region to have a greater height at the withers and a shorter diagonal body length as compared with goats from the Blagoevgrad District. Body Measurements Of The Kalofer Long‐Haıred Goat Breed In Bulgarıa 253 In comparison with some dairy breeds, the Kalofer Long‐haired has a lower height at withers. According to data from the American National Saanen Breeders Association (http://nationalsaanenbreeders.com/), the minimum requirements for Saanen goat height at withers is 76.2 cm but most often that height varies from 78.74 cm to 81.28 cm. The minimum requirement for height at withers of the Anglo‐Nubian female goats in USA is 76 cm and in bucks – 88 cm. According to the Dairy Goat Society of Australia (DGSA), the ideal wither height of the Anglo‐Nubian female goat is considered to be 81 cm and in bucks – 94 cm. The height at withers in Shami (a Damascus goat raised in Egypt) females is 69.2 cm and in bucks – 83.1 cm (Helal, 2009). When compared with the height at withers (68.8 cm) established by earlier authors in other local goats in Bulgaria (Kadijski, 1958; Balevska and Tjankov, 1971) it is clear that the Kalofer Long‐ haired goats have higher figures for that feature. The height at the rump was 73.73 cm pointing to an expressed superstructure of the Kalofer Long‐haired goat (the height at the rump is greater by 2.1 cm than the one at the withers). The superstructure is particularly noticeable in the goats from the Kalofer region. The rump is sloping which is typical of both does and bucks. Both male and female animals have a comparatively strong and massive bone system. The shin‐bone girth in the does was 8.89 cm and in the bucks – 11.47 cm. The mother goats from the Blagoevgrad District have a proven bigger shin‐bone girth than the goats from the Kalofer region. The abundant hairiness of the lower parts of the legs additionally increased the value of that feature. The head of the Kalofer Long‐haired goat is averagely long (20.34 cm in the does and 22.59 cm in the bucks), usually straight but in some animals it could be of a slightly curved and broken profile line. The buck head width was 14.59 cm and in does – 13.01 cm. Regarding the horn shape of the females, the „prisca” type were the most frequent in the two distribution areas – 48% of the Kalofer region sample and 64% of the Blagoevgrad sample respectively. In both areas hornless goats could be found – 10% of the Kalofer region goats and 19% of the Blagoevgrad District goats (Table 1). An exceptionally typical horn shape was observed in the male animals – heteronomic spiraling horns, strongly side‐deviating, the distance between the horns – “point to point” was averagely 71.75 cm, with a deviation of up to 108 cm (Table 4). The horn length was averagely 47.56 cm with a deviation of up to 62 cm. There is a statistically proven trend showing that horn length increases with age, the intensity of that growth abating after 4 years of age. Judging by the horn shape, the Kalofer Long‐haired bucks are different from the Valais Blackneck Goat breed which is similar in coloration and hair coat but in the latter the male horns are of the „prisca” type, not spiraling side wards (Mason, 1996). The stretchability index in the Kalofer Long‐haired goats was 103.49. A proven trend of a more stretched format in the Blagoevgrad goats was reported as compared with the Kalofer region ones. There exists a highly proven trend for goats from the Blagoevgrad District to have a higher figure for the bone development index as compared with the goats from the Kalofer region. The long leg index in the Kalofer Long‐haired goats was 52.76. The Kalofer region goats have longer legs than those from the Blagoevgrad District. th 254 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Fig. 1 Buck of the Kalofer Long‐haired goat breed Fig. 2 Doe of the Kalofer Long‐haired goat breed Table 1. Type of horns and coat coloration of Kalofer long‐haired does Type of horns Kalofer region Blagoevgrad region n ‐ 48 n ‐ 61 number % number % Prisca 23 48 39 64 Aegagrus 17 35 5 8 Semiphlexycornia 3 7 6 9 Hornless 5 10 11 19 number % number % Black 7 15 37 61 Black and white 3 6 9 15 White and black 11 23 10 16 Gray 16 33 2 3 White and gray 9 19 ‐ ‐ Red “plav”’ 2 4 ‐ ‐ White and red ‐ ‐ 3 5 Coloration of coat Table 2. Body measurements of does of the Kalofer Long‐haired goat breed (n=109). Body measurements Height of withers Height of rump Diagonal body length Shoulder width Chest depth LS SE Kalofer region Blagoevgrad region F P 71.60 0.46 +0.96 –0.96 4.40 * 73.73 0.37 +1.38 –1.38 13.70 ** 73.99 0.56 –0.95 +0.95 2.93 * 19.12 0.20 –0.29 +0.29 2.00 33.80 0.27 –0.002 +0.002 0.003 Body Measurements Of The Kalofer Long‐Haıred Goat Breed In Bulgarıa Body measurements LS SE Kalofer region 255 Blagoevgrad region F P 13.01 0.10 –0.60 +0.60 38.13 *** 20.34 0.13 +0.35 –0.35 6.60 * 16.98 0.13 +0.04 –0.04 0.04 23.86 0.18 –0.21 +0.21 1.51 69.29 0.43 –0.56 +0.56 1.72 15.90 0.14 –0.21 +0.21 2.19 6.98 0.58 –0.20 +0.20 12.53 *** 27.66 0.57 –1.55 +1.55 7.59 ** 23.45 0.47 –0.76 +0.76 2.57 8.89 0.06 –0.24 +0.24 14.9 88.8 0.51 –3.33 +3.33 0.43 103.49 0.66 –2.77 +2.77 17.68 *** 52.76 0.27 +0.65 –0.65 5.85 * Index of bone development 12.42 0.10 –0.48 +0.48 23.22 *** Index of massiveness 124.42 0.76 –1.28 +1.28 2.85 * Head width Head length Width of rump Rump length Right back length Ear length Ear width Coat length at rump Coat length at withers Shin‐bone girth Heart girth Stretchability index *** Long leg index th 256 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 3. Body measurements of bucks of the Kalofer long‐haired goat breed (n – 39) Body measurements LS SE Kalofer region Blagoevgrad region F P 81.85 0.63 +0.15 –0.15 0.06 82.40 0.74 +1.13 –1.13 2.37 81.52 1.13 +0.06 ‐0.06 0.04 22.22 0.41 –0.45 +0.45 1.23 38.38 0.63 –0.03 +0.03 0.03 14.59 0.22 –0.40 +0.40 2.79 22.59 0.26 ‐0.19 +0.19 0.57 19.04 0.25 +0.04 –0.04 0.04 26.71 0.33 –0.33 +0.33 0.95 77.61 1.14 –1.69 +1.69 2.19 16.21 0.29 +0.21 ‐0.21 0.52 7.11 0.14 –0.12 +0.12 0.71 33.69 1.09 –1.23 +1.23 1.26 30.13 1.05 –3.21 +3.21 9.29 ** 11.47 0.08 +0.14 ‐0.14 2.95 * 101.06 0.80 –0.75 +0.75 0.85 99.50 0.95 –0.21 +0.21 0.05 53.14 0.59 +0.09 –0.09 0.02 Index of bone development 14.03 0.10 +0.15 ‐0.15 2.32 Index of massiveness 123.59 0.96 –1.09 +1.09 1.29 Height of withers Height of rump Diagonal body length Shoulder width Chest depth Head width Head length Width of rump Rump length Right back length Ear length Ear width Coat length at rump Coat length at withers Shin‐bone girth Hearth girth Stretchability index Long leg index Body Measurements Of The Kalofer Long‐Haıred Goat Breed In Bulgarıa 257 Table 4. Size of the horns on males. Size of the horns on males LS SE min max 3‐ 4‐ 5‐ 6‐ years of age years of age years of age years of age n‐5 n‐4 n‐10 Horn length, n‐18 F P * 47.56 1.26 33.0 62.0 –4.26 ‐2.56 +3.36 +3.18 2.50 71.75 3.14 47.0 108.0 –7.75 ‐3.64 ‐1.35 +12.74 1.57 cm Distance between point of the horns, cm Conclusions The following conclusions could be made on the basis of the study outcomes: 1. The height at the withers in the local Kalofer long‐haired bucks is 81.85 cm and the diagonal body length – 81.52 cm. In the does the figures are 71.60 cm and 73.99 cm respectively. The hair of the local Kalofer long‐haired goats is long, straight or slightly wavy. In the bucks the average hair length at the withers is 30.13 cm and at the rump – 33.69 cm. 2. In the region of Kalofer the most widely spread colour is gray – it is found in 33% of the animals, while in the Blagoevgrad District the most frequent colour is black – in 61% of the studied animals. 3. The breed distribution area exerts a high‐ and average‐probability degree impact on the following exterior features of the Kalofer long‐haired goats: height at the rump, head width, ear width, shin‐bone girth, hair length at the rump. 4. The bucks of the Kalofer long‐haired have a specific horn shape – spiraling, strongly side‐ deviating, the distance between the horns – “point to point” is 71.75 cm. Age has an evident impact on the horn length. 5. The most frequent goat horn type in the two distribution areas is „prisca” – in 48% of the studied females in the Kalofer region and in 64% of the does in the Blagoevgrad District. LIST USING LITERATURE 1. Balevska, R., S. Tjankov. 1971. Study of the Rilomanastirska goat breed. Scientific studies of a Zootech. Faculty, t. XXII, Sofia., Zemizdat. 315 – 323. 2. Kadijski, E. 1958. Study of the local goats breed. Disertation. 3. Krastanov, Zh. 2003. Status of genetic resource in Bulgaria. Animal science, p.1‐2, pages 7‐9. 4. Management Plan of National Park “Central Balkan”, 2001‐2010 5. Solomonov H., E. Kadijski, I. Lazarov, 1984. Goat breeding. Sofia. Zemizdat. p. 133. 6. Tjankov,S., I. Stankov, R. Slavov. 1996. Goat breeding, St. Zagora. p. 132. 7. Harvey, W.R. 1990. Mixed model least squares and maximum likelihood computer program PC‐2 version. 8. Helal, A. 2009. Body measurements and some coat characterstics of Shammi (Damascus) goats raised in North Sinai, Egypt. World Journal of Agricultural Sciences 5 (5): 646‐650. 9. Mason, I.L. 1996. A World Dictionary of Livestock Breeds, Types and Varieties. Fourth Edition. C.A.B International. 273 pp. 10. http://nationalsaanenbreeders.com/ 11. http://home.vicnet.net.au/~goats/dgsavictoria/standards.htm ENVIRONMENTAL EFFECTS ON PRODUCTIVE AND REPRODUCTIVE PERFORMANCE OF KHUZESTANI BUFFALOES IN IRAN B. TAHERI DEZFULI1*, A. NEJATI JAVAREMI2, M.A. ABBASI3, J. FAYAZI4, M. CHAMANI5 1. PhD student of animal breeding, Faculty of Agriculture, Science and Research Branch, Islamic Azad University, Tehran, Iran. 2. Department of Animal Science, Faculty of Agriculture, The University of Tehran, Karaj, Iran. 3. Animal Science Research Institute, Karaj, Iran. 4. Department of Animal Science, Ramin Agriculture and Natural Resource University, Ahvaz, Iran. 5. Department of Animal Science, Faculty of Agriculture, Science and Research Branch, Islamic Azad University, Tehran, Iran. * Baharah_tah2003@yahoo.com Abstract In this study, 16594 records of production and reproduction performance of Khuzestani buffaloes, collected from 1993 to 2010, were utilized for the evaluation of some environmental factors .The effects of herd, calving year, calving season and parity were evaluated on the traits under a mixed linear model. Herd, year of birth and season were considered as fixed effects for age at first calving and in analyzes of milk yield. Lactation length was considered as a covariate. Mean and standard deviation of the traits were 1939.76 ± 6.50 kg, 120.27 ± 0.48 kg, 83.94 ± 0.40 kg, 6.1 ± 0.01 %, 3.9 ± 0.004 %, 200.34 ± 0.44 days, 4.68 ± 0.02 kg, 9.58 ± 0.04 kg, 156 ± 2.05 days, 465.21 ± 2.05 days, 240.27 ± 1.89 days and 3.68 ± 0.02 years for milk yield, fat yield, protein yield, fat percentage, protein percentage, lactation length, milk yield per day of calving Interval, milk yield per day of lactation length ,open days, calving interval, dry period and age at first calving ,respectively .The effects of herd, calving year and parity were significant (P<0.01) for all traits .The effects of herd, birth year and birth season were significant on age at first calving (P<0.01), while the effect of season of calving was not significant on protein percentage, milk yield per day of lactation length, milk yield per day of calving interval and open days (P>0.01). Keywords: buffalo, production, reproduction, Khuzestan, environment. Introduction The domestic water buffalo is one of the important animal genetic resources of Iran that have major role in rural economy. Khuzestan, located in the south west of Iran, is one of the main regions of buffalo breeding and its suitable climatic condition for breeding this animal, causing more than five thousand jobs to rural employment in growing and rearing buffalo. There are over 138000 buffaloes in Khuzestan. Relative importance of buffalo products is the same in various regions, and in all places buffaloes are reared primarily for milk production so that about 40 percent of dairy products of this province are from buffaloes now. Due to the high level of fat percentage (6‐7%), buffalo milk has a special feature and its products are of high economic value. Quality and the value of buffalo milk and its products and a considerable population of buffalo in Khuzestan, has made buffalo as the most important domestic animal of this province, so that efforts for improvement of buffalo production and development of buffalo rearing have been more. Therefore, increasing its production capacity and full use of the genetic potential of this animal can be effective in economic development of buffalo rearing and improving buffalo owner's situation, in addition of providing a significant portion of the protein needed by the region. In this regard, recognizing the production and th 260 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) reproduction potential of this animal and environmental factors affected these traits are required. Studies in the field of buffaloes in Bulgaria have shown that the traits such as age at first calving, calving interval and milk production are some important traits which affect greatly farm profit in buffalo farms (14). Also, the importance of considering production and reproduction traits of the first lactation in the selection index has been reported for Murrah and NiliRavi buffaloes in India by Kumar et al. (2008). In another study, Seno et al. (2010), reported genetic correlation between milk yield and age at first calving as ‐0.15 for Murrah buffaloes in Brazil and indicated that daughters of the buffalo bulls with high breeding values for milk production could reach physiological mature at an early age. This study is attempted to investigate production and reproduction traits of buffaloes of Khuzestan and address the effect of environmental factors to perform basic actions in the field of evaluation its performance and buffalo breeding. Materials and Methods In this research, 16594 production and reproduction performance records and pedigree information of buffalo cows, distributed in 526 buffalo herds in Khuzestan province, have been used. Buffalo cows had all given birth during 1993 ‐ 2010. Studied traits corresponded to milk yield (MY), fat yield (FY), fat percentage (FP), protein yield (PY), protein percentage (PP), lactation length (LL), dry period (DP), milk yield per day of calving interval (MYPDCL), milk yield per day of lactation length (MYPDLL), number of open days (OP), calving interval (CI) and age at first calving (AFC). Entry and manipulation of data was done using Excel software. Records of herds which their Information was not accurate or was incomplete were excluded. Birth and calving year were divided in two seasons: warm season, May to October and cold season, November to April. The Effect of herd, calving year, calving season and parity were studied as fixed effects for all traits. Birth year and birth season were studied with the herd effect for age at first calving. Also, Lactation length was considered as covariate for milk yield trait. The GLM procedure of SAS software was employed to analysis the data as the following statistical model: Yijklmno = μ + ai + Hj + Pk + Yrl + Sm + b (LLn) + eijklmno Where, Yijklmno = observed value of the trait, μ = overall mean, ai = random effect of ith animal, Hj = the effect of jth herd (j = maximum 404), Pk = the effect of kth parity (k = maximum 18), Yrl = the effect of lth calving year or birth year (l = maximum 18), Sm = the effect of mth calving season or birth season (m = 2), b = regression coefficient of lactation length on milk production trait, LLn = the effect of nth lactation length as covariate and eijklmno = random residual effect. Results and Discussion Least square means and standard errors for production and reproduction traits are presented in table1. In this study, the mean and standard error values of production traits including of milk yield, fat yield, fat percentage, protein yield, protein percentage, lactation length, milk yield per day of calving interval and milk per day of lactation length were estimated as 1939.76 ± 6.5 kg, 120.27± 0.48 kg, 6.1± 0.01 percent, 83.94 ± 0.40 kg, 3.9 ± 0.004 percent, 200.34 ± 0.44 days, 4.68 ± 0.02 kg and 9.58± 0.04 kg, respectively. The means and standard errors of the reproductive traits were also estimated as 240.27 ± 1.89 days, 156 ± 2.05 days, 465.21 ± 2.05 days and 3.68 ± 0.02 years for dry period, open days, calving interval and age at first calving, respectively. Environmental Effects On Productive And Reproductive Performance Of Khuzestani Buffaloes In Iran 261 Figure1‐ Buffalo herds in Khuzestan of Iran Milk yield is the most important trait in dairy animal production and total yield in one lactation period is often used in genetic evaluation of them, besides its fat and protein percent. The average milk production was 1939.76 kg for Khuzestani buffalo that in comparison with other Iranian buffaloes showed higher milk yield. Sanjabi et al. (2009), in the study of milk and fat yield records of the Iranian river buffaloes, reported the average milk production of buffaloes in Gilan, Mazandaran, East Azerbaijan, West Azerbaijan, Khuzestan and Ardebil as 1452, 1586, 1382, 1183, 2135 and 1189 kg, respectively and the highest milk production was obtained for buffaloes in Khuzestan. However, the amount of milk production of Khuzestani buffaloes is less than some other breeds of the world, so that Ghaffar and Chaudhary (2007) reported the average milk production of NiliRavi buffaloes of Pakistan as 2481.82 kg. According to traditional raising buffalo’s barn in Khuzestan and poor management situation, it is expected that improving environmental condition such as feeding and management, will provide incidence of maximum of buffalo genetic ability and its milk production will be increased. Aspilcueta‐Borquis et al. (2010), in the study of Murrah buffaloes in Brazil, reported the average of milk yield, fat yield and protein yield for a 305‐day lactation period as 1813, 118.3 and 81.6 kg, respectively. Fat and protein yield obtained in our study (120 kg fat and 83 kg protein yield) are comparable with those reported for Murrah buffalo in Brazil, however, lower than the amounts reported by Rosati and VanVleck (2007) for the Mediterranean buffaloes in Italy (196.9 kg of fat and 104.7 kg protein). th 262 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1‐ statistical characteristic of production and reproduction traits of Buffaloes Traits* The Number of Animals The Number of Records Mean ± Standard Error Standard Deviation MY (kg) FY (kg) FP (%) PY (kg) PP (%) LL (day) MYPD CI (kg) MYPD LL (kg) CI (day) DP (day) OD (day) AFC (year) 7834 7756 4456 7284 7303 7760 5360 5362 5383 5468 5367 4314 16594 15232 15232 11336 11309 15971 7859 7763 8090 8636 7989 1925 1939.76 ± 6.5 120.27 ± 0.48 6.1 ± 0.01 83.94 ± 0.40 3.9 ± 0.004 200.34 ± 0.44 4.68 ± 0.02 9.58 ± 0.04 465.21 ± 2.05 240.27 ± 1.89 156 ± 2.05 3.68 ± 0.02 837.33 60.07 1.15 43.42 0.41 55.83 2.09 3.68 185.06 176.55 183.53 1.04 * MY= milk yield, FY= fat yield, FP= fat percentage, PY= protein yield, PP= protein percentage, LL= lactation length, DP= dry period, MYPDCL= milk yield per day of calving interval , MYPDLL= milk yield per day of lactation length, OP= number of open days, CI= calving interval and AFC = age at first calving. Based on the obtained results, the average of lactation length of buffalo in Khuzestan is estimated about 200 days which is similar to the Egyptian buffaloes and buffaloes in Azerbaijan of Iran. Karimi et al. (2007), have been reported the average amount of milk production, lactation length and fat percentage for Azerbaijani buffaloes as 1244 kg, 206 days and 7.56 percent, respectively . Also, Aziz et al. (2001) in their experiment about production and reproduction traits of Egyptian buffaloes, estimated lactation length of buffaloes as 208.6 days. However, buffaloes of Khuzestan have shorter lactation period than Mediterranean, Murrah and Jafarabady buffaloes (276.68, 258.03 and 235.59 days, respectively). In general, calving interval, open days and dry period are traits with low heritability and these traits are associated with a high degree of variability is caused by different environmental factors. The estimated average of dry period for buffaloes in present study (240.7 ± 1,98 days) is longer than those were reported in the studies of NiliRavi buffaloes of Pakistan (194.41 ± 12.37 days) (7), buffaloes of Marche region in Italy (142 to 165 days) and Murrah buffaloes in India (184 days ) (5 & 13). But this period for buffaloes of Khuzestan is shorter than Egyptian buffaloes with 307.3 days in dry (3). The average of age at first calving for Khuzestani buffaloes was estimated as 3.68 years which is equal to 44.77 months. Age at first calving is different in various breeds and also depending on the type of farm management and buffalo nutrition. In the study of Thiruvenkadan et al. (2010), the mean of age at first calving was reported at 51.9 months of age for Murrah buffaloes in Coastal region of India. However, the average of age at first calving were reported in different buffalo studies less and about 35.92, 39.5 and 39 months of age for buffaloes of Marche region in Italy, Italian buffaloes and Murrah buffaloes in Brazil, respectively (13,12 & 22). The average of calving interval for buffaloes in our study was close to the amounts reported for the buffaloes of Marche region in Italy and Turkish Anatolian buffaloes (467 days) but it is longer than reported period for buffalo of Pakistan (415 days) (13 & 20). Generally, having a shorter calving interval, milk production would be more in animal production life. This is more important for the buffaloes. Because buffalo milk production is less than cow’s production and so prolonged calving interval will bring more losses for the buffalo owners. Therefore, for the economic development of buffalo rearing, various factors affecting buffalo calving interval reducing should also be examined The number of days open also was estimated as 156 days for Khuzestani buffaloes that was shorter, compared with Egyptian buffaloes open days period (199.5 days) (3). Environmental Effects On Productive And Reproductive Performance Of Khuzestani Buffaloes In Iran 263 Milk production per day of calving interval is known as a trait that combined milk production with calving interval as one reproduction trait in to a single index. These two traits usually are considered as two contrasting traits. So the amount of milk produced per day of calving interval can be as an indicator trait to improve both milk yield and calving interval together. However, the use of this trait is less considered in genetic improvement. The average of milk yield per day of calving interval was estimated as 4.68 kg in our study that is more than the amount reported by Ramos et al. (2004)(3.75 kg). Also, Hamid et al. (2003) reported milk yield per day of calving interval for buffalo farms of Pakistan to be 4.83kg. The average of milk production per day of lactation length was 9.58 kg for buffaloes in Khuzestan. Amble et al. (1970) have been reported this trait for Indian buffaloes in army farms as 5.14 kg with an average of 279 days for lactation length. This trait was also reported for Surti buffaloes as 5.17kg (19). To address the effective environmental factors, the effect of herd, of calving (birth) year, calving (birth) season and parity were studied for production and reproductive traits. The effect of herd, calving year and parity were significant for all considered traits (P<0.05). In contrast, calving season was not significant for protein percentage, calving interval and open days (P>0.05). Based on the calving records, the most buffalo's calving were in the autumn. The effect of lactation length was significant for milk production trait as a covariate (P<0.05). Also, herd, birth year and birth season had significant effect for age at first calving (P<0.05). In the study of Khalil et al. (1991), Ibrahim (1998) and Vasconcellos and Tonhati (1998), lactation yield, calving interval, dry period and open days was significantly affected by calving year and parity for the various breeds of buffalo, which is consistent with results obtained in present study. Matti et al. (2005) also in the study of buffaloes in Marche region of Italy, reported significant effect of calving year and parity for lactation length, milk yield and open days. However, in their study the effect of calving year was not significant for dry period. As reported by Aziz et al. (2001), season of calving had significant effect on calving interval, dry period and open days of Egyptian buffaloes, but this effect was non‐significant for lactation length. In Matti et al. study (2005), also the effect of season of calving was significant for lactation length, fat yield and protein yield. Figure 2‐ Buffalo of Khuzestan Generally, study the production and reproduction traits of buffaloes in Khuzestan and the effect of some environmental factors showed that despite the poor condition of the buffalo management and nutrition, these animals have good performance and milk production which is close to production of some famous breeds of buffalo around the world. Therefore, to develop and improve buffaloes rearing in the province, besides the breeding activities having regard to factors such as improving nutrition and management practices are necessary. th 264 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. Amble, V.N., Gopalau, R., Malhotra, J.C. and Mehrotra, P.C. (1970). Some Vital Statistics And Genetic Parameters Of Indian Buffaloes At Military Dairy Farms. Indian Journal of Animal Science, 40:377‐388. Aspilcueta‐Borquis, R.R., Seana, R.C., Berrrocal, M.H.M., Seno, L.O., Bignardi, A.B., Faro, L.E., et al. (2010). Genetic Parameters For Milk, Fat, Protein Yields In Murrah Buffaloes. Genetic and Molecular Biology, 33(1): 71‐77. Aziz, M.A., Schoeman, S.J., Jordaan, G.F., El‐Chafie, O.M. and Mahdy, A.T. (2001). Genetic And Phenotypic Variation Of Some Reproductive Traits In Egyptian Buffalo. South African Journal of Animal Science, 31(3):195‐ 199. Ghaffar, A. and Chaudhry, M.A. (2007). Daughter Performance Based Buffalo Bull Ranking For Boosting Milk Production In Pakistan. Italian Journal of Animal Science, 6(Suppl. 2): 267‐270. Gupta, B.D., Kaushik, S.N. and Mishra, R.R. (1994). Study On Reproductive Efficiency Parameters Of Murrah Buffaloes. Indian Journal of Dairy Science, 47(4): 257‐264. Hamid, S.K, Farooq, M., Mian, M.A., Syed, M. and Jamal, S. (2003). Milk Production Performance And Inter‐ Relationship Among Traits Of Economic Importance In Buffaloes Maintained At Commercial Dairy Farms. Livestock Research for Rural Development, 15(2): http://www.lrrd.org/lrrd15/10/hami1510.htm. Hussain, Z., Javed, K., Hussain, S.M.I., and Kiyani, G.S. (2006). Some Environmental Effects On Productive Performance Of Nili‐Ravi Buffaloes In Azad Kashmir. Journal of Animal and Plant Science, 16(3‐4):66‐69. Ibrahim, S.A. (1998). Analysis Of Non‐Genetic Factors Affecting Calving Interval And Post‐Partum Traits In Egyptian Buffaloes. Egyptian Journal of Animal Production, 35:597‐607. Karimi, H., Mahpeakar, H.A., Neamattollahi, A., Anvari, R., Fard Moradnia, A. and Niksan, K. (2007). The Study Of Important Factor On Reproduction Of Azerbaijan Buffalo (Bubalus bubalis). Journal of Animal and Veterinary Advances, 6:1296‐1297. Khalil, M.H., Mourad, K.A., Mohamed, M.M. and Owen, J.B. (1991). Genetic And Phenotypic Evaluation For Reproductive Performance Of Egyptian Buffaloes. Animal Production, 52:75‐82. Kumar, S., Yadav, M.C. and Prasad, R.B. (2008). Multi‐Trait Selection For Genetic Improvement In Indian Buffaloes. Buffalo Bulletin, 27 (1):154‐160. Matassino, D. and Rossi, G. (1998). Biotecnologie E Miglioramento Genetico. Bubalus bubalis, I: 269‐304. Matti, S., Tommei, B. and Pasquini, M. (2005). Reproduction And Production In A Buffalo Farm Of The Marche Region: A Ten‐Year Study. Italian Journal of Animal Science, 4(2):307‐309. Peeva, T. (2004). Economic Selection Traits‐Source For Genetic Improvement In Milk Buffaloes. Proceedings of the 7th World Buffalo Congress, Abstracts, Philippine, p: 16. Ramos, A.A., Wechsler, F.S., Gonçalves, H.C. and Malhado, C.H. (2004). Milk Yield Per Day Of Calving Interval In Dairy Buffalo Cows. Proceedings of the 7th World Buffalo Congress, Philippine. pp: 247‐248. Rosati, A. and Van Vleck, L.D. (2007). Estimation Of Genetic Parameters For Milk, Fat, Protein And Mozzarella Cheese Production In Italian River Buffalo Population. Livestock Production Science, 74:185‐190. Sanjabi, M.R., Naderfard, H.R., Moeini, M.M., Lavaf, A. and Ahadi, A.H. (2009). Potential Of Milk Production Of Iranian Water Buffaloes. EAAP‐60th Annual Meeting, Barcelona. Session 01, p: 21. Seno, L.O., Cardos, V.L., Faro, L.E, Sesana, R.C., Aspilcueta‐Borquis, R.R., Camargo, G.M.F. and Tonhati, H. (2010). Genetic Parameters For Milk Yield, Age At First Calving And Interval Between First And Second Calving In Milk Murrah Buffaloes. Livestock Research for Rural Development, 22(2): Available on: http://www.lrrd.org/lrrd22/2/seno22038.htm. Singh, C.V. and Singh, RV. (1989). Genetic And Non‐Genetic Factors Affecting First, First Two And First Three Lactation Cumulative Yield And Their Average Daily Yield/Cumulative Lactation Period In Nili‐Ravi Buffaloes. Livestock Advisor, 16(5):5‐9. Tekerli, M., Kucukke Babci, M., Akalin, N.H. and Kocak, S. (2001). Effects Of Environmental Factors On Some Milk Production Traits, Persistency And Calving Interval Of Anatolian Buffaloes. Livestock production science, 68:275‐281. Thiruvenkadan, A.K., Panneerselvam, S., Rajendran, R. and Murali, N. (2010). Analysis On The Productive And Reproductive Traits Of Murrah Buffalo Cows Maintained In The Coastal Region Of India. South African Journal of Animal Science, 3(1):1‐4. Tonhati, H., Vasconcellos, F.B. and Albuquerque, L.G. (2000). Genetic Aspects Of Productive And Reproductive Traits In A Murrah Buffalo Herd In Sao Paulo, Brazil. Journal of Animal Breeding and Genetics, 17(5):331‐336. Vasconcellos, B.F. and Tonhati, H. (1998). Inbreeding And Its Effects On Some Productive And Reproductive Traits In A Murrah Buffalo Herd. Journal of Animal Breeding and Genetics, 115:299‐306. INVESTIGATION OF “NATURAL RESISTANCE ASSOCIATED MACROPHAGE PROTEIN 1 (NRAMP1)” GENE POLYMORPHISM IN NATIVE CATTLE BREEDS IN TURKEY B.EKİM1*, K.S.DİKER2 1 Department of Laparoscopic Surgery Training Center, Faculty of Medicine, Gazi University, Ankara 2 Department of Microbiology, Faculty of Veterinary Medicine, Ankara University, Ankara * Corresponding author: ekimburcu@gmail.com Introduction The natural resistance associated macrophage protein 1 (Nramp1) has been reported to confer susceptibility to Mycobacterium bovis, Salmonella typhimurium and Leishmania donovani in the mouse (1). Bovine (bos taurus) NRAMP1 cDNA has been cloned and was found to have an 86.9% sequence identity with mouse Nramp1 (2). It was reported that in cattle a microsatellite polymorphism in the 3’ untranslated region (UTR) affected the expression of NRAMP1 and also affected the Brucella abortus replication (3). The aim of this study was to investigate the polymorphism of the NRAMP1 gene in Turkish cattle breeds which was associated with the resistance to intracellular pathogens and to provide data which will form a basis of the term “genetic resistance”. Materials and Methods DNA from a total of 200 blood samples, from regions of Turkey, belong to four Turkish native cattle breeds (Turkish Grey, South Anatolian Red, East Anatolian Red, Anatolian Black) and two exotic cattle breeds (Holstein, Simmental) was isolated by phenol‐chloroform‐isoamlyalcohol method and amplified by PCR. Fragment analysis and DNA sequencing methods were applied to DNA amplicons for the investigation of polymorphism caused due to the variations of (GT)n numbers in the 3’UTR region of bovine NRAMP1 gene. Allelic diversity and allelic richness comparisons were performed by F statistics (FSTAT) (4). Results As homozygous 175bp of DNA amplicons were observed in exotic cattle breeds, homozygous 173bp, 175bp, 179bp and 181bp of DNA amplicons were detected in native Turkish breeds and DNA sequencing analysis revealed that 173bp, 175bp, 177bp, 179bp, 181bp of DNA fragments were carried (GT)13, (GT)14, (GT)15, (GT)16 and (GT)17 repeats, respectively. NRAMP1 gene loci of the selected sequences of native and exotic cattle breeds were compared with the gene databases for the same region of NRAMP1 3’UTR by using BLAST software (5). This comparison demonstrated 96%‐ 100% of homology between the DNA sequences of the same region. Five different alleles were found in 6 cattle breeds investigated. When the investigated locus of the bovine NRAMP1 gene was compared in terms of allelic diversity and allelic richness, allelic diversity and allelic richness ratios of native Turkish breeds were found higher. In addition, native Turkish breeds were demonstrated more polymorphic structure for 3’UTR region of the bovine NRAMP1 gene. th 266 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Discussion The results of the study will make contributions to the evaluation of the resistance to the infections caused by intracellular pathogens and also breeding of farm animals more resistant to the infections by providing information about the term of “genetic resistance of the Turkish cattle breeds”. Key words Cattle, Gene polymorphism, NRAMP1, Turkey, REFERENCES 1. VIDAL SM, MALO D, VOGAN K, SKAMENE E, GROS P. (1993) Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 73 469‐485. 2. FENG J, LI Y, HASHAD M, SCHURR E, GROSS P, ADAMS GL, TEMPLETON GW. (1996) Bovine natural resistance associated macrophage protein 1 (NRAMP1) gene. Genome Res 6 956‐964. 3. BARTHEL R, FENG J, PIEDRAHITA JA, MCMURRAY DN, TEMPLETON JW, ADAMS LG. (2001) Stable transfection of the bovine NRAMP1 gene into murine RAW264.7 cells: Effect on Brucella abortus survival. Infect Immun 69 3110‐3119. 4. GOUDET J. (2002). FSTAT, Version 2.9.3.2. Lausanne Switzerland 5. BASIC LOCAL ALİGNMENT SEARCH TOOL (BLAST). (2010). Erişim: http://blast.ncbi.nlm.nih.gov/Blast.cgi. Erişim tarihi: 10.07.2010. AN IMPORTANT GENOTYPE FOR THE TURKISH AGRO‐BIODIVERSITY: GÖKÇEADA GOAT C.TÖLÜ*, T. SAVAŞ Department of Animal Science, Agriculture Faculty, Çanakkale Onsekiz Mart University 17020 Çanakkale Turkey, *Corresponding author: cemiltolu@comu.edu.tr; tsavas@comu.edu.tr Abstract In this study, it was aimed to report some traits of Gökçeada goats, which successfully maintain themselves under the natural conditions of Gökçeada, with respect to their protection within the scope of genetic resources. In this respect the information obtained from the goats supplied from the Island and reared in a semi‐intensive system at the Goat Husbandry Unit at Çanakkale Onsekiz Mart University and also the information obtained from the literature were collected and the biological and zootechnical identifications of the Gökçeada goat were performed. Gökçeada goats, which are predominantly black, have yellow or red blazes on both sides of their heads including their eyes. It was seen that Gökçeada goats had similar body measurements and lower live weights as compared to those of the same species on the mainland. The birth weight and the mature live weight of Gökçeada goats were found as 2.55 kg and 38 kg, respectively, whereas their mean kid yield per goat at birth was determined as 1.6 to 1.8 kids. Individuals with a milk yield of 591 kg were striking in the Gökçeada genotype, in which the mean lactation length and the mean lactation milk yield were determined as 251 to 259 days and 227 to 245 kg, respectively. Its milk fat (4.92‐5.75%) and milk protein (3.29%) resembled those of our other native breeds. It is necessary to reveal, with more elaborate studies, the potential for Gökçeada goat cheese that is greatly demanded on the Island. It was determined that the Gökçeada kids, which were considered as dairy kids, had some small but nonfat carcass and that their meat was soft and of a light color and had a slight smell. One should be careful about the adaptation of the genotype, which successfully maintains itself under the island conditions and which is the source of income for producers, to different production systems. Keywords: Gökçeada (Imbros), morphology, goat milk, kid, niche product Introduction It is known that in every region around the world, different animal species are confronted with the danger of extinction at various rates (Rege, 1999). A similar case is also present in Turkey (Ertuğrul et al., 2005). The most important reasons for this include unlimited and identical cross‐ breeding and artificial insemination (Ruanne, 2000). Changing conditions and the ongoing pressure of natural selection are essential in the extinction of breeds. However, there are significant reasons for the protection of domestic species and breeds (Savaş, 1995; Basedow, 1998). There are some 5,593,560 head goats in Turkey (FAO, 2009). It is seen that the number of goats in Turkey follows some continually decreasing course upon the decreasing production in the recent years. It might be stated that despite the decrease in the number, the extensive and semi‐ extensive production systems have gained momentum towards the semi‐intensive and even intensive systems. It is reported that 96% of the goat wealth of Turkey consists of Hair goats (Anonymous, 2007). Apart from Hair and Angora (Mohair) goats, there are Saanen Goats, Maltese Goats, Damascus Goats, Kilis Goats, Georgian Goats, Abkhazian Goats, German White Goats and some local goat breeds in Turkey (Yalçın, 1990; Özder, 2006). Nevertheless, Hair goat is reported to be a general expression in our country and a classification for the genotypes other than some goat breeds and it is expressed that the genotype groups classified as Hair goats should be identified at th 268 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) the soonest time (Ertuğrul et al., 2005). The genotype differences have been revealed more clearly with the banding activities by the sheep/goat producers’ unions in Turkey within the last 3 years. It is seen that there is a considerable number of different goat breeds in many areas all around the world (Bertaglia et al., 2007) and that their yield traits are in good condition (Serradilla, 2001). Furthermore, a contribution is made to the economy by producing special products from these goats that are in small populations (Boyazoglu and Morand‐Fehr, 2001). The cheese, which contains goat milk in its composition, and goat kid meat are demanded in Turkey. Besides, it is expressed by ice cream producers that goat milk is highly favorable for ice cream. The scientific studies on the Gökçeada goat are at limited levels. The team, also including the authors, first of all defined production under the island conditions (Daş et al., 2002) and then formed scientific data about the genotype, through a TÜBİTAK project (TOVAG 106O411) and a doctoral project (Tölü, 2009). The biological and zootechnical identifications of the Gökçeada goat, an essential source for agro‐biodiversity, were performed in this study. Gökçeada Geography Gökçeada, an island affiliated to the province of Çanakkale, has an area of 289 km2. Gökçeada is located at a distance of 14 miles (25 km) from the Gelibolu Peninsula to the mainland. There is a town center and nine villages on the Island. Gökçeada has a quite rugged land structure and consisted of volcanic masses. Considerable amounts of oleander, olive, maquis type of shrubs and pine forests are encountered. The pastures excluding the pasture areas protected from animal pressure are heavily covered by thorny burnet (Sarcopoterium spinosum) plant and tragacanth plant (Astragalus sp.) species. Of the island, 77% is mountainous, 12% consists of rugged land and 11% is plain. Around 27% of the island is covered by maquis and 33% by burnet (Cengiz et al., 2009). Gökçeada has a transitional climate between Marmara and Mediterranean climates. The 32‐year mean rainfall is around 740 mm on Gökçeada. Goat Husbandry on Gökçeada Gökçeada had hosted a dense Greek population until the 1960s and it is told that the main sources of income on Gökçeada then were viniculture, olive and cheese production. It is known that cheese is produced with sheep and goat milk. Those producers who have reared Gökçeada goats on the mainland praise the milk yields of these animals. It is seen that until the 1970s, there had been a selection for milk yield in the goats concerned. The goats were released into the nature as the Greeks abandoned the Island. These goats have been moving freely at the hills of Gökçeada for about 40 years. In this way, a goat genotype that has adapted to the hard conditions and scarce sources of the Island but partially maintained its milk yield has been formed. There are some 13,452 head goats on the Island. The existing goat and sheep breeds have been protected from cross‐breeding on Gökçeada, which has had a transportation problem with the mainland so far. Moreover, with a regulation that entered into force in 1982, the entry of goats into the Island was prohibited and the regulation caused the goats to become further purified. However, entry of animals into the Island has started in the recent years and the Gökçeada goat has begun to be threatened by cross‐breeding, as around the world. 88% of the animal producers on the Island are sheep producers and the rate of goat husbandry among all branches of animal husbandry is 30% (Aktürk et al., 2005). Goats stay outdoors in an unconfined state throughout the year on Gökçeada, the western end of Turkey. In the system applied, no roughage or concentrate feeding is performed at all, the animals stay in the places they themselves determine throughout the year instead of a shelter, and no protective health application is carried out at all. In this system, producers intervene An Important Genotype For The Turkish Agro‐Biodiversity: Gökçeada Goat 269 only once a year for marking and to obtain kids. Nevertheless, some producers call some of their herds to the “house” by feeding and they obtain milk. Gökçeada Goat Morphological traits of Gökçeada goat Gökçeada goats are generally black. They have yellow or red blazes on both sides of their heads including their eyes. The parts under the tarsal joint of the legs are of the same color with their blazes. Besides, sky blue, brown and multi‐colored animals are also encountered in the order of frequency. The hairs covering the body are generally long and the ears are relatively short and upright; however, a slight break as of one‐third portion of the ear can be seen in some animals. As required by their “natural lives”, both males and females are generally horned, though hornless individuals are also encountered. Even though the udder connection is not very good, not much drooping is observed. While the udder color varies by body color, it is generally black (Figure 1). Figure 1. Gökçeada goat Traits of body measurement and live weight It is seen that the Gökçeada goats have similar values in terms of body measurements with some goat breeds produced in Anatolia (Table 1). This trait of kids, which had been born with a small size at birth, continued at weaning as well. When the body measurements are generally evaluated, it might be stated that the Gökçeada goat resembles Hair, Kilis and Norduz goats (Soysal et al., 2003; Simşek and Bayraktar, 2006; Anonymous, 2008a) and has a smaller body size than that of Damascus and Maltese goats (Keskin and Gül, 2006; Tölü, 2009). The live weight averages of Gökçeada goats ranged from 33.8 kg to 38.6 kg depending on caring and feeding (Tölü, 2009). When it is considered that Gökçeada goats live by themselves under “wild conditions” and when the relatively limited conditions on Gökçeada are taken into account, it might be considered natural that they are smaller than those of the same species on the mainland. Likewise, Herre and Röhrs (1973) express that live weight ranges from 30 to 40 kg in the feral goats on the Galapagos Islands. The live weights of Gökçeada goats resemble those of Angora goats (Vatansever and Akcapinar, 2006), while they are lower than those of Hair, Honamli, Norduz and Damascus goats (Bhattacharya, 1980; Keskin and Gül, 2006; Özder, 2006; Vatansever and Akcapinar, 2006; Anonymous, 2008a; Anonymous, 2008b). th 270 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1. Mean ( x ), standard deviation (SD), minimum and maximum values regarding some body measurements of Gökçeada goats (Tölü, 2009) Birth (0‐3 days) Traits (cm) SD Min x Body length 27.3 1.4 25.0 Height of withers 29.2 1.8 26.0 Heart girth 30.6 2.2 27.0 Heart depth 11.6 0.8 10.0 Rump height 28.7 1.8 25.0 Rump depth 9.6 0.8 8.0 Rump width 3.4 0.3 3.0 Weaning (60 days) Body length 42.8 4.1 29.0 Height of withers 43.8 3.1 38.0 Heart girth 45.5 3.1 40.0 Heart depth 18.1 1.4 23.0 Rump height 43.4 3.2 37.0 Rump depth 16.3 1.6 14.0 Rump width 5.3 0.5 4.2 Ear length 10.6 1.3 6.8 Ear width 4.9 0.4 4.0 Female yearling (14 months) Body length 63.5 3.7 55.0 Height of withers 61.6 3.9 53.0 Heart girth 65.3 3.6 59.0 Heart depth 26.1 1.5 24.0 Rump height 59.7 3.1 53.0 Rump depth 23.7 1.6 22.0 Rump width 8.4 0.6 7.2 Ear length 15.0 1.3 12.0 Ear width 6.3 0.5 5.5 Goat (2‐6 years) Body length 71.7 3.1 65.0 Height of withers 66.3 3.0 61.0 Heart girth 78.1 3.9 67.0 Heart depth 31.9 2.2 26.0 Rump height 64.9 2.4 61.0 Rump depth 28.6 2.5 24.0 Rump width 10.7 0.8 8.5 Ear length 15.6 1.1 12.5 Ear width 7.0 0.4 6.0 Table 2. Mean ( x ) and standard deviation (SD) values regarding the live weights of Gökçeada goats according to ages (Tölü, 2009) SD Age (year) x 1 24.59 3.65 2 35.31 2.49 3 36.24 5.25 4 38.26 4.29 5 40.31 4.92 6 42.87 4.82 Max 31.0 34.0 36.0 13.0 33.0 11.0 4.7 49.0 50.0 50.0 26.0 50.0 22.0 6.2 13.4 5.8 69.0 69.0 70.0 29.0 63.0 26.0 9.6 16.5 7.0 79.0 73.0 83.0 36.0 70.0 34.0 12.2 17.5 8.5 An Important Genotype For The Turkish Agro‐Biodiversity: Gökçeada Goat 271 Traits of reproduction and growth In the Gökçeada genotype produced at the Goat Husbandry Unit at Çanakkale Onsekiz Mart University, the number of kids per kidding goat was recorded as 1.6 in 2007 and 1.8 in 2008 (Tölü, 2009). The offspring yield of the genotype, which was brought as pregnant from Gökçeada, increased with the feeding environment that improved in the second year. The offspring yield of the genotype was higher than that of Hair, Angora and Kilis goats (Şimşek et al., 2006; Güney et al., 1995; Soysal et al., 2003), whereas it was lower than that of Damascus and Maltese goats (Keskin and Gül, 2006; Tölü and Savaş, 2010). It was seen that although varying by sex and birth type, the kid birth weights regarding the 1‐ to 6‐year‐old goats in the Gökçeada genotype ranged from 1.72 to 3.75 kg and that the average of the two years was 2.55 kg (Tölü, 2009). The kids of Gökçeada goats, which reached 5.67 to 11.84 kg at 60 days of weaning age on average, displayed a 106‐119 g daily increase in live weight in this period. The same values were far higher in Maltese and Turkish Saanen goat genotypes (Tölü, 2009). The birth weights reported in the Saanen x Hair cross‐breed and pure Hair goat kids ranged from 2.95 to 3.70 kg and from 2.63 to 2.77 kg, respectively (Şengonca et al., 2003; Şimşek and Bayraktar, 2006). The birth weight was reported as 3.1 kg for the Norduz kids (Kırk et al., 2004) and 2.76‐2.84 kg for the Angora goat kids (Vatansever and Akçapinar, 2006). The mean birth weights of the American Alpine, French Alpine, Nubian, Saanen and Toggenburg goat genotypes were reported as 3.4 kg, 3.4 kg, 3.3 kg, 3.6 kg and 3.9 kg, respectively (Amoah et al., 1996). As it will be seen, the kids of Gökçeada goats had a lower birth weight than other goat genotypes. It was observed that in the Gökçeada genotype, the live weight average of yearlings in the breeding period was 19.6 kg and that this average corresponded to 48% of the live weight of goats in the breeding period (Tölü, 2009). The similar trait was reported as 55% in the dairy type of goats (Morand‐Fehr et al., 2002; Tölü et al., 2009) and 43% in Maltese goats (Tölü and Savaş, 2010). Milk Traits In the two‐year process of the project, the mean lactation length and lactation milk yield in the Gökçeada genotype were determined as 251 to 259 days and 227 to 245 kg, respectively and the maximum 591 kg of milk yield was striking (Tölü, 2009). While the mean lactation length was 150 to 162 days in Hair goats (Sönmez, 1974; Şengonca et al., 2003; Şimsek et al., 2006), it ranged from 201 to 257 days in some of our other native goats (Şengonca et al., 2002; Şengonca et al., 2003; Güler et al., 2007). The lactation milk yield was between 70 and 160 kg in Hair goats (Sönmez, 1974; Bhattacharya, 1980; Şengonca et al., 2003; Şimsek et al., 2006). The lactation milk yield was reported as 226 to 350 kg in Maltese goats (Sönmez et al., 1971; Blundell, 1995; Carnicella et al., 2008; Tölü et al., 2010), 75 kg in Angora goats (Yertürk and Odabaşıoğlu, 2007), 200 to 300 kg in Kilis goats (Güney et al., 1995; Soysal et al., 2003), 330 to 350 kg in Damascus goats (Keskin et al., 2004; Güler et al., 2007), 135 to 216 kg in Honamli goats (Anonymous, 2008b) and 66 to 222 kg in Norduz goats (Anonymous, 2008a). Gökçeada goats have a higher milk yield than the Hair goats that are widely produced in our country. Therefore, an opportunity should be sought to benefit from the genotype, which stands out with its contentment as well, at higher rates in our goat production (Tölü, 2009). In Gökçeada goats, the mean milk fat, milk protein and milk dry matter for the two years were determined as 4.92‐5.75%, 3.29% and 13.7‐14.7%, respectively (Tölü, 2009). The rates of milk fat and milk protein were reported as 5.5% and 4.8% for Hair goats, respectively (Bhattacharya, 1980) and the rate of milk fat was reported as 5 to 5.5% in Hair goats and 4.7% in Kilis goats (Soysal et al., 2003). In Damascus goats, the rates of milk fat and milk protein are 4.3% and 3.5%, respectively (Keskin et al., 2004). In Maltese goats, milk fat ranges from 3.5 to 3.8% and milk protein from 3.3 to 3.4% (Blundell, 1995; Carnicella et al., 2008). th 272 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Traits of product quality Meat traits When all carcass and meat quality traits of Gökçeada kids sent for slaughtering as “dairy kids” at a live weight of around 10 kg were evaluated as a whole, it was determined that small amounts of consumable products were obtained, that their carcass structure was small but nonfat and that they had soft meat with a light color and a slight smell. Furthermore, it is expressed that their meat color is good and their meat quality is good with their soft and slightly fatty structure (Özcan et al., 2010; Ekiz et al., 2010). It might be stated that the carcass yield of Gökçeada kids is at the lower limits as compared to that of some of our native breeds (Koşum et al., 2003; Daşkıran et al., 2006; Koyuncu et al., 2007), but they have significant potential with slight fat covering and a light‐bright meat color (Özcan et al., 2010; Ekiz et al., 2010). Cheese traits 37.73% dry matter, 15.30% protein and 17.84% oil content were detected in the cheese made of Gökçeada goat milk under island conditions (Tölü et al., 2011). In their study, the researchers classified the cheese yield of the Gökçeada genotype as good. The sensory analyses made in the same project with unpublished results showed that the Gökçeada goat cheese was liked at a higher rate by the panelists. On the other hand, an 18.97% protein rate on average was recorded in the goat cheese produced with the traditional method under Gökçeada conditions (Yaşar et al., 2011). It is expressed that goat cheese is considerably demanded and liked by local people and domestic tourists on Gökçeada. More information should be produced with studies to be carried out on Gökçeada goat milk and products. Animal health It was seen that problems in the sense of adaptation of the genotype, which had long adapted to island conditions, to the semi‐intensive system on the mainland might be encountered particularly in kid growing (Tölü, 2009). The health practice per animal performed on the genotype and the observations as regards goat kid diarrhea and Ecthyma (Ecthyma contagiosum) disease revealed that with some of its traits, the genotype resembled the Turkish Saanen goat genotype, an intensive breeding genotype (Tölü, 2009). Thus, it is necessary to carefully approach the production of the genotype on the mainland. In addition, it is necessary to produce more information about the health characteristics of the genotype with comparative studies to be carried out under island and mainland conditions. Conclusion The body measurements of Gökçeada goats are close to those of our other native breeds. However, their live weights are lower. When Gökçeada goats are compared with many of our native goat breeds on the mainland, it is understood that they have significant potential for milk and kid yields and that they might become far more productive provided that their production conditions are improved. Nevertheless, one should particularly pay attention to the organization of the kid growing stage in their adaptation to different production conditions. It might be stated that Gökçeada goats are a value that should also be utilized in terms of goat kid meat and goat cheese. New approaches are needed about the animal products on Gökçeada in the sense of “special products” that have been dwelled upon in goat production around the world in the recent years. Some traits of the genotype, which successfully maintains itself under the hard conditions of Gökçeada, constitute the reason for its preservation as a genetic resource. However, more research on the genotype is required. An Important Genotype For The Turkish Agro‐Biodiversity: Gökçeada Goat 273 References Aktürk, D., Savran, F., Hakyemez, H., Daş, G. and Savaş, T. (2005) Gökçeada’da ekstansif koşullarda hayvancılık yapan işletmelerin sosyo‐ekonomik açıdan incelenmesi. Tarım Bilimleri Dergisi 11 (3): 229‐235. Amoah, E.A., Gelaye, S., Guthrie, P. and Rexroad Jr C.E. (1996) Breeding Season and Aspects of Reproduction of Female Goats. Journal of Animal Science 74: 723‐728. Anonymous (2008a) Norduz Keçisi. http://www.tagem.gov.tr/hgk/milli_irk_tescil_listesi_taslagi_keci_norduzkecisi.htm.(05.06.2011). Anonymous (2008b) Honamlı Keçisi. http://marmarahae.gov.tr/irklar/honamli.pdf (05.06.2011) Anonymous (2007) Türkiye İstatistik Kurumu (TUİK) www.tuik.gov.tr (20.11.2007). Basedow, M. (1998) Die genetische Diversität deutscher Rinderrassen dargestellt durch molekulargenetische Markersysteme. Schriftenreihe des Instituts für Tierzucht und Tierhaltung der Christian‐Albrechts‐ Universität zu Kiel. Bertaglia, M., Stephane, J., Roosen, J. and Consortium, E. (2007) Identifying European marginal areas in the context of local sheep and goat breeds conservation: A geographic information system approach. Agricultural Systems 94, 657‐670. Bhattacharya, A.N. (1980) Research on goat nutrition and managment in mediterranean middle east and edjacent Arab countries. Journal of Dairy Science 63: 1681‐1700. Blundel,l R. (1995) Reintroduction of the local breeds of sheep and goats in Malta. Gabina D. (ed.) In: “Strategies for Sheep and Goat Breeding: CIHEAM‐IAMZ, (231p). Meeting of the Joint FAO/ CIHEAM Network on Sheep and Goats, 26‐28 March, Sidi‐Thabet, TUNISIA. Boyazoglu, J. and Morand‐Fehr, P. (2001) Mediterranean dairy sheep and goat products and their quality A critical review. Small Ruminant Research 40: 1‐11. Carnicella, D., Dario, M., Ayres, M.C.C., Laudadio, V. and Dario C. (2008) The effect of diet, parity, year and number of kids on milk yield and milk composition in Maltese goat. Small Ruminant Research 77: 71‐74. Cengiz, T., Özcan, H., Baytekin, H., Altınoluk, Ü., Kelkit, A., Akbulak, C., Özkök, F. and Kaptan Ayhan, Ç. (2009) Gökçeada Arazi Kullanım Planlaması. TÜBİTAK 107Y337 nolu proje sonuç raporu. Daş, G., Hakyemez, B.H. and Savaş T. (2002) Gökçeada’da “Yabani Koşullarda” koyun ve keçi Yetiştiriciliği. Ekin Dergisi 22: 66‐70. Daşkıran, I., Kor, A. and Bingöl, M. (2006) Slaughter and carcass characteristics of Norduz male kids raised in either intensive and pasture conditions. Pakistan Journal of Nutrition 5 (3): 274‐277. Ekiz, B., Özcan, M.,Yilmaz, A.,Tölü, C. and Savaş, T. (2010) Carcass measurements and meat quality characteristics of dairy suckling kids compared to an indigenous genotype. Meat Science 85: 245‐249. Ertuğrul, M., Dellal, G., Elmacı, C., Akın, O., Karaca, O., Altın, T. and Cemal, İ. (2005) Hayvansal gen kaynaklarının koruma ve kullanımı. Türkiye Ziraat Mühendisliği VI. Teknik Kongresi, 3‐7 Mart 2005, Ankara. FAO, 2009. www.fao.org (05.06.2011). Güler, Z., Keskin, M., Masatçıoğlu, T., Gül, S. and Biçer, O. (2007) Effects of breed and lactation period on some characteristics and free fatty acid composition of raw milk from Damascus goats and German Fawn x Hair goat B1 crossbreds. Turkish Journal of Veterinary and Animal Sciences 31: 347‐354. Güney, O., Cebeci, Z., Torun, O., Biçer, O. (1995) Country report of Turkey on small ruminant production with special reference to the selection programme for increasing milk production in dairy goat flock of University of Çukurova.” Gabina D. (ed.) In: “Strategies for sheep and goat breeding: CIHEAM‐IAMZ, 1995. (231p). Meeting of goint FAO/CIHEAM Metwork on Sheep and Goats, 26‐28.03.1995. Sidi‐Thabet, TUNISIA. Herre, W. and Röhrs, M. (1971) Haustiere‐zoologisch gesehen. Gustav Fischer Verlag ss. 240. Keskin, M., Avşar, Y.K. Biçer, O. and Güler, M.B. (2004) Comparative study on the milk yield and milk composition of two different goat genotypes under the climate of the eastern Mediterranean. Turkish Journal of Veterinary and Animal Sciences 28: 531‐536. Keskin, M. and Gül, S. (2006) Hatay ili keçi yetiştiriciliğinde Şam keçisi ve Türkiye için önemi. Hasad Hayvancılık 255: 46‐49. Kırk, K., Aşın, Y. and Cengiz F. (2004). Norduz keçilerinin yapay tohumlama ile döl verim karakteristiklerinin belirlenmesi. IV. Ulusal Zootekni Kongresi, 1‐3 Eylül, Isparta. Koşum, N., Alçiçek, A., Taşkın, T. and Önenç, A. (2003) Fattening performance and carcass characteristics of Saanen and Bornova male kids under an intensive management system. Czech Journal Animal Science 48 (9): 379‐386. th 274 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Koyuncu, M., Duru, S., Kara Uzun, Ş., Öziş, Ş. and Tuncel, E. (2007) Effect of castration on growth and carcass traits in Hair goat kids under a semi‐intensive system in the South Marmara region of Turkey. Small Ruminant Research 72: 38‐44. Morand‐Fehr, P., Richard, A., Tessier, J. and Hervieu, J. (2002) Effects of decoquinate on the growth and milk performance of young female goats. Small Ruminant Research 45(2):109‐114. Özcan, M., Yılmaz, A., Ekiz, B., Tölü, C. and Savaş, T. (2010) Slaughter and carcass characteristics of Gökçeada, Maltese and Turkish Saanen suckling kids. Archiv Tierzucht 53: 318‐327. Özder, M. (2006) Keçi Irkları, Keçi Yetiştiriciliği. ed: Kaymakçı M., İzmir İli Damızlık Koyun‐Keçi Yetiştiricileri Birliği Yayınları No: 2, Bornova, İzmir. s: 29‐63. Rege, J.E.O. (1999) The state of African Cattle Genetic Resources: I. Classification Framework and Identification of Threatened and Extinct Breeds. Animal Genetic Resources Inf. 25: 1. Ruanne, J. (2000) A Framework for Prioritizing Domestic Animal Breeds for Conservation Purposes at the National Level. Conservation Biology 14: 1385‐1393. Savaş, T. (1995) Yerli ırk hayvanlarımızın korunması konusunda bir tartışma. Animal Enformasyon 10 (11). Serradilla, J.M. (2001) Use of high yielding goat breeds for milk production. Livestock Production Science 71: 59‐73. Soysal, M.İ., Özkan, E., Gürcan, E.K. (2003) The status of native farm animal genetic diversity in Türkiye and in the world. Trakia Journal of Sciences 1 (3): 1‐12. Sönmez, R. (1974) Melezleme yolu ile yerli keçilerin süt keçisine çevrilme olanakları. Ege Ü.Z.F.Yayınları No: 226, E.Ü. Matbaası, Bornova, İzmir. Sönmez, R., Şengonca, M., Alpbaz, A.G. (1971) Ege Üniversitesi Ziraat Fakültesinde yetiştirilen Malta keçilerinin çeşitli özellikleri ve verimleri üzerinde bir araştırma. Ege Üniversitesi Ziraat Fakültesi Dergisi 8: 57‐71. Sönmez, R. (1974) Melezleme yolu ile yerli keçilerin süt keçisine çevrilme olanakları. Ege Üniversitesi Ziraat Fakültesi Yayınları No: 226, Ege Üniversitesi Matbaası, Bornova. Şengonca, M., Kaymakçı, M., Koşum, N., Taşkın, T. and Steinbach, J. (2002) Batı Anadolu için bir Süt Keçisi:“Bornova Keçisi”. Hayvansal Üretim 43: 79‐85. Şengonca, M., Taşkın, T., Koşum, N. (2003) Saanen x Kıl keçi melezlerinin ve saf kıl keçilerinin kimi verim özelliklerinin belirlenmesi üzerine eş zamanlı bir araştırma. Turkish Journal of Veterinary and Animal Sciences 27: 1319‐1325. Şimşek, Ü.G. and Bayraktar, M. (2006) Kıl keçisi ve Saanen X Kıl keçisi (F1) melezlerine ait büyüme ve yaşama gücü özelliklerinin araştırılması. F.Ü. Sağlık Bilimleri Dergisi 20: 229‐238. Şimşek, Ü.G., Bayraktar, M., Gürses, M. (2006) Çiftlik koşullarında kıl keçilerine ait bazı verim özelliklerinin araştırılması. F.Ü. Sağlık Bilimleri Dergisi 20: 221‐227. Tölü, C., Yurtman, İ.Y., Savaş, T. (2009) Türk Saanen keçilerinde canlı ağırlık ve değişimi üzerinde değerlendirmeler. Hayvansal üretim, 50(1): 9‐17. Tölü, C., Yurtman, İ.Y. and Savaş, T. (2010) Gökçeada, Malta ve Türk Saanen keçi genotiplerinin süt verim özellikleri bakımından karşılaştırılması. Hayvansal Üretim, 51(1): 8‐15. TÖLÜ, C., SAVAŞ, T., 2010. Gökçeada, Malta Ve Türk Saanen Keçi Genotiplerinin Döl Verim Özellikleri Bakımından Karşılaştırılması. T.Z.F. Derg., 2010‐7 (2): 113‐121. Tölü, C. (2009) Farklı keçi genotiplerinde davranış, sağlık ve performans özellikleri üzerine araştırmalar. Çanakkale Onsekiz Mart Üniversitesi, Fen bilimleri Enstitüsü, Zootekni A.B.D., Çanakkale. Uysal‐Pala, Ç., Karagül‐Yüceer, Y., Pala, A. and Savaş, T. (2006) Sensory evaluation of drinkable yogurt made from different goat breeds. Journal of Sensory Studies 21: 520‐533. Vatansever, H. and Akçapınar, H. 2006. Lalahan Hayvancılık Merkez Araştırma Enstitüsü’nde yetiştirilen farklı kökenli Ankara keçilerinde büyüme, döl verimi ve tiftik özellikleri. Lalahan Hayvancılık Araştırma Enstitüsü Dergisi 46 (2): 1‐11. Yalçın, B.C.(1990) Keçi Yetiştiriciliği, Koyun‐Keçi Hastalıkları ve Yetiştiriciliği.” ed: Aytuğ, C. N., TÜM VET Hayvancılık Hizmetleri Yayını No:2, İstanbul s: 453‐458. Yaşar, K., Tölü, C., Şahingil, D. and Hayaloğlu, A.A. (2011) Proteolysis level and volatile aroma compounds in Gökçeada goat milk cheese. IDF International Symposium on Sheep, Goat and other non‐Cow Milk, 16‐ 18 May, Athens, Greece. Yertürk, M., and Odabaşıoğlu, F. (2007) Doğu ve Güneydoğu Anadolu bölgesinde yetiştirilen renkli Tiftik keçilerinin yarı entansif şartlarda verim özelliklerinin araştırılması. Y.Y.Ü. Veteriner Fakültesi Dergisi 18 (2): 45‐50. THE CURRENT STATUS, CONSERVATION PROGRAMME AND SUSTAINABLE UTILIZATION OF TURKISH GREY CATTLE Deniz SOYSAL Bandırma Marmara Animal Research Institute. Balıkesir / Turkey. soysal_deniz@hotmail.com Summary Turkish Grey Cattle is typical steppe cattle. Bos primigenius primigenius which has a long forehead and long horns is known as the wild ancestor of all grey cattles. There are many relatives of Turkish Grey in different European countries especially in Balkan region (Hungarian Grey, Ukrainian Grey, Podollian). Due to excessive exporting of exotic breeds and unconsciously crossbreeding, there had been very dramatic decrease at the number of Turkish Grey Cattle population at the last 50 decades. Nowadays the population has less than 50.000 members, whereas, official statistics shows that over one million Turkish Grey Cattle were living in 1960’s. After academic and official societies became aware of this situation, they decided to put scientific conservation programmes into practice. General Directorate of Agricultural Research and Policy (GDAR) is the pioneer council of conservation programmes in Turkey. Ex‐situ invivo conservation studies of Turkish Grey began in Bandırma Marmara Animal Research Institute which is a unit of GDAR, in 1995. After ten years in 2005, a flock with pure Turkish Grey Cattles in Çandır Village (Enez/Edirne) was determined as in‐situ conservation location. At the same year the cryo‐conservation studies began with TÜRKHAYGEN‐1 project. This Project aimed to save froozen genetic materials like sperma, ovum, tissue and blood in the Gene Banks. Turkish Grey Cattle is the first cattle breed in the world which was cloned from freezed and cryopreserved cells. Although ex‐situ and in‐situ conservation programmes are able to prevent breeds from totally extinct, unfortunately these efforts couldn’t stop the decrease in population. In order to overcome this reducement we have to find solutions to increase breeders income. Keywords: Turkish Grey Cattle, conservation, sustainable utilization Introduction Subsequently, thousands of years of natural and human selection, genetic drift, inbreeding and cross‐breeding have contributed to AnGR (Animal Genetic Resources) diversity and have allowed livestock keeping to be practised in a variety of environments and production systems. AnGR diversity is vital to all production systems. It provides the raw material for breed improvement, and for adaptation to changing circumstances. As revealed by recent molecular studies, the diversity found in today’s indigenous livestock populations and breeds greatly exceeds that found in their commercial counterparts. Unravelling the origin and distribution of livestock diversity is central to its current utilization, and to its long‐term conservation (Hanotte et al., 2006) Turkish Grey Cattle which is also known as Grey Steppe or Plevne was widely distributed in Marmara and Aegean Regions of Turkey in the past. The breed had emerged as a highly populated breed for that dominated stocks in Balkan, Marmara Region of Turkey during the Ottoman Empire period and beginning of the Turkish Republic period of the location mentioned. Grey steppe originated in steppe of Ukraine from where it moved to west and south immigrated into Italy, Hungary, Balkan Countries and Turkey in ancient times. Iskar Grey (Bulgaria), Istrian (Croatia), Dalmatian Grey (Croatia), Slovenian Podolian (Croatia), Katerin (Greece), Sykia (Greece), Hungarian Grey (Hungary), Cinisara (Italy), Maremana (Italy), th 276 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Podolicia (Italy), Romanian steppe (Romania), Ukrainian Grey (Ukraine) and Turkish Grey are consisting the group of similar breeds. (EAAP‐AGDB resources) Description of the Breed: Purpose of Raising : Meat and milk Colour : Hair colour changes from light grey to dark grey. Males have a dark ring around eyes and a white ring around of mouth and nose. Bulls are darker than cows. Necks, chests, lower shoulders and legs are darker than the other parts of the body. The skin colour is dark grey and nails are black. Lowest parts of horns are yellowish and ends are black. The black colour of anus is an evidence of breed’s purity. After birth the light brown colour of calves changes gradually to grey. Horn : Circular cross‐section, nodeless. Height at Withers : Males 126 cm, females 118 cm. Body Length : Males 123 cm, females 138 cm. Milk Yield per Lak. : 1000 – 1100 kg. Lactation Period : 220 day. Milk Fat (%) : 4%. Daily Weight Gain : Young Bulls (15 – 24 months): 900 g. Heifers (15 – 24 months): 700 g. Birth Weight : Males 22 kg, females 20 kg. First Mating Age : 30 – 36 months. Mature Live Weight : Males 470 kg, females 375 kg. Specific Features: Turkish Grey Cattle have superior digestive systems and they are strong for sudden food changes. They can consume less quality feed supplies. They are highly adaptive to sudden climate changes, poor feeding conditions, diseases and parasites. Recovery time is very short if they are sick. They have an aggressive nature and instincts to defence of calves and the herd. All members of herd will take a circular position if they feel danger. Maternal insight and grazing ability is very well. Due to its very ill tempered and nervous nature managing and handling is very difficult. Breeding Conditions: The natural living areas of this breed are rough, woody and mountainous lands. They have ability to living and they can be nourished and reproduce without human help. Generally cows are grazed on one common pasture or rice stubble area. Male Grey cattle are generally sold at 2‐2.5 years of age for meat production. Females are used for replacement. Older females over 10 years age are also sold for meat production. Due to their older age and excessive movements female meats get darker than the other meats. This makes consumers reluctant to buy that kind of meats. Conservation Programmes Conservation of animal genetic resources is important; because, there might be a need of recovering the lost/decreased genetic variation and they might be possessing special genes or important genetic information. Conservation strategies must be planned (i) not to lose the genes or gene combinations that might be of use, (ii) to make use of the advantages of heterosis, (iii) to use the present resources as the insurance of the future, (iv) to preserve the cultural products, and (v) to use the present material in diverse research fields. In fact, animal genetic resources have been being conserved upon national conservation projects in economically developed countries (Hiemstra and The Current Status, Conservation Programme and Sustainable Utilization of Turkish Grey Cattle 277 FAO, 2003). Conservation of animal genetic resources includes in‐situ and ex‐situ programmes (Ertuğrul M, 2005; İhsan S., 2004; Hiemstra and FAO, 2003). Turkey, which has a great number of endemic species, has an important share in the genetic resources of the earth. Therefore, Turkey must conserve its biodiversity and make use of it where necessary, which is accepted as the indicative of economic and genetic richness, and is proved to be useful in medicine, agriculture and industry. In addition, biologic diversity is connected with populations’ ecologic, cultural and spiritual richness and with its past. However, the increase in the population size as well as the economic pressure speeds up the changes in traditional farming techniques and causes the decrease in biodiversity. (Arat 2005) After academic and official societies became aware of this dangerous situation, they decided to put scientific conservation programs into practice. General Directorate of Agricultural Research and Policy (GDAR) is the pioneer council of conservation programmes in Turkey. Ex‐situ in‐vivo conservation studies of Turkish Grey began in Bandırma Marmara Animal Research Institute which is a unit of GDAR, in 1995. In this institute there has been constituted a pure breed flock with 150 Grey cattle members for 16 years. Some investigations were carried out on this flock. Several studies are still ongoing. In 2005 a conservation scheme was introduced and a production system for this rare but genetically valuable breed was discussed. After a public awareness campaign aiming to boost the concept of animal genetic resource conservation, a flock with pure Turkish Grey Cattles in Çandır Village (Enez/Edirne) was determined as in‐situ conservation location. The Government decided to give an extra 400 TRY subsidy per year/per animal for a total of 100 head of Grey cattle in the area within the framework of in situ conservation projects. This amount will be paid for a total of 600 head of Grey cattle in five different locations between the years 2011 and 2015. The in situ conservation programme will continue in Çandır village (Edirne), Çamucu (Balıkesir), Dışkaya, Soğucak and Ömeraltı villages (Bursa) in new period. The current scientific conservation method is cryo‐conservation which means conserving the material (e.g. cryopreservation) taken from the animal like gamete, embryo, sperm, tissue or cell, and DNA in gene banks. This conservation method has become more effective with the new advances in the modern biology, more specifically, in molecular genetics and biotechnology (Matsas et al, 2004; Shivaji et al, 2003; Mariante et al, 2002). Cryopreservation technique makes possible the long term storage of high number of samples in small volume containers. Moreover, rapidly developing technology enables to apply cryopreservation techniques to different species like cattle, sheep, goat, swine and poultry. In the future, using the crypreserved sperm would only need the female individuals of the population in restoring the decreased genetic diversity in the population as well as the decreased population size. Moreover, cryopreserved embryo and sperm might enable us to bring back the individuals of a lost breed. Cryopreserving healthy germ cells and embryo may help to eradicate animal health problems that might emerge in the future, as well (Piltti et al, 2004; Stachecki et al, 2004; Bağış et al, 2004; Aller et al, 2002; Leibo and Songsasen 2002; Dobrinsky JR ) In Turkey, Cryo conservation program began with “In vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources – I (TURKHAYGEN‐I)” project in 2005. In the content of the Project embryo, sperms, tissue or cell, and DNA samples were collected from 25 male and 25 female Turkish Grey cattle and these materials were preserved in two different gene banks. In another scientific study which is called “Cloning of Anatolian Native Cattle Breeds Project” Turkish Grey has cloned. Turkish Grey Cattle is the first cattle breed in the world which was cloned from freezed and cryopreserved cells. The aim of Project is to provide a sustainable management system to prevent the extinction of breeds. The study was carried out under collaboration between TBITAK (Turkish Scientific and Technological Research Council) MRC Genetic Engineering and Biotechnology Institute and Istanbul and Uludağ University, Faculty of Veterinary Medicine. In this study, cloned embryos were produced in TUBITAK MRC, Genetic th 278 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Engineering and Biotechnology Institute, Animal Genetics and Reproduction Biology Laboratory by using tissue sample of an Anatolian Grey Bull located in The Faculty of Veterinary Medicine, Uludağ University, and for Ece, Ecem, Nilufer and Kiraz the tissue sample of female cattle located in Marmara Region. First, the cells were isolated from the tissue, they are cultured and then the proliferated cells were cryopreserved in the cellbank. In order to test the cell bank, some of the cells were used as DNA source in the "Cloning of Anatolian Native Cattle Breeds" project. For this reason, in vitro matured oocytes were enucleated and the nucleuses of somatic cells were transferred into enucleated mature oocytes by injection. After 7‐day culture, when clon embryos reached blastocyst stage, they were transferred to the farm of The Faculty of Veterinary Medicine, Istanbul University and Uludağ University in a portable incubator. Then, they were implanted into carrier mothers. In this respect, cloned Anatolian Grey embryos, which were sent to The Faculty of Veterinary Medicine, Istanbul University and Uludağ University, were eventually developed into a healthy fetus and the male calf, ‘Efe’ was born, then two female calves Ece & Ecem were born in Istanbul University, after a while two female calves Nilufer and Kiraz were born in Uludag University. In this project, more than 250 cloned embryos were produced, some of which were freezed and cryopreserved, some of which were transferred either to Istanbul University or to Uludag University for implanting into carrier mothers to be born. (http://www.turkhaygen.gov.tr/anadolu/index_en.asp#) Sustainable Utilization: Ex‐situ and in‐situ conservation programs are mostly able to prevent breeds from totally missing, but these couldn’t stop the decrease of population. To overcome with this problem we have to find solutions to increase breeders’ income otherwise extinction is unavoidable. First of all Native Breeders Associations should assemble for each breed. The government has to support these breeders and allow them to join Cattle Breeders Association of Turkey. Special features like meat quality, disease and climatic resistance should be bringing to light. Furthermore organic animal breeding can be a good way to solve this problem. The Turkish and European outlines for organic animal production recommend the use of local breeds. Local, native breeds were selected and bred and adapted to their specific environments as well as for social, cultural and economic situations (Nauta and Spengler Neff, 2011). A successful Project in Ayvacık (Çanakkale) has put in practice since 2009. The main subsistence of people living in Ayvacık district is farming. Especially livestock breeding is most common occupation. The Project has begun with 60 breeders in eight villages. Villages have wood covered areas with endemic plants and they are all in Kazdağları region. The main breed of this area is Turkish Grey cattle. The breeder made collaboration with Provincial Directorate of Agriculture and Ayvacık Municipality and assembled Ayvacık Organic Red Meat Producer Association. Cattle and pasturage are certificated by ICEA. After that they built a slaughterhouse where organic produced meat slaughtered and packed. Nowadays the association sells organic Turkish Grey meats at great market chains and organic markets. The breeders get 35% more income rather than commercial produced meats. In our country there are many appropriate and isolated areas for organic animal breeding. Uludağ and Mustafakemalpaşa Region (Bursa), Kozak Plateau (Bergama/İzmir), Yalova, Hisarlı Mountain and Çandır (Edirne) where the Turkish Grey Cattle’s living areas are most favourable districts for organic animal breeding. That kind of projects will resist Turkish Grey Cattle from extinction. The Current Status, Conservation Programme and Sustainable Utilization of Turkish Grey Cattle 279 REFERENCES Aller J.F., Rebuffi G.E., Cancino A.K., Alberio R.H. (2002). Successful transfer of vitrified Ilama (Lama glama) embryos. Anim Reprod Sci. Sep 16; 73 (12): 1217. Bagıs H. Sağırkaya H,, Odaman H,. Andras D. (2004). Vitrification of pronuclear stage mouse embryos on SSV versus in cryotube comparision of the effect of ecuilibration time and different sugers in the vitrification solution. Mol Reprod Dev ; 67:186192. Dobrinsky JR., (2002). Advancements in cryopreservation of domestic animal embryos. Theriogenology. Jan 1; 57 (1): 285302.. Ertuğrul M., Dellal G., Elmacı C., Akın A.O., Karaca O., Altın T. ve Cemal İ. (2005). Hayvansal Gen Kaynaklarının Koruma ve Kullanımı. TMMOB Ziraat Mühendisleri Odası, Türkiye Ziraat Mühendisliği VI. Teknik Kongresi, I. Cilt 275‐290. Kurar E, Arat S, Ertugrul O, Pabuccuoglu S, Sagirkaya H, Tasdemir U and Togan I., (2008). In vitro Conservation and Preliminary Molecular Characterization of Some Turkish Native Domestic Animal Genetic Resources‐ I (TURKHAYGEN‐I) ISAG 31st International Society of Animal Genetics – Hollanda Hanotte, O., Toll J., Iniguez L. & Rege, J.E.O. (2006). Farm animal genetic resources: why and what do we need to conserve. Proceeding of the IPGRI–ILRI– FAO–CIRAD workshop: Option for in situ and ex situ conservation of AnGR, 8–11 November 2005, Montpellier, France. Hiemstra S.J. (2003). Guidelines for the constitution of national cryopreservation programmes for farm animals (FAO). Mariante Ada S, Egito AA. (2002). Animal genetic resources in Brazil : result of five centuries of natural selection. Theriogenology. Jan 1; 57 (1): 22335. Matsas D, Huntress V, Levine H, Ayres S, Amini J, Duby R, Borden P, Saperstein G, Overstrom E. (2004). Preservation of heritage livestock breeds:integrated program to cryopreserve germplasm from Tennessee myotonic goats. Reprod Fertil Dev. 17(1,2).195. Nauta W.and Spengler Neff, A. (2011). An organic perspective on reproduction and breeding methods. A contribution to the LIB‐Symposium in Wageningen, 15th‐16th march 2011 Leibo SP, Songsasen N. (2002). Cryopreservation of gametes and embryos of nondomestic species. Theriogenology. Jan 1; 57 (1):30326. Piltti K, Lindeberg H, Aalto J and Korhonen H. (2004). Live cubs born after transfer of OPS vitrified warmed embryos in the farmed European polecat (Mustela putorius). Theriogenology. Apr 1; 61 (5): 81120. Stachecki J.J. and Cohen J. (2004). An overview of oocyte cryopreservation. Reprod Biomed Online. Aug; 9 (2): 15263 . Soysal I.. (2004). Türkiye Yerli Hayvan Genetik Kaynaklarımız., Tekirdağ Ziraat Fakültesi M.I. Soysal and S. Kök (2006). The last survivors of Grey cattle resisting extinction. A case study of characteristics and sustainability of traditional systems of native Grey cattle breeds Seminar of the Scientific‐Professional Network on Mediterranean Livestock Farming, 2, Zaragoza (Spain), 18‐20 May 2006 CIHEAM‐IAMZ ISBN 2‐85352‐374‐8.‐ p 55‐63 http://www.ayvacikorganiket.com http://www.eeap.org http://www.marmarahae.gov.tr http://www.tagem.gov.tr http://www.turkhaygen.gov.tr/anadolu/index_en.asp# SOME GENERAL PROPERTIES AND REGIONAL STATUS OF INDIGENOUS TUJ SHEEP AND ITS IMPORTANCE AS A GENE RESOURCE E. SEZGİN1*, S. KOPUZLU2, S. YÜKSEL1, A. SEZGİN3 1 East Anatolian Agricultural Research Institute‐Erzurum, Turkey 2 Atatürk UniversityNarman Vocational School‐Erzurum, Turkey 3 Erzurum Agricultural Directorate of Province Erzurum, Turkey * Corresponding author: skopuzlu@atauni.edu.tr Abstract Tuj Sheep is one of the indigenous gene sources, which is reared mainly in Kars, Igdir and Ardahan provinces including Northern Caucasus region. This indigenous sheep breed is also called “Kesik” by the local farmers. Recently, ıt has been at risk of extinction due to uncontrolled mating. Tuj sheep has a three‐piece‐tail which is long and fatty and has a S‐shaped curve at the bottom. Wool is bright white colored as mutton is tender and delicious in this sheep breed. It is smaller in body size comparing to the other sheep breeds in the same region. The wool is mixture of rough and fine fibers showing homogeneity in length. The diameter of the wool is 34.2 μ in average, having 46’S quality class. Body weight, wither height, chest depth and circumference, shin circumference were determined to be 35‐45 kg, 62.7 cm, 29.2 cm, 56.9 cm, 85.2 cm and 7.7 cm respectively for a Tuj yearling. Milk yield is low. Since it is at risk of extinction, it is of great importance to take this indigenous sheep breed under conservation in the context of genetic resources. Key Words: Tuj sheep, genetitic sorces, wool, meat, ÖZET Tuj koyunu Kars, Iğdır ve Ardahan illeri başta olmak üzere kuzey Kafkasya bölgesinde yetiştiriciliği yapılan ve yerli gen kaynağımız olan bir ırktır. Yöresel olarak “Kesik” adıyla da ifade edilen bu ırkın, son zamanlarda kontrolsüz melezlenmesi sonucu sayısının yok denecek kadar azaldığı görülmektedir. Tuj koyununda kuyruk üç parçalı, uzun ve yağlı kuyruklu olup kuyruğun alt kısımda bu ırka has olarak S şeklinde bir kıvrım oluşmuştur. Bu ırkta yapağı rengi beyaz parlak bir görünümde, etler gevrek ve lezzetlidir. Bölgede yetiştirilen diğer yerli koyun ırklarına nazaran daha küçüktür. Yapağısı kaba‐karışık tip yapağı vermekte, yapağıda incelik koyunlarda ortalama 34,2μ olup, incelik bakımından birörneklik göstermektedir. Yapağıda tesbit edilen kalite sınıfı 46’S dir. 12 aylık yaştaki bir hayvanda canlı ağırlık 35‐45 kg, cidago yüksekliği 62,7 cm, göğüs derinliği 29,2 cm, vücut uzunluğu 56,9 cm, göğüs çevresi 85,2 cm ve ön incik 7,7 cm dır. Süt verimi düşüktür. Önemli bir koyun ırkı olan Tuj koyunu yok olma tehlikesiyle karşı karşıya kaldığı için koruma altına alınması, yerli koyun gen kaynaklarını muhafazası bakımından büyük önem taşımaktadır. Anahtar Kelimeler: Tuj koyunu, Gen kaynağı, yapağı, et th 282 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) INTRODUCTION With its social, cultural and geographical structure, Anatolian peninsula has been home to various civilizations. It is also rich in various animal and plant species with a vast biodiversity and the center of attention of the world. Particularly, in terms of sheep breeds, with more diversity than the geographically close places such as Middle East, the Balkans, Eastern Europe and Western Asia, our country has an important place in the world. The growing world population brings about an increase in food consumption. At the same time, shrinking production areas and dwindling resources are an important harbinger of significant hazards in the future. The resulting global changes directly affect the feed resources and in return, the changes in feed resources effect the livestock production. Particularly, the production of meat and dairy products, which has a significant place in an adequate and balanced human nutrition, must reach a sufficient level and appropriate methods, and long‐term models should be applied for the production process. In addition to culture races, indigenous animal races hold an important place in meeting meat and dairy products need of the world. For this reason, it is of great importance that breeders should actively be supplied with indigenous gene resources and so should the production and consumption chain. Resistant to adverse environmental conditions, easy and economical to care and feed, disease resistant, the indigenous gene resources with low selectivity almost play a role of insurance for the future of humankind. For these reasons, breeding sheep and goats intensively in places with different geography and harsh climate conditions such as Eastern Anatolian Region is an important issue to particularly focus on. However, several reasons such as policies implemented for the day, urbanization, and breeder conditions failing to improve have brought about uncontrolled sales and decreases in the number of sheep and goats as well as cattle. This uncontrolled trend has brought substantial dangers together with it as well as a quantitative decrease in indigenous populations. The number of Tuj sheep has also decreased and Tuj sheep genotype is in danger of extinction. Taking Tuj sheep under protection will make a considerable contribution to the potential of indigenous sheep gene resources in Turkey. Therefore, this study aimed at discussing the regional status of indigenous Tuj sheep and its importance as a gene resource of the country. 1. The Origin of Tuj Sheep and its Expansion Areas Tuj is a sheep race raised in Kars and Ardahan provinces, particularly in Çıldır, in the North‐East Anatolian Region. It was brought to this region from Caucasus during Russian occupation of the region. Russians raised this race for its meat and spent efforts for its expansion during their stay in this region for half a century. In addition, they encouraged local people to breed and raise this animal by paying more for its wool. The purebred Tuj sheep originally has a small body mass; however, today the growth in its body mass stems from its hybridization with Morkoraman sheep due to the effect of economic and natural conditions over time (Yarkın and Eker, 1954; Kaymakçı and Sönmez, 1992). Tuj sheep is named as Kars sheep, Çıldır sheep, Kesik and Herik in Turkey, and Tushin and Tushinksi abroad (Özcan, 1989). The number of purebred samples of this race has almost dwindled to extinction. 2. The Properties of Tuj Sheep 2.1 Morphological Properties Tuj sheep has a small body mass. Its head is small, profile is smooth, and the forehead is covered with hair up to eye level. Rest of the head is hairless. The neck is covered with thin hairs. Its wool cover is up to wrists on front legs and continues up to rear legs (Yarkın and Eker, 1954; Karaoğlu, 1997). Its eyes are close to light brown. The ewes are hornless. The males are horned and Some General Properties And Regional Status Of Indigenous Tuj Sheep And Its Importance As A Gene Resource 283 horns are spiral shaped. Around the nose and mouth, feet, eyes and on the nails, it has black pigment structures (Özcan, 1990; Akçapınar, 2000). Dark color is desirable on Tarsus and Carpus joints. Sheep with black and brown color on shins are also seen in this race (Yarkın and Eker, 1954). It has drooping white ears. This race has a unique tail structure. The tail is short and the tail vertebrae bent upward in the middle, and the tip of the tail, which is lean and slim, is drooping down. The hairless side of the tail is seen from behind when it walks (Yarkın, 1953). Table 1. Some body measurements in Tuj sheep (cm) Rump height 60.1 Yarkın, 1959 Withers height 62.7 Ulusan and Aksoy, 1996 Back height 58.5 Yarkın, 1959 Chest depth 29.2 Yarkın and Eker, 1954 Chest circumference 85.2 Ulusan and Aksoy, 1996 Front rump width 18.6 Yarkın and Eker, 1954 Middle rump width 18.0 Yarkın, 1959 Last rump width 16.5 Yarkın and Eker, 1954 Body length 56.9 Yarkın, 1959 Front shin circumference 7.7 Ulusan and Aksoy, 1996 Chest depth between shoulder blades 18.0 Yarkın, 1959 Head length 24.8 Yarkın, 1959 Head width 11.0 Yarkın and Eker, 1954 Forehead length 9.3 Yarkın, 1959 Ear length 14.2 Yarkın, 1959 Ear width 7.7 Yarkın, 1959 2.2 Wool yield and properties The wool cover of Tuj sheep is fully bright white. It yields rough and mixed type wool about 2‐ 2.5 kg (Özcan, 1990). Average curl length is 10.9 cm, fiber length is 13.3 cm and fiber fineness is 34.2 µ. Sortiman is 46’S (D) and the resilience values after 1 minute and 5 minutes are 84.6 and 90.3 respectively (Karaoğlu et al., 1996). The number of folds is 17.3, and the efficiency is 59.4 (Kopuzlu and Emsen, 2005). 2.3 Milk yield and properties The studies on milk yield of Tuj sheep report that it can be milked during 90 and 137 day periods (Yarkın and Eker, 1954; Karaoğlu et al., 2001b). Birth weight in Tuj lambs is 4.54 kg and 4.16 kg in males and ewes respectively (Karaoğlu et al., 2001a). The live weight in adult sheep is 35‐45 kg (Tellioğlu, 1984), whereas it is 40‐45 kg in adult rams (Akçapınar, 2000). Karaoğlu et al. (2001b) report that the amount of milk obtained from sheep during lactation, fat content in milk during 1st, 2nd, 3rd and 4th lactation and dry matter are 42.4 kg, 47.2 kg, 47.8 kg, 53.3 kg, 6.9 % and 17.2 % respectively. 2.4 Reproduction and survival rates Studies report that the rate of pregnancy per ewe mated is 0.89, lambing rate is 0.89 and the number of lambs born is 1.0. The number of lambs weaned is 0.86, the number of lambs born per th 284 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) ewe lambing is 1.13, and the number of lambs weaned is 1.07 (Karaoğlu et al., 1996). The number of lambs per ewe is reported to be 1.08 according to a study (Baş et al., 1986) and it is 1.26 in another study (Emsen and Dayıoğlu, 1999). Survival rate in Tuj lambs with respect to weaning period is 80‐84 % in males and ewes respectively (Baş et al., 1986; Emsen and Dayıoğlu, 1999). Tuj Sheep Tuj Ram 2.5 Other properties Studies report that regarding the weaning period in Tuj lambs, age is 2.5 – 3 months, live weight is 16.4 kg in ewes and 17.5 in males (Karaoğlu et al., 2001a). Survival rate is 80‐84 % in males and ewes respectively (Baş et al., 1986; Emsen and Dayıoğlu, 1999). Average daily weight gains in Tuj lambs under intensive fattening period are 160 g and 203.5 g in males and ewes respectively (Macit et al., 1998; Macit et al., 2001). It is also reported that hot and cold carcass weight in Tuj sheep are minimum 15.1 kg and 14.6 kg (Macit et al., 2002) and maximum 26.0 and 25.4 kg (Geliyi et al., 1984). Macit et al. (1997) report in their studies on carcass yield in Tuj sheep that hot carcass yield is 49.5 % and cold carcass yield is 48.4 %. Invulnerable to environmental conditions, Tuj sheep are also resistant to diseases. Their meat is among the preferred meats as it is soft and delicious. Their wool is fine and long. Tail in Tuj sheep is reported to weigh between 4.3 and 5.14 kg (Geliyi et al., 1984). Tuj Sheep Tail Structure Tuj Sheep Wool Some General Properties And Regional Status Of Indigenous Tuj Sheep And Its Importance As A Gene Resource 285 CONCLUSION Tuj sheep is one of our important gene resources. Its purebred growing has dwindled to almost extinction. As an indigenous sheep race, it needs addressing in terms of its wool properties and quality, meat yield and quality, reproductive efficiency, resistance to environmental conditions and diseases. It is of great significance that purebred ones of Tuj sheep should be collected and reproduced in areas where they are raised. If this cannot be accomplished, Tuj sheep as a gene resource will face extinction. REFERENCES Akçapınar, H. (2000) Sheep Breeding. Medisan Publishing, Ankara p:115 Anonymous.(2009) TUIK. Small livestock statistics http://www.tuik.gov.tr/VeriBilgi.do?tb_id=46&ust_id=13 Baş S., Özsoy M.K. and Vanlı Y.1986) The effects of feeding in different flocks before mating period on reproduction rate in sheep, and growth and survival rates in lambs. Turkish Vet. and Hay. D.C. 10(3) p:221‐234. Eliçin A., Geliyi C., Ertuğrul M., Cengiz F., İlaslan M., and Aşkın Y. (1989) Fattening rate and Carcass characteristics of Tuj Lambs in pasture supported with different amounts of concentrate feed. Ankara University. Almanac of Agricultural Faculty 40(1‐2), p:336‐345 Emsen H. and Dayıoğlu H.(1999) Reproduction Rate Properties of İvesi and Tuj Sheep, and Growth and Development Properties of Purebred and Hybrid Lambs of These Races. International Livestock Congress’99, 21‐24 September. p:546‐551 Karaoğlu M., Kopuzlu S., Emsen H. and Aksoy A. (1996) Evaluation of Reproduction Rates and Wool Properties of Tuj Sheep Raised in Agricultural Faculty of Atatürk University. National Livestock Congress’96, 18‐20 September, İzmir p:211‐218 Karaoğlu M.(1997) The Performance of Tuj Sheep in Terms of Some Yield Properties Grown in Agricultural Enterprises of Atatürk University under Semi‐Intensive Conditions. Atatürk University. Natural Sciences Inst.The Department of Animal Sciences. Doctoral Thesis. Karaoğlu M., Macit M. and Emsen H.(2001a) An Investigation on Growth and Development Properties and Survival Rates in Tuj Lambs. Turkish J. Vet. Anim. Sci. 25,s:261‐266 Karaoğlu M., Macit M. and Aksoy A.(2001b) Milk Yield Properties in Tuj Sheep under Semi‐Intensive Conditions Turkish J. Vet. Anim. Sci. 25, s:249‐253. Kaymakçı M. and Sönmez, R. (1992) Lamb breeding. Hasad Publishing, Livestock Series:3 p:90‐91 Kopuzlu S. and Emsen H.(2004) Evaluation of Some Wool Properties in Tuj Sheep. 4th National Animal Sciences Congress, 1‐2 September, Isparta Volume 2 p:179‐185 Macit M., Karaoğlu M., Yaprak M. and Kopuzlu S.(1997) Fattening performance and slaughter and carcass properties in Tuj Lambs under intensive conditions. Atatürk University. The journal of agricultural faculty, 28(1), p:64‐73 Macit M., Esenbuğa N., Kopuzlu S., Karaoğlu M., Dayıoğlu H. and Yaprak M.(1998) A comparison of Tuj, Morkaraman, and Tuj X Morkaraman Hybrid Lambs supplied with additional concentrate feed in terms of fattening rate properties. Eastern Anatolian Agricultural Congress, 14‐18 September, Erzurum. p:379‐ 385 Macit M., Karaoğlu M., Esenbuğa N., Kopuzlu S. and Dayıoğlu H.(2001). Growth Performance of Purebreed Awassi, Morkaraman and Tushin Lambs and Their Crosses under Semi‐Intensive Management in Turkey. Small Ruminant Research 41, p:177‐180 Macit M., Esenbuğa N. and Karaoğlu M.(2002) Growth Performance and Carcass Characteristics of Awassi, Morkaraman and Tushin Lambs Grazed on Pasture and Supported with Concentrate. Small Ruminant Research. 44, p:241‐246. th 286 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Özcan L.(1989) Sheep and Wool Production. Çukurova University.Agricultural Faculty. Coursebook, No:106 Özcan L.(1990) Sheep breeding. Ministry of Agriculture and Rural Affairs No: 343 Serial:15 Ankara. p:100‐103 Tellioğlu S.(1984) Sheep breeding and wool production. Atatürk University. Agricultural Faculty. The Department of Animal Sciences.Coursebook, Erzurum p:34 Ulusan H.O.K. and Aksoy A.R.(1996) The yield performances of Tuj and Morkaraman sheep raised in Kafkas University, Veterinary Faculty Farm. 2. Growth and carcass sizes. Kafkas University Vet. Fac. Journal. 2(2), p:139‐146 Yarkın İ.(1953) Sheep breeding. Ankara University. Agricultural Faculty Publication. 37. Course book. 18 p:65‐67 Yarkın İ. and Eker M.(1954) Studies on Tuj Sheep Raised in Kars and its environs. A.U. Agricultural Faculty. 1954 Almanac, Printed separately from fascicle 4. SOME GENERAL FEATURES, REGIONAL STATUS AND IMPORTANCE OF KAÇKAR GOAT BREED AS A GENE RESOURCE E. SEZGİN1*, S. KOPUZLU2, S. YÜKSEL1, E.E. ERMİŞ3, Ayşe SEZGİN4 1 Eastern Anatolia Agricultural Research Institute, Yakutiye, Erzurum, Turkey 2 Atatürk University Narman Vocational Higher School‐Erzurum 3 The Provincial Directorate of Agriculture Artvin Turkey 4 Provincial Directorate of Agricultural Erzurum, Turkey * Corresponding author: esezgin25@hotmail.com Abstract Kaçkar Goat is mainly raised in Artvin, Rize, Trabzon and Giresun provinces in Eastern Black Sea Region. It is also called as crescent‐horned or hook‐horned goat. Kaçkar Goats are raised mainly in forest areas. The hairs on the back are originally black. Their horns have a crescent‐like shape. They have a medium body mass. They are considered to have a good level of milk and meat yield by the people in the region. We have been experiencing a very rapid decrease in the number of goats in Turkey in recent years. The number of Kaçkar Goats has also decreased significantly and genotype of this goat is in danger of extinction. Protecting the race of Kaçkar Goat will make significant contributions to the potential of local goat gene resources in Turkey. Key words: Kaçkar Goat, Gene Resources, Protection, meat and milk Özet Türkiye’de Kaçkar keçilerinin yetiştirilme alanları, esas olarak Doğu Karadeniz bölgesinde Artvin, Rize, Trabzon ve Giresun illerindir. Bunlara Hilal boynuzlu veya Çengel boynuzlu Keçiler isimleri de verilmektedir. Kaçkar keçileri esas olarak Ormanlık alanlarda yetiştirilmektedirler. Kaçkar keçilerinin üst kaba kılları esas olarak siyah renklidir. Boynuz yapısı hilal şeklindedir. Orta cüsseye sahiptirler. Bölge insanları tarafından süt ve et verimleri iyi düzeyde olduğunu kabul edilmektedir. Türkiye’de son yıllarda keçi sayılarında çok hızlı azalışlar yaşanmaktadır. Kaçkar keçilerinin sayılarında da hızlı bir azalış olup bu keçi genotipi yok olma tehlikesiyle karşı karşıya gelmiştir. Kaçkar keçilerinin koruma altına alınması Türkiye yerli keçi gen kaynakları potansiyeline çok önemli katkı sağlayacaktır. 1. Introduction Goat raising is a branch of production carried on using traditional methods in underdeveloped and developing countries. It is the main source of income for many low‐income families in mountainous regions and rugged land in our country where the land is unsuitable for crop production and other branches of agriculture production. Goat raising is also carried on in small and medium‐sized enterprises in our country with traditional methods. Another point that makes goat raising important in our country is that it has a significant place and depth in social and cultural texture. Goat raising in Turkey has been a business of production carried on traditionally for centuries and it has made significant contributions to the region’s economy and socio‐cultural structure. According to 2009 data, goat stock in Turkey is 5.13 million goats. 97.1% of the total stock includes Hair Goat and 2.9% Angora Goat. The share of goat production in Turkey’s total red meat, milk and leather production is 3%, 2% and 9% respectively. Though Hair goat breed is raised in all regions, th 288 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Angora goat is raised only in areas outside Western Marmara and Northeast and Middle East Anatolian Region. While Hair goat is mostly raised in Mediterranean, Southeast and Middle East Anatolian Region respectively, Angora goat is mainly raised in Western Anatolian Region (5). In addition to Hair and Angora breeds in goat population in Turkey, some local breeds such as Kilis, Honamlı and Norduz have also been raised. These genotypes have a considerable importance in their regions in terms of their genetic, economic and socio‐cultural aspects. In recent years, depending on many factors, a rapid decrease in the total number of goats has been observed. These breeds raised in very small numbers in their regions are affected negatively from this decrease. Thus, it has become mandatory to launch applications or projects to protect local goat genotypes to avoid extinction. For this purpose, studies aiming to protect these goat genotypes continue within the scope of “Domestic Animal Genetic Resources Conservation Project”, which was developed by the Ministry of Agriculture and Rural Affairs, General Directorate of Agricultural Researches and launched in 1995 (7). Apart from conserving the local goat gen resources for a sustainable goat production, universities and research institutes should develop new goat genotypes. In addition, extra studies are needed to r eveal other local goat gen resources which already exist but are not known sufficiently. Several local goat genotypes have been developed in different regions in Turkey for centuries. Some of these genotypes have disappeared due to influence of several factors; however, some still maintain their existence. During this process, the goat breeds have been classified but these classifications have not been sufficient. As a result, some of the local goat genotypes other than Angora goat have been mainly classified in Hair Goat breed. Therefore, it is necessary that the differences between goats of each region should be studied in detail with an emphasis on the morphological, serological and molecular level studies on the classification of local goat genotypes. The outcomes of these studies should be shared with scientists and researchers dealing with this field of study. From this point of view, by introducing the Georgian goat, this paper aimed at leading the studies intending to add a new breed to the local goat gen resources in Turkey. 2. The Origins of Kaçkar Goat and its Expansion Areas Kaçkar goat has its origins from regions around the Kaçkar Mountains, which expand over a quite long and wide area. It is called also as Kaçkar Goats in these regions. It is raised locally in small populations mainly in Artvin, Rize, Trabzon and Giresun provinces in the Black Sea Region in Turkey. A unique culture has emerged in regions where this breed is raised. Unlike Hair Goats, Kaçkar Goats are raised in more mountainous areas. They are also similar to the Abkhaz Goats in Borçka county of Artvin province. 3. The Features of Kaçkar Goat 3.1 Body features Kaçkar Goats have a medium body mass and a fairly smooth body structure. The outer fiber cover (upper coarse hair), ear and tail of this breed are short and this distinguishes them from Hair Goats. They have erect‐ear and the tips of the ears are turned up and side. Horns are an important distinguishing feature in females of this breed. Although there are no sufficient studies on features distinguishing Kaçkar and Hair Goats morphologically, the horns of male Kaçkar Goats have a long and crescent‐like structure reminding the Capra aegagrus type and they have a completely different shape than those of male Hair Goats. The horns are in rarely seen hook or sickle‐edge shape. Some General Properties And Regional Status Of Indigenous Tuj Sheep And Its Importance As A Gene Resource Picture 1. Male Kaçkar Goat (Sezgin E. 2010) 289 Picture 2. Kaçkar Goats (Sezgin E.2010) 3.2 Fiber cover and color The upper coarse hairs are generally black. However, there are some others with pied color. Upper coarse hairs are short and smooth. The head in Kaçkar Goats is covered with long, shiny and elastic coarse hairs. It has curl in the forehead. The curl is black and white, and brilliant. 3.3 Some Yield features We do not have enough studies determining the yield features of Kaçkar Goats. However, the producers state that Kaçkar Goats have a fairly good level of meat and milk yield. The mammary glands and teats have developed in female goats. Lactation period lasts up to 8 months in some growing regions and an average of 2 kilograms of milk a day per animal can be obtained. The highest milk yield period is between 8th and 12th weeks. The rate of twin birth in flocks is around 50%. Picture 1. Male Kaçkar Goat (Sezgin E. 2010) Picture 2. Kaçkar Goats (Sezgin E.2010) th 290 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Conclusion With its origins from regions around the Kaçkar Mountains, Kaçkar Goat is an important genotype. It has different features from other local goat breeds regarding local gene resources, morphological aspects and yield. It should be studied in more detail. A sustainable goat production in Turkey, and the development and survival of folk culture linked to this production depend on the protection and development of local goat gene resources to a great extent. For this reason, protection of locally raised Kaçkar Goats will make a significant contribution to the potential of local goat gene resources in Turkey REFERENCES 1. Batu, S.(1951). Goat Races in Turkey. Ankara University, Veterinary Faculty Publications: 4, Course book: 2, Ankara. 2. Soysal, M.İ. and Soysal, S.İ.(2009) The Production of Genetic Resources of Domestic Farm Animals: Goat. Tekirdağ. 3. Torunoğlu Tohumculuk. Important Goat Races in The World. www.torunoglutohum.com. 4. Şengonca, M. and Nedim, K.(2005) Raising Sheep and Goats (Raising and Improving Goats). Course Book. E.Ü. Agr. Fac. Publications. No.:563. Bornova‐İzmir. 5. Tüik (2009) Web Site of Turkey Statistical Institute. http://www.tuik.gov.tr/jsp/duyuru/upload/vt/vt.htm (15 Ocak 2010). 6. Kaymakçı, M.(2006) Goat Production. ISBN 9944‐5334‐1‐6.Bornova ‐İzmir. 7. Anonymous, 2009. Genetic resources of domestic animals in Turkey. T.R. Agriculture And Rural POTENTIAL ECOLOGICAL IMPACTS OF COMMERCIALLY PRODUCED Bombus terrestris L. (HYMENOPTERA: APIDAE) COLONIES F. GUREL* and B.A. KARSLI Department of Animal of Sciences, Faculty of Agriculture, Akdeniz University Antalya *Corresponding author: fgurel@akdeniz.edu.tr Abstract Bombus terrrestris L. is reared extensively today on an industrial scale and widely used commercially in many countries including Turkey as a pollination agent. In Turkey, approximately 100 000 commercially produced colonies of B. terrestris have been used for the pollination of a number of crops, mainly of tomatoes (95%) in greenhouses every year. A single B. terrestris colony may produce more than a hundred of new queens which may escape from greenhouses and nest in native flora. The invasion and the increase in population of introduced B. terrestris in the new areas have caused some problems, such as, competition with native pollinators for floral resources and nest sites, the introduction of parasites and pathogens, and hybridization with native species. Commercially produced colonies originated from different stocks and differ genetically from local populations and the escaping sexual may introduce foreign alleles. Therefore, the commercial use of B. terrestris for pollination should be considered in respect to genetic changes in local populations. The aim of this paper is to discuss the possible ecological impact of commercially produced B. terrestris colonies on ecosystems. Keywords: Bumble bee, B.terrestris, native populations, hybridization Özet Günümüzde Bombus terrestris L. arısı endüstriyel ölçekte yaygın bir şekilde yetiştirilmekte ve Türkiye dahil bir çok ülkede ticari bir tozlaştırma aracı olarak kullanılmaktadır. Türkiye’de de her yıl yaklaşık 100 000 adet ticari üretilmiş B. terrestris kolonisi başta domates olmak üzere (% 95) serada yetiştirilen birçok ürünün tozlaşmasında yaygın olarak kullanılmaktadır. Bir B. terrestris kolonisi yüzden fazla yeni ana arı üretebilmekte ve bu ana arılar seralardan dışarı çıkarak doğal florada yuva oluşturabilmektedir. B. terrestris arılarının yeni alanlara girerek populasyonlarının artması ve yayılması; besin kaynakları ve yuva yeri için yerel tozlaştırıcılarla rekabet, parazit ve patojenlerin taşınması ve yerel türlerle melezlenme gibi bazı sorunlara yol açmaktadır. Ticari olarak üretilen koloniler farklı genetik yapılara sahiptirler ve yerel populasyonlardan farklılıklar gösterirler. Erkek ve ana arıların seralardan kaçması bölgeye yabancı alellerin girmesine yol açacaktır. Bu nedenle B. terrestris arılarının tozlaşma amacıyla ticari olarak kullanımının yerel populasyonlarda genetik değişikliğe yol açabileceği göz ardı edilmemelidir. Bu makalede, ticari olarak yetiştirilmiş B. terrestris kolonilerinin ekosistem üzerine olası ekolojik etkilerini tartışılmıştır. Anahtar kelime: Bombus arısı, B.terrestris, yerel populasyonlar, melezlenme Giriş Asya ve Avrupa gibi büyük kıtaların geçiş noktasında yer alan Türkiye, sahip olduğu farklı iklim ve vejetasyon tipleri, jeolojik yapısı, zengin su kaynakları ve coğrafi konumundan dolayı biyolojik çeşitlilik bakımından önemli bir gen merkezidir. Türkiye’de 9.000’den fazla bitki türü, 2.000’den fazla arı türü bulunmaktadır. Türkiye’de yaklaşık olarak 50 bombus türü tanımlanmıştır (Özbek, 1990; th 292 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 1997). Apidae familyası içinde yer alan bombus arıları özellikle ılıman iklim kuşağındaki bitkilerin en önemli tozlaştırıcıları arasında yer almaktadır. Bombus arılarının tozlaştırıcı olarak önemleri 1900’lü yılların başında anlaşılmış ve birçok yem bitkisi tohumunun üretiminde bombus arıları etkin olarak kullanılmıştır. Ancak, bombus arılarının kitlesel üretimi yaklaşık yirmi beş yıl önce Hollanda ve Belçika’daki birkaç ticari firma tarafından gerçekleştirilmiştir. Bombus arılarının örtü altı yetiştiricilikte verim ve kaliteyi artırıcı etkilerinin belirlenmesi ile birlikte ticari üretilmiş bombus kolonileri tozlaşma amacıyla Türkiye dahil birçok ülkede yoğun olarak kullanılmaya başlanmıştır. Bombus arıları ticari olarak günümüzde de az sayıda firma tarafından üretilmektedir. Yılda bir milyondan fazla bombus kolonisi üreten bu firmalar kolonileri direk ihraç ederek ya da çeşitli ülkelerde kurdukları ortaklıklarla pazarlamaktadırlar. Özellikle kitlesel üretiminin daha kolay olması nedeniyle bombus arıları içinde yetiştiriciliği en fazla yapılan ve tozlaşma amacıyla en yoğun kullanılan tür Bombus terrestris L. türüdür (Velthuis ve Doorn, 2006). B. terrestris, Türkiye ve Akdeniz Bölgesi doğal faunasında da en yaygın bulunan bombus türüdür. Bu tür, deniz seviyesinden 1500 m yüksekliğe kadar çok geniş bir habitatta önemli vejatasyon tiplerinde görülmektedir (Özbek, 1997). Türkiye’de B. terrestris türünün muhtemelen bir kaç ekotip ve alt türünün bulunduğu ve bunların her birinin kıyı bölgelerinden yüksek dağlık alanlara kadar özel ekolojik koşullara uyum sağladığı tahmin edilmektedir. Ege ve Akdeniz kıyı bölgelerinde yerel B. terrestris ana arıları diyapozdan sonbaharda çıkmakta iken, (doğada sonbahar‐ilkbahar arasında görülmekte) iç bölgelerde ve Avrupa’da ilkbaharda çıkmaktadırlar (doğada ilkbahar‐ sonbahar arasında görülmektedir). Ayrıca farklı bölgelerden toplanan yerel B. terrestris ana arılarının koloni gelişim özelliklerinde de farklılıklar saptanmıştır (Yeninar vd., 2000; Gürel vd., 2008). Ayrıca farklı bombus alttür ve ekotiplerinin hastalık, zararlı ve parazitlere direnç bakımından farklılık gösterebileceği de bilinmektedir. Ticari B. terrestris kolonilerinin tozlaşma amacıyla yoğun kullanımı sonucunda populasyonlarının artması ve yayılmasının besin kaynakları ve yuva yeri için yerel tozlaştırıcılarla rekabet, parazit ve patojenlerin taşınması ve yerel genotiplerle melezlenme gibi bazı sorunlara yol açabileceği belirtilmekte ve bu arıların ekoloji üzerine yapabilecekleri olası zararlı etkiler tüm ülkelerde dikkatle izlenmektedir (Dafni, 1998; Goka vd., 2001). Son yıllarda birçok ülkede olduğu gibi Türkiye seracılık sektöründe de tozlaşma amacıyla B. terrestris arısının kullanımı yaygınlaşmaktadır. Akdeniz sahil kesiminde her yıl yaklaşık olarak 100 bin adet ticari üretilmiş B. terrestris kolonisi örtü altı yetiştiricilikte tozlaşma amacıyla kullanılmaktadır (Gürel ve Gösterit, 2007). B. terrestris türü bombus türleri içinde uyum yeteneği en iyi olan yayılmacı bir türdür. Tozlaşma amacıyla kullanılan kolonilerde çok sayıda ana ve erkek arı üretilmekte, bu ana ve erkek arılar doğadaki yerel populasyonlara ait ana ve erkek arılar ile çiftleşebilmekte ve sera dışında koloni oluşturabilmektedir. Türkiye’de ticari olarak kullanılan B. terrestris kolonilerinin tamamı yabancı firmalardan sağlanan ana arılardan üretilmektedir ve bu ana arıların genetik kökeni bilinmemektedir. Bu nedenle zaman içinde Türkiye yerel B. terrestris genotiplerinin ticari kolonilerde üretilen ana arı ve erkek arılarla çiftleşmesi ve melezlenmesinin kaçınılmaz olacağı ve bunun sonucunda yerel B. terrestris populasyonlarının doğal genetik yapısının farklılaşacağı beklenmektedir. Bu istenmeyen durumun önlenmesi amacıyla birçok ülke, yalnız kendi doğalarında bulunan bombus tür veya alttürlerin ticari üretimde kullanılmasına izin vermektedir. Türkiye B. terrestris populasyonlarının genetik çeşitliliği tanımlanmadan kaybolma tehlikesi altındadır. Yerel B. terrestris populasyonlarına yönelik genetik çalışmalarla genetik çeşitliliğin tespit edilmesi ve bu çeşitlilikten gen kaynağı olarak koruma stratejilerinde faydalanılması oldukça önemlidir. Potential Ecological Impacts Of Commercially Produced Bombus Terrestris L. (Hymenoptera: Apidae) Colonies 293 Bombus terrestris türünün doğal yayılma alanları Bombus terrestris türü dünyada geniş bir yayılma alanına sahiptir. Bu alan, Avrupa kıtasında kuzeyde İskoçya’ya güneyde ise Akdeniz’in güneyi, İtalya, Malta, Yunanistan, Türkiye ve İspanya’ya kadar uzanır. Sıcak ve kuru iklimlere göre sıcak ve nemli iklimlere daha iyi uyum sağladığı bilinmektedir (Goodwin ve Steiner, 1997). Türkiye, doğal faunasında Bombus terrestris bulunan bir ülkedir ve yapılan az sayıda çalışma ile Güneydoğu Anadolu Bölgesi dışındaki (bu bölgede konuyla ilgili herhangi bir çalışma yapılmamıştır) tüm bölgelerde yerel Bombus terrestris türünün bulunduğu belirlenmiştir. Dünyadaki tür dağılımına bakıldığında Türkiye’nin bombus arıları açısından çok önemli bir gen merkezi olduğu anlaşılmaktadır (Aytekin, 2001; Özbek, 1990; 1997). Farklı bölgelerde bulunan Bombus terrestris populasyonlarının yaşam döngüleri ve koloni gelişim özellikleri arasında farklılıklar bulunmaktadır. Bombus terrestris türü, diğer bombus türlerine oranla sahip olduğu geniş ekolojik esneklik özelliği sayesinde doğal yayılma alanlarının ötesinde çok geniş ve hızlı yayılma potansiyeline sahiptir. Bu arıların yayılma hızları kullanıldıkları bölgelerdeki yoğunluklarına ve bölgenin ekolojik koşullarına bağı olarak farklılık göstermektedir. Yapılan çalışmalar Bombus terrestris türünün Yeni Zelanda’da yılda 90 km, İsrail’de 30 km, Tasmanya’ da ise 25 km hızla yayıldığını göstermektedir (Dafni, 1998; Goodwin ve Steiner, 1997; Hingston ve ark., 2002). Bombus terrestris türünün oldukça geniş alanlarda, birlikte evrimleşmedikleri bitkilerde bile tarlacılık yapma yetenekleri, bu arıların çok farklı alanlara uyum sağlayabileceklerini de göstermektedir. Bombus türleri içinde en fazla fırsatçı olan Bombus terrestris türünün doğal olarak bulundukları veya sonradan götürüldükleri alanlarda çok sayıda familyaya ait yüzlerce bitkiden polen ve nektar kaynağı olarak faydalandıkları saptanmıştır (Benton, 2000; Goodwin ve Steiner, 1997; Hingston ve ark., 2002). Bombus terrestris türü deniz seviyesinden 2500 metre yüksekliğe kadar çok geniş yükseklik sınırları içinde yaşayabilmektedir (Goodwin ve Steiner, 1997). Benzer şekilde bu tür, çok farklı habitat tiplerinde; yıllık yağışın 339 mm den az, 10 000 mm den fazla olan alanlarda da yaşayabilme yeteneğine sahiptirler (Dafni, 1998; Hingston ve ark. 2002). Bombus terrestris türünün çok geniş ekolojik esneklik göstermesinde yaşam döngüsü ve koloni gelişimlerini bulundukları ortama göre düzenleme yetenekleri de etkilidir. Bombus terrestris ana arıları çiftleştikten sonra diyapoz olarak adlandırılan dönemi geçirmek üzere toprak altına girerler. Avrupa’nın büyük bir bölümünde ve Türkiye’nin iç kesimlerinde sonbaharda uygun olmayan kış koşullarını geçirmek amacıyla diyapoza giren ve ilkbaharda diyapozdan çıkan ana arılar, Akdeniz Bölgesinde sıcak ve kurak yaz dönemini geçirmek için yaza doğru diyapoza girmekte ve sonbaharda diyapozdan çıkmaktadır. (Gürel ve ark., 1999; 2008). Ayrıca kışları sert geçmeyen ve florası uygun olan bölgelerde yıl boyu Bombus terrestris görülmekte ve bu bölgelerde ana arının diyapoza girmeden yumurtlayarak yılda iki generasyon oluşturduğu tahmin edilmektedir (Hingston ve ark., 2002). Bombus terrestris türünün ekosistem üzerine olası olumsuz etkileri İnsanların katkısı sonucunda, canlı organizmaların dünyadaki coğrafik engelleri aşma oranı tahmin edilemeyecek bir düzeye ulaşmıştır. Yeni giren veya ithal edilen türlerin bir bölümü insan sağlığı için yararlı ve çok az çevresel zarara yol açmalarına karşın, bir bölümü de yeni çevrelerine hızlıca yayılmış ve dünya ekonomisine büyük zarar vermiştir (Hingston ve ark. 2002). Bu konudaki en iyi örnek Amerika Kıtasına sonradan götürülen Avrupa bal arısı Apis mellifera L. dır. Apis mellifera Japonya, Amerika ve Avustralya’da birçok doğal çiçek ziyaretçisinin yerini almış (Gross ve Mackay, 1998) ve Kuzey Amerika’da yabancı otların polinasyonunu artırmıştır (Parker, 1997). Ayrıca mevcut nektar ve polen kaynaklarını azaltarak diğer türlerin zengin besin kaynaklarını kullanmasını engellediği konusunda çok sayıda delil vardır (Hopkins ve Turner, 1999). Ekolojik rekabetin yanı sıra Bombus terrestris türünün ithal edilmesi, kullanıldıkları bölgelerdeki doğal organizmaları etkileyebilecek doğal düşmanların ve hastalık yapıcı diğer etmenlerin de o bölgelere girişini th 294 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) kolaylaştırmaktadır. Ayrıca bu arıların doğal bitkilerin polinasyonunu engelleyerek yabancı ot populasyonunun artmasına ve yerel türler ile melezlenerek genetik bozulmalara da neden olabileceği göz ardı edilmemelidir (Goulson, 2003). Bombus terrestris polilektik bir türdür. Diğer bir ifade ile yaşadıkları coğrafi bölgedeki çok sayıdaki bitki türünün çiçeklerinden faydalanarak beslenirler (Hingston ve McQuillan, 1998) ve bu bitkilerin çoğu aynı zamanda diğer birçok doğal arıların da besin kaynaklarının önemli bir kısmını oluşturmaktadır. Bombus arılarının yaşam döngüsü ve ekolojik yapıları diğer birçok çiçek ziyaretçisi böcek ile özellikle diğer arı türleri ile örtüşmektedir (Donovan, 1980; Hingston ve McQuillan, 1998). İlkbahar ve yaz mevsimi boyunca tarlacılık yapan bombus arılarının uçuş dönemleri de diğer polinatörlerden daha uzundur ve daha uzun süre tarlacılık yaparak bitkisel kaynakları diğer arılara oranla daha fazla kullanma yeteneğine sahiptirler. Ayrıca Bombus terrestris türü, bombus türleri içinde koloni populasyonu en kalabalık olan türdür ve bu özellikleri nedeniyle de diğer türlerle rekabette önemli avantaj sağlar. Bombus terrestris türü arılar bulundukları veya yeni girdikleri bölgelere çok kolay uyum sağlayabilme yeteneğine sahiptirler ve bitkisel kaynakların kullanımında da diğer çiçek ziyaretçisi böceklerden daha baskındırlar. Bu nedenle diğer arı türlerini olumsuz etkilerler. (Hingston ve McQuillan, 1999). Ayrıca diğer birçok arıdan daha ağırdırlar ve vücutlarında daha yoğun tüylere sahiptirler. Büyük vücutlu arılar soğuk havalarda daha avantajlıdır. Çünkü vücut sıcaklıklarını koruma yetenekleri daha yüksektir. Bu özellikleri sayesinde bu arılar, günün erken ve geç saatlerinde ve soğuk havalarda da tarlacılık yapabilirler (Dafni ve Schmida, 1996). Diğer arı türleri tarlacılık yapmaya başlamadan önce nektarın bombus arıları tarafından alınması, şüphesiz ki yaşanan rekabette diğer arı türleri açısından bir dezavantajdır. Bombus terrestris türünün yaşadıkları alanlardaki diğer organizmalar ile rekabete girebilecekleri önemli bir kaynak da yuva yerleridir. Bu arıların kolonileri, yaşam döngüleri sonunda genç ana arılar üretirler. Üretilen genç ana arılar çiftleştikten sonra çevresel ve fizyolojik koşullar uygun olana kadar toprak altına girerek diyapoz olarak adlandırılan süreci geçirirler. Uygun koşullar oluştuğunda diyapozdan çıkan ana arılar öncelikle koloni oluşturmak için uygun bir yuva yeri ararlar. Bombus arıları yuvalarını yeraltında bulunan boşluklarda yaparlar ve sıklıkla terkedilmiş sürüngen yuvaları, tarımsal faaliyetler sonucunda oluşan veya yaprakların oluşturduğu uygun boşlukları kullanırlar (Donovan, 1980; Goulson, 2003). Şüphesiz doğal faunada yuva yeri bulma ekolojik bir denge içinde gerçekleşmektedir. Ancak seralarda polinasyon amacıyla yoğun olarak ticari Bombus terrestris kolonisi kullanılan Akdeniz sahil kesiminde, bu kolonilerde üretilen genç ana arıların seralardan kaçıp doğal alanlarda yuva oluşturması, mevcut ekolojik dengeyi bozarak yuva yeri bulma açısından yaşanan rekabeti artırabilir. Bu durumda yuva yeri bakımından yaşanan rekabet sadece Bombus türleri arasında gerçekleşmeyecek aynı zamanda doğadaki ekolojik dengenin bir parçası olan ve bombus arıları ile benzer yuva yerlerine sahip diğer canlılar da yuva yeri için rekabet etmek zorunda kalacaklardır. Türkiye’de Bombus terrestris kolonilerini pazarlayan firmalar yurt dışından diyapozdan çıkmış ve koloni oluşturmaya hazır haldeki ana arıları ithal etmekte ve bu ana arılara koloni oluşturmaktadırlar. Ancak diyapoza girmiş ve çıkmış ana arılarda iç parazit olan Sphaerularia bombi ve Locustacarus buchneri, dışparazitler, protozoalar ve viral, fungal ve bakteriyel hastalıklar belirlenmiştir (Macfarlane, 1975). Bu nedenle Bombus terrestris önemli zararlara yola açabilecek parazit ve hastalıkları yayarak doğal arı populasyonlarını etkileyebilir ve doğal ekosisteme önemli olumsuz etkide bulunabilir. Türkiye’de ithal edilen Bombus terrestris kolonileri ve ana arıları ile birlikte parazit ve hastalıkların ülkeye girip girmediği konusunda herhangi bir araştırma yapılmamıştır. Birçok çiçek; oldukça fazla sayıda tozlayıcı tarafından ziyaret edilir ve bu tozlayıcıların her biri farklı kalitede tozlaşma sağlar. Bombus terrestris türü arılar da çok değişik bitkileri ziyaret eder ve bazı durumlarda kalitesiz tozlaşma sağlayabilir. Çiçek hırsızı olarak da bilinen bu arılar, eğer çiçeğin yapısı nektar almaya uygun değil ise güçlü mandibulaları ile korollanın alt kısmından bir delik açarak nektarı Potential Ecological Impacts Of Commercially Produced Bombus Terrestris L. (Hymenoptera: Apidae) Colonies 295 alırlar. Bu durumda bu arılar etkili polinasyon yapamaz ve çiçek paraziti olarak rol oynar. Bu davranış çiçeğin diğer tozlayıcılar tarafından ziyaretini engeller ve sonuçta tohum oluşumu azalır (Irwin ve Brody, 1999). Bu nedenle bu tür bitkiler bulundukları bölgelerde yok olma tehlikesi ile karşı karşıya kalabilir. Bir bitki türünün populasyonunun ortadan kalkması, aynı zamanda yalnız o bitki ile beslenen böcek türlerinin de yaşama şansını ortadan kaldırır. Bombus arıları bulundukları bölgelere sonradan götürülen egzotik türlerin (yabancı ot vs.) populasyonunun artmasına neden olabilirler. Egzotik yabancı otların artması, dünyanın bir çok bölgesinde önemli ekonomik ve ekolojik problemlere yol açmaktadır (Hanley ve Goulson, 2003). Bombus terrestris türünün yayılması sonucu ortaya çıkabilecek diğer önemli bir etki, yerel genotipler ve yeni giren genotipler arasında çiftleşme sonucu oluşabilecek genetik açılımlardır. Türkiye’deki yerel Bombus terrestris populasyonları arasında birçok özellik bakımından önemli varyasyonlar olduğu saptanmıştır (Yeninar ve ark., 2000; Gürel ve ark., 2008). Bu nedenle ticari koloniler ve yerel kolonilerde yetiştirilen ana arı ve erkek arılar arasında meydana gelebilecek olası melezleşmeler yerel gen kaynaklarının kaybolmasına yol açabilecektir. Sonuç Bombus arıları örtü altında yetiştirilen domates, biber, patlıcan gibi bitkiler başta olmak üzere birçok bitki için mükemmel tozlaştırıcılardır. Bombus arıları kullanılarak yapılan tozlaşmayla seralarda üretilen ürünlerin kalite ve miktarı artmakta, hormon ve pestisit kullanımı azalmaktadır. Bu nedenlerle sera ürünlerinin yetiştiriciliğinde Bombus terrestris arısının kullanılması önerilmektedir. Diğer taraftan, ticari olarak üretilen ve tozlaşma amacıyla kullanılan B. terrestris kolonilerinin doğal ekoloji üzerine olan olası etkileri diğer bir ifade ile bu türün yayılma hızı, farklı koşullara uyumu, yerel türlerle melezlenmesi ve yuva ve besin kaynakları için doğal tozlaştırıcılarla rekabeti gibi konular da incelenerek gerekli önlemler alınmalıdır. KAYNAKLAR AYTEKİN, A.M. (2001). Bombus arılarının Türkiye’deki durumu ve geleceği. Teknik Arıcılık 74: 16–20. BENTON, T. (2000). The Bumblebees of Essex. The Nature of Essex Series, No: 4, Loginga Books, DAFNI, A. and SCHMIDA, A. (1996). The possible ecological implications of the invasion of Bombus terrestris (L.) (Apidae) at Mt Carmel, Israel. In: The conservation of bees, The Linnaean Society, London,183–200. DAFNI, A. (1998). The threat of Bombus terrestris spread. Bee World 79 (3):113–114 DONOVAN, B.J. (1980). Interactions between native and introduced bees in New Zealand. New Zealand Journal of Ecology 3: 104–116. GOKA, K., OKABE, K., YONEDA, M. and NIWA, S. (2001). Bumblebee commercialization will cause worldwide migration of parasitic mites. Molecular Ecology 10: 2095–2099. GOODWIN, S. and STEINER, M. (1997). Introduction of Bombus terrestris for biological pollination of horticultural crops in Australia. Gosford IPM Services. GOULSON, D. (2003). Effects of introduced bees on native ecosystems. Annual Review of Ecology Evolution and Systematic 34: 1–26. GROSS, C.L. and MACKAY, D. (1998). Honeybees reduce fitness in the pioneer shrub Melastoma afine (Melastomataceae). Biological Conservation 86: 169–178. GÜREL, F., EFENDİ, Y. and MUTAF, S. (1999). Colony initiation of bumble bee queens (B. terrestris) and colony development in captivity. Turkish Journal of Veterinary and Animal Science 23: 379–384. GÜREL, F. and GÖSTERİT, A. (2007). Bombus terrestris L. (Hymenoptera: Apidae) arısının yıl boyu kitlesel üretiminde uygulanan teknikler ve karşılaşılan sorunlar. 5. Ulusal Bilim Kongresi, Yüzüncü Yıl Üniversitesi Ziraat Fakültesi, 5–8 Eylül Van, 1–10. th 296 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) GÜREL, F., GÖSTERİT, A., EREN, Ö. (2008). Life‐cycle and foraging patterns of native Bombus terrestris (L.) (Hymenoptera, Apidae) in the Mediterranean region. Insectes Sociaux. 55: 123–128. HANLEY, M.E. and GOULSON, D. (2003). Introduced weeds pollinated by introduced bees: Cause or effect? Weed Biology and Management 3: 204–212. HINGSTON, A.B. and MCQUILLAN, P.B.(1998). Does the recently introduced bumblebee Bombus terrestris (Apidae) threaten Australian ecosystems? Australian Journal of Zoology 23: 539–549. HINGSTON, A.B. and MCQUILLAN, P.B.(1999). Displacement of Tasmanian native megachilid bees by the recently introduced bumblebee Bombus terrestris (Linnaeus, 1758) (Hymenoptera: Apidae). Australian Journal of Zoology 47: 59–65. HINGSTON, A.B., SMEDLEY, J.M., DRISCOLL, D.A. and CORBETT, S. (2002). Extent of invasion of Tasmanian native vegetation by the exotic bumblebee Bombus terrestris (Apoidea: Apidae). Australian Ecology 27: 162–172. HOPKINS, K. and TURNER, V.B. (1999). Resource use and foraing patterns of honeybees, Apis mellifera, and native insect on flowers of Eucalyptus costata. Australian Journal of Ecology 24: 221‐ 227. IRWIN, R.E. and BRODY, A.K. (1999). Nectar‐robbing bumble bees reduce the fitness of Ipomopsis aggregata (Polemoniaceae). Ecology 80: 1703–1712. MACFARLANE, R.P.(1975). The nematode Sphaerularia bombi (Sphaerulariidea) and the mite Locustacarus buchneri (Podapolipidae) in bumble bee queens Bombus spp. (Apidae) in New Zealand. The New Zealand Entomologist 6(1): 79. ÖZBEK, H. (1990). A New bumblebee species of pyrobombus dalla torre (Hymenoptera, Apidae, Bombinae) in Eastern Anatolia, Turkey. Türkiye Entomoloji Dergisi 14 (4): 207–214. ÖZBEK, H. (1997). Bumblebee fauna of Turkey with distribution maps (Hymenoptera: Apidae, Bombinae) Part 1: Alpigenobombus skorikov, Bombias robertson and Bombus latreille. Türkiye Entomoloji Dergisi 21 (1): 37–56. PARKER, I.M. (1997). Pollination limitation of Cytisus scoparius (Scotch Broom), an invasive exotic shrub. Ecology 78: 1457–1470. Roubik, D.V. 1980. Foraging behaviour of competing Africanized honeybees and stingless bees. Ecology 61: 836–845. VELTHUIS, H.H.W. and DOORN, A. (2006). A century of advances in bumblebee domestication and the economic and environmental aspects of its commercialization for pollination. Apidologie, 37: 421–451. YENİNAR, H., DUCHATEAU, M.J., KAFTANOĞLU, O. and VELTHUIS, H.H.W. (2000). Colony developmental patterns in different local populations of the Turkish bumblebee, Bombus terretris dalmatinus. Journal of Apicultural Research 39 (3–4): 107–116. THE CONSERVATION of GENETIC RESOURCE of DAĞLIÇ SHEEP BREED in BREEDER’S CONDITIONS and A STUDY ON ACHIEVING ECONOMIC SUSTAINABILITY BY COMMERCIAL CROSSBREEDING: KONYA PROVINCE CASE T. CANATAN1*, M. KAN1, N.K. AKBULUT1, G. KELEŞ1, Ş. DOĞAN1, B.E.TEKE1 1 BahriDagdas International Agricultural Research Institute, Konya, Turkey *Corresponding author: tulaycanatan@hotmail.com Abstract Dağlıç sheep breed is an important domestic animal genetic resource in Turkey. Recent statistics show that there is a dramatic decrease in the number of Dağlıç sheep like other indigenous sheep breeds. Therefore, it is vital to protect our indigenous sheep breeds as genetic resources by in situ conservation programs as well as to ensure sustainability of sheep enterprises by increasing their economic profitability. A study was conducted to investigate the intensive fattening performances of commercial crossbred lambs obtained by using Hasak and Hasmer meat genotypes as a sire line in comparisonwithpureDağlıçlambs were investigated in 3 Dağlıç breeding sheep farms in Tatköy village, Selcuklu district, Konya province in 2010. A 62 day fattening trial with a total of 90 Daglıc, Hasak x Daglıc (F1) and Hasmer x Daglıc (F1) lambs as groups of ten lambs, half male half female from each breed at each farm was conducted. The results revealed that brut profit values of Hasak x Daglıc (F1) and Hasmer x Daglıc (F1) crossbred lambs taken intensive fattening were higher (P<0.05) than Daglıc lambs. As a result, besides in situ conservation of Daglıç sheep as a genetic resource, producing commercial crossbreed lambs using Hasak and Hasmer genotypes as sire line can increase profitability to provide sustainability of sheep farms in our region. Key Words:Daglıc sheep, Hasmer, Hasak, crossbred lamb, economic sustainability Özet Dağlıç koyunu, Türkiye yerli evcil hayvan genetic kaynakları açısından önemli bir ırkımızdır. Son yıllardaki istatistiki veriler, diğer yerli koyun ırklarımızda olduğu gibi Dağlıç koyunu sayısında da büyük azalmalar olduğunu göstermektedir. Bu nedenle, yerli koyun ırklarımızın gen kaynağı olarak yerinde korunmasının yanısıra koyunculuk işletmelerinin ekonomik karlılıklarının arttırılarak, sürdürülebilirliklerinin sağlanması da önem taşımaktadır. Bu amaçlar doğrultusunda, 2010 yılında, Konya İli Selçuklu İlçesi Tatköy Köyü’nde, saf Dağlıç koyun ırkı yetiştiriciliği yapan 3 işletmede, Hasmer ve Hasaketçi genotiplerin baba hattı olarak kullanılması ile elde edilen kullanma melezi kuzuların yoğun besi özellikleri saf Dağlıç kuzular ile karşılaştırmalı olarak araştırılmıştır. Çalışmada, her bir işletmede yarısı erkek yarısı dişi 10’ar baş Dağlıç, Hasmer x Dağlıç (F1) ve Hasak x Dağlıç (F1) olmak üzere toplam 90 baş kuzu ile 62 günlük yoğun besi yapılmıştır. Araştırma sonucunda, yoğun besiye alınan Hasmer x Dağlıç ve Hasak x Dağlıç melez kuzularının brut kar değerleri, Dağlıç kuzulardan daha yüksek (P<0.05) bulunmuştur. Sonuç olarak, Dağlıç koyununun gen kaynağı olarak yerinde korunmasının yanısıra, Hasmer ve Hasak genotiplerinin baba hattı olarak kullanılmasıyla elde edilecek kullanma melezi kuzuların bölgemizdeki koyunculuk işletmelerinin karlılıklarının artırılması ve sürdürülebilirliklerinin sağlanmasında kullanılabileceği sonucuna varılmıştır. Anahtar Kelimeler: Dağlıç, Hasmer, Hasak, melez kuzu, ekonomik sürdürülebilirlik th 298 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Introduction One of the most important animal protein sources is red meat. Red meat consumption per person is 116,7 kg in the USA, 99,5 kg in Argentine, and 93,9 kg in Australia, while it is only 18,6 kg in Turkey.It is due to great advances in animal production with the genetic and environmental improvements in these countries (FAO 2004). Cattle, sheep and goat are the most important sources of red meat. Increasing trend of consumer preference to lean meat has caused a decrease in sheep meat demand. Furthermore, insufficient rainfall, overgrazing of pasture and lack of shepherd has led to a decrease in sheep number and corresponding low profit receiving from the sheep farming activities when compare to the past. Today, when sheep farming activity has been still gradually lowering, economic sustainability, having economic, social and environmental dimensions, appear as an important concept. The populations of Daglıc sheep breed accounting a significant ratio in domestic sheep population has been decreasing like other sheep populations year by year. These breed has adapted insufficient condition of region. Hence, it is important to protect domestic sheep genetic resources with in situ conservation programs while providing sustainability to sheep enterprises through improved economic performance. It is aimed with this study to increase the income of farmers by getting high‐quality slaughtered crossbred Daglıc lambs which were obtained by using Hasmer and Hasak breeds for paternal line, on the other hand to conserve Daglıc sheep breed which are growth pure line as main line for genetic resources. MaterialandMethods The sheep used for crossbreeding were Hasmer (31.25%Hampshire Down, 31.25% German Black Head and 37.5% of Merino) and Hasak (Hampshire Down 31.25%, 31.25% German Black Head and 37.5% White Karaman) types which were reared at Bahri Dagdas International Agricultural Research Institute in Konya and Daglıc sheep reared in three different farms in Tatköy villages, Selcuklu region in Konya. Totally, in 2010,981 heads lambs (Hasmer crossbred (225), Hasak crossbred (225) and Daglıc lambs (531) were obtained by crossbreeding and without crossbreeding. Inthestudy,891 lambs were fed inpasture, while a total of 90 Daglıc, Hasak x Daglıc (F1) and Hasmer x Daglıc (F1) lambs as groups of ten lambs, half male half female from each breed fed with concentrate ad libitum for a 62 day. The experiment was designed and the result swere analyzed in the “Complete Randomized Block Design” with three replications (3blocks (farms), 2factors (sex and fat tening programs). Covariance Analyses was performed as the initial live weights of the lambs at the beginning of extensive and intensive fattening programs weren’t balanced. The differences among groups were determined by “Least Significance Differences” being a Multi Comparative Analyses (Düzgüneş et al., 1987). Gross margin was dependent variable and calculated as (Açıl and Demirci 1984, Güneş and et al., 1993, Kıral, 1993, Özçelik and et al., 1999); Gross margin = Gross production value (GPV) – variable cost Gross production value = (The end of feeding live weights (kg) – initial live weights (kg)) * live weight price (TL/kg) Variable cost = Feed cost + Permanent non‐labor cost + maintenance cost (Veterinary, medicine, water, electricity etc.) The most important costs in calculating variable costs were formed by the feed costs, non‐ permanent labor and maintenance costs. The other variable cost elements (Machinery repair and maintenance, marketing etc.) weren’t taken into account in calculating the total variable costs due to the lack of these elements. In this study, labor costs of the farms used in time of pasture and The Conservation Of Genetic Resource Of Dağlıç Sheep Breed İn Breeder’s Conditions And A Study On Achievıng Economic Sustainability By Commercial Crossbreeding: Konya Province Case 299 fattening programs were calculated according to the survey results carried out at the farms over 8 hours per day (Erkuş and et al. 1995, İnan 1998). The value of labor used in study was calculated according to the 35 TL/day per person for each farm. While calculating the labor costs it was taken into consideration that the labor was non‐permanent shepherd fee and rented from the outside of the farms. Feed costs in the intensive fattening program was taken as the price of concentrated feed in free market (0,7 TL/kg). Konya Exchange of Commerce and KONET’s price statistics of live weight value of the lambs in 2010 (11 TL/kg) were used to calculate the gross production value price (KTB,2011 and KONET,2011). ResultsandDiscussion The fertility traits of lambs are shown in Table1. 1014 lambs obtained from 1043 mated ewes with the ratio of 96.7% in 3 farms at 150. day. There search was carried out with 981 single lambs. There were not any twins. Of 981lambs, 225 lambs were Hasmer cross bred, 225 lambs were Hasak crossbred, and the rest were Daglıc lambs. The 90 lambs were used in intensive fattening program (30 Hasmer cross bred, 30 Hasak cross bred, 30 Daglıc lambs), while other lambs were fed based on the pasture. Table 1. The fertility traits of the farms in 2010. TRAITS FARM1 FARM2 FARM3 TOTAL The number of mated ewe 404 303 336 1043 The numb. of ewes gave birth 395 296 323 1014 The number of infertile ewes 9 7 13 29 The number of lambs 395 296 323 1014 The number of dead lambs 10 12 11 33 The number of live lambs 385 284 312 981 The number of male lambs 186 144 170 500 The number of female lambs 199 140 142 481 Lambing rate% 97,8 97,7 96,1 97,2 Infertility rate% 2 2 4 3 Death rate% 3 4 3 3 Survival rate at 150. days% 97,5 95,9 96,6 96,7 Gross margin of commercial cross bred and Daglıc lambs are showed in Table2. Farms, sex and fattening types were the variation sources. The calculation of gross margin was one of the important factors both comparing the farms and deciding farm’s production activities if results are economic or not. In the Table 3, covariance analyses results for gross margin of the farms according to the block and factors were shown. Table 2 and Table 3 show that the results of covariance analyses for sex* fattening type interaction was statistically significant factor at 90% confidence level. Initial live weights of the lambs we had considered as covariant was found as a statistically significant variable at 99% confidence level. As the results of the covariance analyze, the factors which are statistically significant for sex* fattening types interaction at 90% confidence level were grouped according to “Least Significant Differences (LSD) Test”. Male and female Hasmer and Hasak cross bred lambs’ grossmargin values in intensive fattening program are higher than the rests. Blocks (The farms), sex and fattening types were also found statistically significant factors at 99% confidence level (Table 3). th 300 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. The grossmargin values of the farms according to the block and factors (TL/Head) Traits Gross Margin (TL/Head) Farms 1 80,89±1,49 a 2 82,14±1,57 a 3 68,15±1,74 b Fattening Types Daglıc (intensive) 64,36±3,93 c Hasak x Daglıc F₁ (intensive) 93,24±3,95 a Hasmer x Daglıc F₁ (intensive) 97,10±3,95 a Daglıc (extensive) 72,85±1,34 b Hasak x Daglıc F₁ (extensive) 73,23±1,37 b Hasmer x Daglıc F₁(extensive) 61,60±1,39 c Sex Male (M) 80,44±1,71 b Female (F) 73,69±1,69 a Fattening types x Sex Daglıc x Female (intensive) 61,58±5,52 de Daglıc x Male (intensive) 67,13±5,54 cde Hasak x Daglıc F₁ (Female) (intensive) 86,08±5,54 b Hasak x Daglıc F₁ (Male) (intensive) 100,40±5,54 ab Hasmer x Daglıc F₁ (Female) (intensive) 87,8±5,54 b Hasmer x Daglıc F₁ (Male) (intensive) 106,93±5,54 a Daglıc x Female (Extensive) 72,00±1,72 cd Daglıc x Male (Extensive) 73,69±1,77 c Hasak x Daglıc F₁ (Female) (Extensive) 74,24±1,92 c Hasak x Daglıc F₁ (Male) (Extensive) 72,23±1,89 cd Hasmer x Daglıc F₁ (Female) (Extensive) 60,95±1,95 e Hasmer x Daglıc F₁ (Male) (Extensive) 62,25±1,88 e Table 3. The results of the covariance analyses done by grossmargin values for the farms(TL) Variation Sources F.N. Sum of Squares F Value Prob>F Farm number 2 29.567,54 32,60 <,0001 Sex 1 3.700,12 8,16 0,004 Fattening type 5 61.436,67 27,10 <,0001 Sex* Fattening type 5 4.611,89 2,03 0,072 Initial live weights (kg) 1 13.049,07 28,78 <,0001 Conclusion In conclusion, crossbreed lambs either male or female in intensive fattening can increase the gross margin values of farms. However, these lambs generally had the lowest gross margin values in extensive fattening because of poor pastures. These results showed that crossbreed activities are important to provide sustain ability of farms and conserving the genetic sources The Conservation Of Genetic Resource Of Dağlıç Sheep Breed İn Breeder’s Conditions And A Study On Achievıng Economic Sustainability By Commercial Crossbreeding: Konya Province Case 301 LITERATURE Açıl, A. F ve Demirci, R. (1984). Tarım Ekonomisi Dersleri, A.Ü. Ziraat Fakültesi Yayınları: 880, Ankara. Akman, N., Aksoy, F., Şahin, O., Kaya, Ç. Y. ve Erdoğdu, G. (2006) Türkiye’nin Hayvansal Üretimi. Türkiye Damızlık Sığır Yetiştiricileri Merkez Birliği Yay. No: 4, Ankara Düzgüneş, O., Kesici, T., Kavuncu, O., Gürbüz, F. (1987). Araştırma ve Deneme Metodları. A.Ü. Zir. Fak. Yay. 1021. Ankara. Erkuş, A., Bülbül, M., Kıral, T., Açıl, A.F. ve Demirci, R. (1995) Tarım Ekonomisi, A.Ü. Ziraat Fakültesi Eğitim, Araştırma ve Geliştirme Vakfı Yayınları No: 5, Ankara. FAO (2004) http://www.faostat.fao.org, Erişim Tarihi: 05.06.2011 Güneş, T., Günay, A., Erkuş, A., Artık, N., Kıral, T., Yanmaz, R., Turan, A. ve Tanrıvermiş, H. (1993) Kastamonu'da Sarmısak Üretimini ve Pazarlamasını Geliştirme Araştırması, A.Ü. Ziraat Fakültesi, Proje Kesin Raporu, (Yayınlanmamış), Ankara İnan, İ.H. (1998) Tarım Ekonomisi ve İşletmeciliği, 4. Baskı, Avcı Ofset, Tekirdağ. Kıral, T. (1993) Ankara İlinde TŞFAŞ Besi Bölge Şefliği Tarafından Desteklenen Sığır Besiciliği İşletmelerinin Ekonomik Analizi, A.Ü. Ziraat Fakültesi Yayınları No: 1280, Ankara. KONET (2011) KONET A.Ş. istatistiki veri tabanı, Konya KTB (2011) www.ktb.org.tr, Erişim tarihi: 02.02.2011 Özçelik, A., Turan, A. ve Tanrıvermiş, H. (1999) Tarımın Pazara Entegrasyonunda Sözleşmeli Tarım ve Bu Modelin Sürdürülebilir Kaynak Kullanımı ile Üretici Geliri Üzerine Etkileri, Tarımsal Ekonomi Araştırma Enstitüsü Yayın No: 14, Ankara NATIVE BREED GENE RESOURCES AND THEIR LOCAL DISTRIBUTION IN KUTAHYA REGION Hayri DAYIOĞLU1, M. Kasım ÇAYCI1, Altuğ ATALAY2, Cem TOKATLI3 1 Dumlupınar Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Zooloji ABD. Kütahya 2 3 Kütahya Tarım İl Müdürlüğü Dumlupınar Üniversitesi Fen Bilimleri Enstitüsü Biyoloji Anabilim Dalı Kütahya In this study, a balance sheet of native breed cattles, sheeps and goats whose importance and value are not lost was prepared and potential production values and preferred directions of them were determinated in the center, districts and villages of Kutahya. The suggestions of protection, conservation and development of these values were presented. Kütahya Bölgesinde Yerli Gen Kaynakları ve Yerel Dağılımları Kütahya merkez, ilçe ve köylerinde hayvancılıkta önemini ve değerini kaybetmeyen yerli ırk sığır, koyun ve keçilerin bilançosunun yapıldığı bu çalışmada potansiyel üretim değerleri, tercih edilirlik yönleri belirlenmiştir. Bu değerlerin korunması, muhafaza edilmesi ve geliştirilmesi konusunda düşünceler ortaya konulmuştur. INTRODUCTION The province of Kutahya, which is the famous city with its tiles, showed a structure that is weighted in terms of production, income and employment of the agricultural sector in a very long period of time throughout the history. Today, 88.2% of the Kutahya population deal with agriculture, agricultural activity has been done in % 34 of the presence land shows that the agriculture has resumed the importance and value in Kutahya. Kutahya has a considerable potential in husbandry sector because of the positive aspects such as Kutahya's topographical structure, the prevailing characteristic climate conditions (the transition place of dry and damp climate), and natural vegetation. In this study, the structure of bovine and ovine breeding have been evaluated which continued the last 6 years in Kutahya, particularly the place and the location of native gene resources in animal production were investigated. METHOD In this study, the statistics of Kutahya Provincial Directorate of Agriculture Livestock Branch were used and the informations obtained from survey study with native breed animal growers have been classified. RESULTS In our country by the end of 2009 census, the presence of 10.723.958 cattles, 87.207 cows, 21.749.508 sheeps, 5.128.285 hair goats have been determined. Although three‐fold increase seen in the presence of cattle culture of our country, in the presence of 61.2% native cattle, 76.18% buffalo, 65% hair goat, 95% mohair goats, 50% sheep decrease was observed between 1991‐2009 (1). The results are similar to average of Turkey when looking at the determined values in Kutahya (Graph 1, Graph 2). th 304 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Native Breed Gene Resources And Their Local Distribution In Kutahya Region 305 Despite a certain level of the increase in the presence of bovine animal in the center of Kutahya in recent 6 years, the presence of small cattle which is 91 thousand, decreased to 70 thousand showing a decrease of 23% in 2006. This declining trend occured in all districts between the proportion of 4% and 90%. In districts that decreased the presence of small cattle is noteworthy that increased in the presence of bovine animals. In this case, that can be said the small cattle breeders tend to bovine animals breeding. In the presence of goats has decreased by 51% in the center of Kutahya in the last 6 years. However, despite the pressure of 2008, recovery in the number of goats was seen in the last 2 years in Simav, Emet and Aslanapa districts. In regional distribution, the goat breeders often seen in wooded areas near the residential areas were monitored. While the presence of culture cattle breed increases by 2.5 fold in the last 6 years, decrease was determined by 54% in the presence of native cattle, 16% in the presence of goat, 23.4% in the presence of sheep in Kutahya (Graphs 3 and 4). th 306 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Native Breed Gene Resources And Their Local Distribution In Kutahya Region 307 Hair goat is preferred for the consumption of “goat” meat. This meat produced from by breeding of the castrated kids locally in the region. However, when "goat hazard mitigation action plan" (2) is implemented, the number of hair goat has decreased in proportion by 24% and due to abandonment of this practice, the number of goat has become the former within 1 year (Graphs 2 and 5). th 308 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The dominant and widespread sheep type is dağlıç sheep, goat is hair goat (black goat), cattle is native black cattle of Kutahya (3, 4, 5). Still, this native gene resources are available a significant number of in the hands of region breeders and constitutes an important place in animal production. We asked the native breed animal Native Breed Gene Resources And Their Local Distribution In Kutahya Region 309 growers “What is the your reason to produce animal with in native breed animals?” and the data obtained follows as: A large part of the growers (42%) keep these animals because they are more durable, 24% of them prefer theese animals because of the breeding, feeding and keeping are easy. 11% prefer for the habits or traditional causes, 8% prefer for easy trade, 7% breed them because they are cheap and 4% of the growers like theese breeds and they breed them for the purpose of protect these breeds. A part of growers (4%) keep them because of the products are more delicious and qualified which obtained from these breeds and customers prefer them (Graph 6). CONCLUSION Turkey is EU accession process and livestock also influenced by this process. Reducing the presence of animals, the main production material is the perception of culture breed cattle in animal production and understanding of return on breeding cattle imported was also dominant in Kutahya as in Turkey’s livestock. (6, 7). Socio‐economic structures and understanding change over time. Sheep‐goat raising not seem attrctive by new generation growers because sheep‐goat raising are more troublesome. Goat growers have been dependent on goat breeding by the local natural reasons (the presence of suitable vegetation to graze goats in mountain villages and residential areas close to the forest). Native cattle growers use native cattle for production because of their opportunities are not suitble to grow culture breed cattle. th 310 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The native breed sheep and goat growers have been completely abandoned to its fate and that individual producers are not members of any union and cooperatives engaged in their own means of production has been observed. Sheep and goat raising lose their value and existence every day in Kutahya because of economic reasons, production policies and applications in the agricultural supporting sector. Accordingly, the number of dağlıç sheep (called as “pırlak” among the public) and “native black” cattle decrased significantly. SUGGESTIONS Addition to imports desired and almost imposed of bringing cow milk policy from Western countries, we have to see the fact that there are surplus in terms of cattle products and inability in terms of sheep and goat products in European countries (7). Hair goat and native breed sheep products are today’s organic products because of feding, breeding style and understanding. These products are suitable for tastes of our people as taste, flavor and aroma. From this perspective it is possible the establishment of appropriate internal and external markets (8). Planed grazing plans should be arranged by improving watershed models for functional forest, pasture and meadow fields on the basis of multifaceted utilization instead of prohibition and suppression action plans. Sustainable forestry policies should be developed which include protection and usage balance established and also grazing (9). Regional institutions should establish research unit (university, Provincial Directorate of Agriculture) for hair goat, dağlıç sheep and native black cattle in Kutahya region. Improvement study should be started with the pure breeding and selection applications by creating pure nucleus populations (core flock) from breed examples. Native breed cattle, native breed and hair goat growers should be encouraged. Today, the value and importance of nostalgia are adopted and our native breed animals should be thought as the “classic” samples. REFERENCES 1. Anonim, 2010. Hayvancılık istatistikleri, http//www.tuik.gov.tr. Hayvancılık istatistikleri 18.05.2010 T.C Başbakanlık Türkiye istatistik kurumu Pre Haber bülteni 6250, Hayvansal üretim 2009 ANKARA. 2. Anonim, 2008. Keçi zararlılarının azaltılması eylem planı T.C Çevre ve Orman Bakanlığı genel müdürlüğü ANKARA. 3. Soysal MĠ. 2010 Türkiye yerli evcil hayvan gen kaynakları (Native Animal Genetic Reseources of Türkiye ), Namık Kemal Üniversitesi Ziraat Fakültesi Zootekni Bölümü Tekirdağ 4. Demirulus H. 2004 hayvansal gen kaynakları ne durumda http//www.ekoloji magazin.com / biyoloji konu başlığı altında 5. Ertuğrul M, Akman N, Dellal G, Gonca gül T, 2000 hayvan gen kaynaklarının korunması ve Türkiye hayvan gen kaynakları Türkiye ziraat mühendisliği 5. Teknik kongresi yayın no 38 ANKARA 6. Günlü A, 2011 Dünden Bugüne Türkiye hayvancılığının temel problemi Güne kurtarmak. http//veteriner hekimliği net bülteni 7. Kaymakçı M. 2011 süt sığırcılığında yanlış politikalar ve hesaplar. http//www.ekolojik üreticiler org. /index 272 8. Kaymakçı M. 2011 kıl keçisi Günah Keçisi mi http//www. ekolojik üreticiler org. /index 63 9. Küçükaydın A. Ormancılık çalışmaları ve kıl keçi, orman mühendisleri odası raporu, Orman‐Keçi‐ Erozyon‐Turizm Sempozyumu 16 Nisan 2005, http//b.domaindlx.com/omodergi/20052. CONSERVATION STUDIES OF ANKARA GOAT Halil EROL Lalahan Livestock Central Research Institute‐ANKARA Introduction Angora goats are conserved within the scope of two main projects, conducted in Lalahan Central Research Institute of Animal Husbandry Department in ex situ in vivo conditions with the project entitled ‘Conservation of Domestic Animal Genetic Resources’ since 1995, and in situ in vivo conditions with the project entitled ‘Community Based Conservation of Domestic Animal Genetic Resources’ since 2005. Conservation programme aims to prevent process of extinction, to provide descriptive information about the performance and to develop a sustainable production system of Ankara goats in rural areas within the context of conservation and sustainable utilization of animal genetic resources. Material and Method The material of the project consisted of 100 heads in Lalahan Livestock Central Research Institute and 200 heads in public. The project has been conducting according to those rules which are pure breeding; no selection; eliminating of animals which don't show breed specifications, infertile and sick; random mating and application of stud selection system; exchanging studs between herds; and collecting data which specify the breed's productive characters. Conclusion Implementation of both in situ in vivo and ex situ in vivo conservation programs has been useful in point of observation of differences between the herds which are bred in different breeding systems CONSERVATION STUDIES OF HERIK SHEEP Halil EROL, H. İbrahim AKCADAG, Murat UNAL Lalahan Livestock Central Research Institute‐ANKARA Introduction Herik sheep is also called as Amasya Herik. Herik sheep is a local breed with half‐fat‐tailed and rough wool. The breed obtained by crossbreeding of Karayaka ewes with Akkaraman and Morkaraman rams. They are reared mostly in the mountainous villages in Amasya. Their numbers are quite reduced and threatened by extinction. The sheep has been conserved in situ conditions with the project entitled “Community Based Conservation of Domestic Animal Genetic Resource” since 2005. Conservation programme aims to prevent process of extinction, to provide descriptive information about the performance. Material and Method The material of project consisted of two herds of 200 heads animals bred in Yukarioren and Cayirozu villages from Merzifon town in Amasya city. The project has been conducting according to those rules which are pure breeding; no selection; eliminating of animals which don't show breed specifications, infertile and sick; random mating and application of stud selection system; exchanging studs between herds; and collecting data which specify the breed's productive characters. Conclusion The conservation project in public that were commenced in 2005 has been successful. Increasing the number of herds will be useful. SOME CHARACTERISTICS OF GÖKÇEADA SHEEP BREED IN BANDIRMA SHEEP RESEARCH STATION İsmail ERDOĞAN*, Mesut YILDIRIR, Tamer SEZENLER, M.Akif YÜKSEL1 1 Bandırma Sheep Research Station. 10200 Bandirma, Turkey *Corresponding author: ismailerdogan2000@yahoo.com Abstract The aim of the present study was to determine some characteristics of Gökçeada sheep reares in Bandırma Sheep Research Station (BSRS). Gökçeada is a native thin‐tailed sheep breed of Gökçeada Island. The breed well adapted to harsh environmental conditions and production type can be characterized as a semi‐wild system. For the conservation and characterisation of this breed a flock was established in 1995 in BSRS. Some suggestions about in‐situ and ex‐situ conservation for this breed were given. In this context, different body measurements, live weights of ewes and growth characteristics of lambs were determined. Keywords: Conservation, Gökçeada sheep, body measurement, growth Introduction There has been a decrease in sheep population in Turkey during to the last two decades and this decline continues. The conservation and sustainability of farm animal genetic diversity in Turkey is essential for sustainable animal production, rural devolepment and food security Gökçeada breed has been dominant sheep breed in Gökçeada Island (northwest region of Aegean sea) in Turkey (Konyali et al., 2004). Indigenous Gökçeada sheep breed is among the smallest sheep breeds in Turkey. Animals are predominantly white, with black marker around the mouth, nose and eyes, on the ears and rarely on the tip of legs. The tail is thin and long, ram has strong spiral horns, ewes are generally polled, but up to 30% of the ewes have small horn. Total size of the population of Gökçeada sheep is about 70.000 heads (Kaymakçı, 2006). The sheep production system in Gökçeada can be characterized as an "animal production system under semi‐wild conditions". Within this system sheep act independently all seasons and can live and graze in different flock sizes under natural conditions. The entire system relies solely on pasture. Sheeps are captured anuallly for shearing, marking, and separation of lambs as a "product". Imbros sheep as a native breed of the island have a small body, and its fertility and milk yield is quite good. Weight and meat products have also proven to be satisfactory (Konyali et al., 2004). As a result of crossbreeding and shrinking breeding areas, the number of purebred Gökçeada sheep decreased during the last decade. Because of this, the Gökçeada sheep has been included in the genetic resources project for the conservation of the indigenous breed of Turkey (Yilmaz et al., 2003). Gökçeada sheep conservation project was started in 1997 at BSRS in Bandirma/Balikesir, Turkey, for the purpose of genetic conservation, and of study and determination of its characteristics. This flock was transferred from Kumkale State Farm and has been maintained in BSRS since then. In this paper, some suggestions about in‐situ and ex‐situ conservation for Gökçeada breed were given. In this context, different body measurements, live weights of ewes and growth characteristics of lambs were determined. th 316 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Material and Metod The data were obtained from Gökçeada sheep flocks reared in BSRS. The flock were kept indoors during winter and they were offered concentrate 400–600 g/ewe/day and alfalfa 0.8‐1.0 kg/ewe/day depending on the physiological status. Lambs were kept alone with their mothers in stalls for 1 days after lambing. When lambs were 10 day old, they were fed ad libitum a creep–feed concentrate and alfalfa hay. The lambs were suckled twice a day, weaned at three months. Some body measurements; Body Length: BL, Withers Height: WH, Chest Depth:CD and Chest Girth: CG and Live Weight (LW) obtained from Gökçeada sheep and lambs. Growth traits; Birth weight (BW) was recorded for all lambs born alive. Individual lamb WW at 90 day was calculated by linear interpolation, and ADG from birth to weaning was calculated. The effects of year, dam age, birth type and sex on the growth of the lambs were determined by least squares analysis of variance (Özdamar, 2004). The differences between the means of the sub‐factors were tested by Duncan test. SPSS statistical software package program was used for the analyses (SPSS, 1999). Result and Discussion Table 1 summarize the least squares means for live body weight and linear body measurements of ewes above 1 year of age. The least squares means of body weights in ewes was found 34.4±0.6 kg. The last squares means of body measurements for withers height 65.4±0.3 cm; body length; 59.8±0.4 cm; chest depth 26.4±0.2 cm and chest girth 79.5±0.6 cm for Gökçeada ewes. Table 1. Least square means and standard errors for body weight (kg) and linear body measurements (cm) for Gökçeada ewes v Factors investigated n Mean SE Minimum Maximum LW 59 34.4 0.6 24.2 44.0 WH 59 65.4 0.3 58.0 73.0 BL 59 59.8 0.4 51.0 66.0 CD 59 26.4 0.2 21.0 30.0 CG 59 79.5 0.6 66.0 88.0 The least square means and standard errors of the live weights of the Gökçeada lambs at BW, WW(90D), LW180, YLW, and ADG90 are shown in Table 2. The live weights of lambs for male and female were 3.2 and 3.1 kg for BW; 19.9 and 17.8 kg for WW; 26.9 and 22.2 kg for LW180; 32.6 and 27.4 kg for YLW; and 179.4 and 157.6 g for ADG, respectively. The results of the present study are in agreement with the findings of Yılmaz et all., (2003). The effect of year and sex on BW were found to be non significant, whereas the effect of birth types was significant (P<0.05). Some Characteristics Of Gökçeada Sheep Breed In Bandırma Sheep Research Station 317 Table 2. Least‐square means and standard errors of the live weights of lambs at different ages (kg) and average daily gain (g) at 90 days Investigate d factors Year BW n WW NS n LW180 *** YLW ADG n NS n *** n *** a 2008 70 3.3±0.1 58 21.3±0.7 51 25.4±0.8 51 28.3±0.1 58 193.1± 7.2a 2009 77 3.1±0.1 71 18.5±0.6b 58 23.5±0.8 50 32.2±0.1 71 166.2±6.5b b 34 24.9±1.0 21 27.9±1.2 50 147.2±7.8b n *** n *** 2010 50 3.3±0.1 50 17.1±0.8 Sex n NS n ** n ** 106 3.2±0.1 98 19.9±0.5 71 26.9±0.6 57 32.6±1.9 98 179.4±5.7a Female 91 3.1±0.1 81 17.8±0.6b 71 22.2±0.6b 65 27.4±1.8b 81 157.6±6.3b Birth type n *** n *** n *** 74 a 21.0±0.6 a a Male a a n NS n *** 57 a 26.8±1.5 49 30.5±0.8 74 188.2±6.4a Single 78 3.5±0.1 Twin 116 3.0±0.1b 102 18.0±0.5b 82 22.9±0.9b 72 29.4±0.7 105 156.4± 5.4b Overall 197 3.2±0.1 179 19.0±0.4 142 24.5±0.5 122 29.8±0.6 179 169.5± 4.3 a,b,c: The differences between the means of groups marked by various letters in the same column are significant (**;P<0.01, ***: P < 0.001) In conclusion, Gökçeada sheep to be used as native genetic resource that the current system should be maintained and supported, where Gökçeada sheep lives in a semi‐human controlled environment in Gokçeada Island in Turkey. Improvement of pasture and organic production systems will enhance the valuation of Gökçeada sheep in the context of organic production and will maintain the contribution of this breed in the next generation within its natural living area (Konyali et al., 2004). Some characteristics such as growth performance of lambs and different body measurements of Gökçeada ewes raised in BSRS were determined. Acknowledgements The authors are grateful to General Directoriate of Agricultural Research for financial and research assistance. REFERENCES Kaymakçı, M. (2006). İmprovement sheep breeding. Sheep and Goat association. No:1, Bornova, İzmir. 336 p. Yılmaz A, Ozcan, M., Ekiz, B., Ceyhan, A. and Altinel, A. (2003). The production characteristics of the indigenous Imroz and Kivircik sheep breeds in Turkey. AGRI 2003, 34: 57‐66 Konyalı, A., Daş, G., Savaş, T., Yurtman, İ.Y. (2004). Imbros Sheep Raising in Gökçeada: A potential for organic animal production? 1st International Congress on Organic Animal Production and Food Safety, 28 April‐1 May 2004, Kusadasi, Izmir, Turkey Özdamar K. (2004). Paket Programlar ile İstatistiksel Veri Analizi I. Kaan Kitabevi. ISBN: 975‐6787‐09‐0. Eskişehir. SPSS, (1999). SPSS Base 10.0 User's Guide. SPSS inc., Chicago, IL, USA, 1999. ON THE ORIGIN OF WOOL SHEEP Johannes A. Lenstra1, James Kijas2, Simon Boitard3 and Ben Hayes4 on behalf of the International Sheep Genomics Consortium5. 1 2 Utrecht University, Yalelaan 2, 3584C Utrecht, The Netherlands. CSIRO Livestock Industries, Brisbane, 4067 Queensland, Australia. 3 4 INRA, Toulouse, 52627 31326, Castanet‐Tolosan, France. Department of Primary Industries, 1 Park Drive, Bundoora, Victoria 3083, Australia 5 www.sheephapmap.org. The phylogeny of 74 breeds from all continents was reconstructed on the basis of genotypes for 49034 SNPs. The high density of markers allows an estimation of divergence times of breeds on the basis of LD as an alternative to classical genetic distances. A NeighborNetwork phylogenetic graph of divergence times displayed for most breeds similar branch lengths, which supports the validity of the estimates. The network separated breeds according to geographic origin and also showed the intermediate positions of crossbred populations. In a graph of Reynolds’ distances branch lengths are uneven as the consequence of genetic drift. The shortest branch lengths were found in Spanish, Italian and Iranian breeds. The tree topology was robust with respect to selection of different subsets of SNPs and showed a remarkable demarcation of geographic breed clusters. Labelling breeds according to the Y‐chromosomal haplotype suggests a paternal founder effect in England or North Europe. Genotypes of nondomestic populations revealed that the feral European mouflon most closely resembles Northern European sheep. Sardinian mouflon is most related to the Sardinian Ancestral Black as the plausible consequence of mutual introgression. Surprisingly, Asian mouflon, which is the wild ancestor species, is more related to Sicilian, Greek and Turkish sheep than to sheep from the Southwest Asian region of domestication. This localizes the phylogenetic root of current domestic sheep in the region around the Ionean Sea. We propose this is region where during the Roman period wool sheep was developed, which subsequently was exported to other regions of the Roman Empire. IMPORTANCE OF CAUCASIAN HONEYBEE AND ITS CHARACTERISTICS AS A GENE RESOURCE M. KARA*, E. SEZGİN1, A. KARA1 1 Eastern Anatolia Agricultural Research Institute, Erzurum *Corresponding author: muhsin_kara64@hotmail.com Abstract: Anatolia is known as one of the gene centers in the world. Caucasian honeybee, on the other hand, is one of the important gene resources in Anatolia and mountain type is the most significant variant of this race. It is black coloured and similar to the Carniola bees regarding shape, size and hair cover. Body is moderate structured, slim and long as abdomen is thin. Chitin is dark. Hair cover is black. Hair colour of worker bees is livid grey as chest hair colour of drones is black. All abdominal rings are black coloured. It has the longest tongue among the all honeybee races. Tongue length varies between 6,7‐7,2 mm. Hair length is short and varies between 0,30‐0,40 mm. It is known that homeland of Caucasian Bee (Apis mellifera Caucasica) is upper valleys of mid‐Caucasia (Georgia, Azerbaijan and northern Caucasus). Its distribution area is extended to Kars, Ardahan and Artvin provinces in north‐eastern Anatolia of Turkey. The area including Posof district of Ardahan province and its all villages and 6 villages of Camili basin in Borçka district of Artvin province is housing different ecotypes of this race. So, this area was isolated for gene conservation of Caucasian Bee by Ministry of Agriculture and Rural Affairs in 2000. In‐situ conservation studies for Caucasian Bee (Apis mellifera Caucasica Garbasthov) have been continuing under the Indigenous Gene Resources Conservation Project with a total of 6960 colonies in on‐farm conditions. Keywords: Caucasian bee, in‐situ conservation, gene resource KAFKAS ARI IRKININ GEN KAYNAĞI OLARAK ÖNEMİ VE IRKIN ÖZELLİKLERİ Özet: Dünyadaki arı gen kaynakları merkezlerinden birisi konumunda olan Anadolu coğrafyasının önemli arı gen kaynaklarından biri de Kafkas arısıdır. Dağ tipi bu ırkın önemli bir varyetesidir. Dağ tipi Kafkas arısında renk siyahtır. Biçim, büyüklük ve kıl örtüsü bakımından karniyol arılarına benzerler. Vücut yapısı orta irilikte ince uzun, karın incedir. Kitin koyu esmer renktedir. Kıl örtüsü daha açık gridir. İşçi arıların kıl rengi kurşuni gridir, erkek arların göğüslerinin kıl rengi siyahtır. Dağ tipi Kafkas arı ırkının tüm abdomen halkaları siyahtır. En uzun dilli arı ırkı olup, dil uzunlukları 6,7 – 7,2 mm’ dir. Kıl uzunlukları kısa (0,30–0,40 mm) ve kıl örtüsü siyahtır. Kafkas arısının (Apis mellifera Caucasica) ana vatanı Orta Kafkasya’nın yüksek vadileri (Gürcistan, Azerbaycan ve Kuzey Kafkaslar) olarak bilinir. Türkiye’de yayılma alanı, Kuzey Doğu Anadolu’da Kars, Ardahan ve Artvin illerine kadar uzanmaktadır. Ardahan ili Posof ilçesi ve tüm köyleri dahil ve Artvin ili Borçka İlçesine bağlı Camili havzasında bulunan 6 köy Kafkas arı ırkının farklı ekotiplerini barındırdığı için Tarım ve Köyişleri Bakanlığı, Tarımsal Üretimi Geliştirme Genel Müdürlüğü 2000 Yılında bir genelge ile bu bölgeleri Kafkas Arı Irkı İçin izole bölge ilan etmiş ve koruma altına almış ve Gen Kaynaklarının Yerinde Muhafazası“ projesi kapsamında Kafkas Arı Irkı (Apis mellifera Caucasica Garbasthov) yerinde muhafazası çalışmaları devam etmektedir. Proje kapsamında her iki bölgede toplam 6960 koloni koruma altına alınmış olup, bu kolonilerde ırkın yetiştirici elinde muhafaza çalışmaları sürdürülmektedir. Anahtar kelimeler: Kafkas arısı, yerinde koruma, gen kaynağı th 322 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) INTRODUCTION Bee keeping is one of the oldest agricultural occupations. It is known that honeybees have been existed for some 50 million years on earth and bee keeping dates back to 10 thousand years ago. Honeybee products have preferably been consumed for health protection throughout human history without doubt on their naturalness and purity (Dadant 1984, Gürel et al. 2004). It is generally accepted that bee keeping emerged in Ancient Egypt and Mesopotamia, Also, Anatolia and Europe have a special place in the development of honeybee culture. It is reported that apiculture was exported to the New World countries by immigrants. Consequently, today it is a widely known activity worldwide except polar areas (Fıratli et al. 2000). According to the archaeological findings Anatolia is one of the oldest territories where honeybee and honeybee keeping culture exist. Due to closed areas formed as a result of climatic diversity and topographical structure different genotypes and ecotypes have been existed in Turkey regarding morphological and physiological characteristics. The effect of honeybee populations in the neighbouring countries on this rich diversity is inevitable. Thus, it has been speaking of the effect of Caucasian bee in Kars and Ardahan provinces, Iranian bee in Eastern Anatolia up to midlands, Italian bee in Thrace and Western Blacksea regions and Syrian bee in South‐eastern Anatolia. Moreover, interactions of the different colonies because of colony transportations within or between the regions as a result of widely engaged mobile bee keeping activities have increased the genetic variation (Karacaoglu and Firatli 1992). Special topographic structure of Anatolia and occurrence of flowering in different times during the year in different regions make Turkey favourable for honeybee keeping. Thus, Turkey, accepted as one of the gene centres in the world, ranks 2nd, 4th and 8th in terms of number of bee colonies, honey production (70 t/year) and honey yield per colony (14 kg) respectively (Anonymous 2006; Guler 2006).Moreover, Turkey has quite higher number of colonies per square kilometre. So, achieving high yield per colony bears in mind first towards increasing the production of honey and other bee products. DISCUSSION Honeybees (Apis mellifera L.) have adapted to a wide range of ecological conditions on Earth showing a broad spectrum in physiological and behavioural attributes. As a result of this, races differ from each other and different ecotypes have emerged within the same race (Ruttner 1988; Dodoloğlu and Genc 2004). They exist and are kept as either pure or crossbred. There have existed purebred honeybee races in the world like Caucasian, Carniola and Italian bees (Inci 1995). Purebred races have been differentiated regarding their original sites or regions and their physiological and morphological characteristics. Purebred honeybees are the unities consisting of the individuals in the specie, sharing the same body characteristics. They have been formed as a result of natural selection. Each race has well adapted to its natural ecosystem. According to the regulations of Ministry of Agriculture of the former USSR, it is necessary that at least 20.000 bee colonies should share the similar biological and production characteristics and they should not have blood relations to other races through four generations to be accepted as a purebred. (Inci 1995). Today, characters used for identification and classification of honeybees have reached up to 42. However, a number of researchers have asserted that number of characters to be considered might vary by races and even ecotypes in the same race. According to Du Praw (1995) breed identification can be done by 13 angle and 2 length measurement in the front wing cells (Karacaoglu and Firatli 1992). It was proposed that wing vein shape and angles were important in identification of Anatolian honeybee genotypes, especially Caucasian and Carniola honeybee races (Guler et al. 2004). As a matter of fact, honeybee races of Turkey were successfully identified and classified through wing vein angles using discriminate analysis (Ruttner 1988). Importance Of Caucasıan Honeybee And Its Characteristics As A Gene Resource 323 Apis mellifera Caucasica is a honeybee race. It is originally found in Caucasian mountains and it has specific distinctive physiological and morphological characteristics which separate it from other races (Inci 1995; Anonymous 2008b). Existence of Caucasian Honeybee in Turkey and Its Importance as a Gene Resource Homeland of Apis mellifera Caucasica Gorbatshov is the mountainous northern part of Trans Caucasia (Karacaoglu and Firatli 1992; Inci 1995; Genc and Dodologlu 2003). Presently, Caucasian honeybee has been existed within the boundaries of Russian Federation. However, it is possible to see pure forms and crosses of this race in highlands of Eastern and especially north‐eastern Anatolia in Turkey up to Ardahan, and Artvin provinces (Genc and Dodologlu 2003; Anonymous 2004). Its existence in north‐eastern part of Turkey has been proven in literature, which can be explained in two ways: 1. Because of geographic closeness, this genotype is naturally found in this area, 2. Russian bee keepers might have brought this genotype during the Russian occupation of this area after 1890’s. Except for some isolated areas in Turkey it is quite difficult to mention about a distinctive race due to the variations in honeybee populations. The first study towards honeybee race identification in Turkey was on honeybee populations in Aegean and Marmara regions by Buttel‐Reepen and they claimed that these populations were the crosses of Cyprus (Apis mellifera Cyprica), Syria (Apis mellifera Syriaca) and Greece (Apis mellifera Ceocropia) bees (Dodologlu and Genc 2004). In another study conducted by Bodenheimer (1942) in Eastern Anatolia, nominated as the sub‐ crossover region for Caucasian bee, he reported that Apis mellifera Remipes had come to existence in this region. In his study, Bodenheimer (1942) determined 6 regions where different honeybee ecotypes existed. He classified these honeybee ecotypes as mountain Caucasian bee (Apis mellifera Caucasica Gorbatshov) in northern Anatolia; yellow Trans‐Caucasian bee (Apis mellifera Remipes) in Elazığ; midland Anatolia bee, very similar to Trans‐Caucasian bee, in Central Anatolia; Western Anatolia bee showing variation between Italian and Syrian bees and the rest were classified as the middling forms of Anatolian bee with Caucasian, Yellow Trans and Syrian bees (Dogaroglu and Uygur 2008). Identification studies in existing honeybee populations have been conducted by using various morphological, physiological and behavioural characteristics in recent years in Turkey (Firatlı and Budak 1992; Dulger 1997). Nevertheless, such studies expected to be based on honeybee breeding have not been carried out within a breeding programme and so they do not go beyond identification of the populations. Original genotypes determined in identification studies have been lost in time due to mobile honeybee keeping practices (Dodologlu and Genc 2004). Getting more and more common, Mobile bee keeping greatly change the genetic variation in Anatolian bee population. So it is stated that dominant genotype of Turkey is the composition of regional honeybee races except the original genotypes of the areas where transportation facilities are limited (Firatlı and Budak 1992; Dodologlu and Genc 2004). Morphological Characteristics Worldwide known and dispersed in 5 continental, Caucasian bee is one of the most superior honeybee races regarding productivity and cold climate hardiness. Behavioural, morphological and physiological traits of this race have been studied and determined by many scientists (Inci 1992; Inci 1995). th 324 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) According to his biometric studies Alpatov (1948) concluded that Apis mellifera Caucasica had several local ecotypes (Karacaoglu and Firatli 1992). However, as mountain and plain, there are two distinctive types of Caucasian Bee in Turkey. Mountain type (A. mellifera Caucasica Gorbatshov), is grey coloured and look like Alpine Carniola bees. Dark Mountain Caucasian bee is small sized and carries more propolis. The other type, on the other hand, is yellow coloured and known as Yellow Plain Caucasian Bee (A. mellifera Remipes Gerstöcker) which is well adapted to the lower altitudes of Caucasia. However, the mountain type is more preferred (Genc and Dodologlu 2003). Mountain type (Apis mellifera Caucasica Garbasthov), is well adapted to the regions of Caucasia with higher altitude and long and snowy winters. It looks like Carniola bees with regard to shape, size and hair cover (Dogaroglu 1999; Genc and Dodologlu 2003). Body is in moderate size, slim and long with a narrow abdomen. Chitin is dark coloured, hair length is short (0,30–0,40 mm), Hair cover (Tomentum) is wide and is light grey coloured than that of Carniola bees. Hair colour of worker bees is lead grey as thorax hair colour of male bees is black. All abdomen rings of the Mountain type are black coloured, but brown spots on the first abdominal ring can also be seen (Dogaroglu 1999; Genc and Dodologlu 2003; Anonymous 2004). Adam (1983) reports that Caucasian bee looks like Carniola bee regarding grey abdominal hair and long tongues as it differs regarding that they construct locks between dark honeycombs using more propolis (Karacaoglu and Firatli 1992). Tregubov (1926) and Gorbachev (1928) also reported that this bee race is more productive in places and seasons with scarce nectar sources since it has the longest tongue which varies between 6.7 and 7.2 mm. allowing it to utilize well the deep‐tube flowers (Dogaroglu 1999; Genc and Dodologlu 2003; Anonymous 2004). Similarly, Bilash et al. (1976) and Crane (1979) claim that it produces honey in various compositions through better utilisation of the deep‐tube‐flowers from which other bees cannot benefit because of short tongue (Karacaoglu and Firatli 1992). Table 1. Some morphological characteristics of Caucasian Bee Characteristics Mean St. Error Cubital Index 2,160 0,310 T3+T4 Width 4,547 0,118 Front Wing Length 9,319 0,183 Rear Leg Length 8,296 0,180 Metatarsus Index 57,680 2,100 Tomentum Index 2,790 0,400 Source: Anonymous (2004) Importance Of Caucasıan Honeybee And Its Characteristics As A Gene Resource 325 Picture 1. İn the hive(E.SEZGİN 2010) Behavioural and Physiological Characteristics Caucasian bees form strong colonies but they reach full strength in mid‐summer because of their slow colonial development in the spring (Vinogrodova 1976). This bee and its crosses have low inclinations towards swarming or swarm very little (Karacaoglu and Firatli 1992.; Dogaroglu 1999; Genc and Dodologlu 2003; Anonymous 2004). During the colonial development stage queen bee can lay 1100–1500 eggs on a day. Live weight of a one‐day‐old queen bee is 90 mg as unmated and mated queen bee live weights are 180 and 200 mg respectively (Anonymous 2008a). They are good tempered, gentle, calm and non‐aggressive. At most 1‐2 hours after colony control it conforms to the new arrangements and are set to the normal working conditions. In some European bee races this can only be achieved in 2 or 3 days (Genc and Dodologlu 2003). Caucasian bees collect propolis in huge amounts and use all of it. In autumn, they leave a small hole in the entrance of the hive. However, their wintering characteristic is not good in northern regions due to susceptibility to nosemia disease (Dogaroğlu 1999; Anonymous.2004). Nevertheless, it is hardy to European Foulbrood (EFB) disease more than standard bee races (Abushâdy 1960). This race has drifting and pillaging nature. Members of the colonies often lose their ways. They are good pollinators for alfalfa, clover and similar plants with deep tube flowers. They enter winter season with weak colonies. They construct smooth honeycombs and seals. Comb seals are dark and concave. Honey yield per colony is high. They store more honey for winter time (Dogaroglu 1999; Genc and Dodologlu 2003; Anonymous 2004), protect food stores well and use thriftily. Other Traits: They benefit from clovers very well and can work at low temperatures and under unfavourable conditions. They are inclined to construct irregular honeycomb bridges. They do not leave some space for air between honey and seal so honeycomb seems to be dark coloured and damply (Anonymous 2004). th 326 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Picture 2. Caucasian bee Swarm (E.SEZGİN 2010) Picture 3. Caucasian bee on flower (M.KARA 2010) CONCLUSION Having the most valuable characteristics, Caucasian bees have widely been used worldwide for hybridization. It was imported from Russia between World War 1 and 2 and crossed with other dark coloured bee races, especially with the Carniola bees, the most similar bee race to Caucasian bee. Intensive studies have been carried out on this bee race in Russia. Good results were harvested from the studies for hybridization with Italian and other bee races in USA (Genç et al.2003). This race has successfully been used in northern states of USA, in Canada, in the Middle and Northern Europe, in almost all parts of Russia, in China, Manchuria and Mongolia, in Middle Asia and in some other countries having cold climate (Anonymous 2008b). In Turkey, bee keeping is an old tradition and bee products have always found a place in human diets (Firatli et al. 2000). So, conservation and improvement of the different ecotypes in the areas of the Caucasian bee race is of vital importance regarding the future of regional and national honeybee keeping activities. As stated earlier, distribution area of Caucasian bee (Apis mellifera Caucasica) is extended up to Kars, Ardahan and Artvin provinces in north‐eastern Anatolia (Anonymous 2004). Having been housing the various ecotypes of Caucasian bee race, all villages in Posof district of Ardahan province and Camili basin of Artvin province were declared as isolated area and this bee race was taken under conservation and development in the year 2008 within the context of Domestic Animals Gene Conservation Scheme. Ardahan and Artvin provinces have completely been closed against bee colony entries from other places. Regional bee keepers have been supported by the government through direct payments in order to protect this bee race in in‐situ conditions. Conservation studies have been underway and 6.960 bee colonies in 107 bee keepers in the two above mentioned areas have been registered and taken under conservation in on‐farm conditions. Since it is the only bee race of which economic value is admitted and so registered, detailed studies on this race in its natural environment, investigation of its ecotypes and breeding studies will contribute the most to countrywide development of the domestic bee keeping activities. Importance Of Caucasıan Honeybee And Its Characteristics As A Gene Resource 327 REFERENCES Anonymous,2008a, Queen Bee Production, (In Tur.) Available online at: http://www.tarim.gov.tr/uretim/Aricilik,Ana_Ari_Yetistiricilik.html Anonymous, 2008b. Caucasian Bee (In Tur.) Available online at: http://www.macahelas.com/Proje/KafkasArisi.htm Anonymous, 2006. The 9th Development Plan (2007‐2013) Exclusive Animal Breeding Specialist Commission Report, Ankara. Available at: http//www.abveteriner.org. Anonymous, 2004. Official Gazetta, Premiership of Republic of Turkey, (In Tur.), Available at: http://rega.basbakanlik.gov.tr/Eskiler/2004/12/20041212.htm Abushâdy, A. 1960. Races of bees, The Hive and the Honeybee. Dadant and Sons (s. 11, 20). Alpatov,V.V.,1948, The races of honeybees and their use in agriculture (in Russian) Siredi Prirody 4. 1‐65. Bodenheimer, F.S. 1942. Studies on Honeybee and Beekeeping in Turkey, Ankara Central Plant Protection Research Institute, NumunePress. İstanbul,.179 p. Bilash, G.D., Makarov, I.I., Sedikh, A.V. 1976. Zonal distribution of bee races in USSR. Symposium on bee biology. Moscow‐1976 (134‐142) Crane, E. 1979. Honey from other bees.In “Ridhererer.Bee Genetics and Breeding” Akademic Press Inc. London.pp 235‐254. Dadant, C. C. 1984. The Hive and The Honeybee,Dadant and Sons, Hamilton Illinois, Dodologlu, A., Genc, F., 2004. Morphological Characteristics of Caucsian and Anatolia Bee (Apis mellitens L.) Races and Their Crosses. Proceedings of the 4th National Zootechni Science Congress, Volume 1: Oral Presentations, 1‐3 March, 2004 Isparta, Dogaroglu, M.,1999. Modern beekeeping techniques,Tekirdağ Dogaroglu, M., Uygur, Ş. Ö., 2008. The importance of Turkey’s Honeybee Ecotypes with regard to Turkey Bee Keeping Activities, Available online at http://www.uludagaricilik.org.tr/dergi/2008/2008‐2/balarisi.pdf Du Praw, E.,1995.The Recognation and handiling of honeybee sipeciment in non linear taxonomy J.Apic.Res.4(2): 71‐84. Dulger C., 1997.Determination of Performances and Morphological Characteristics for Caucasian, Central Anatolia and Erzurum Honeybee (Apismellitens L.) Genotypes UnderErzurum Agroeclogical Conditions (unpublished PhD thesis) Ataturk Üniversity, School of Natural and Applied Sciences, Department of Zootechny, Erzurum. Fıratli, C., Budak, M.E.,1992. Investigation of the physiological, morphological and behavioural differences of the honeybee (Apis mellitens L.) colonies established with queenbees reared by various institutions in Turkey, Project Report No: TUBİTAK VAAG‐795 Ankara, pp: 1.117. Fıratli, C., Genc F, Karacaoglu, M., Gencer, H., 2000. Comparisonal Analysis of Turkey Bee Keeping Activities:Problems and Suggestions,Proceedings of the 5th Agricultural Engineering Technical Congress, Chamber of Agricultural Engineers TMMOB, Volume 2, 17‐21 January, National Library, Ankara. Genc, F. Dodologlu, A., 2003. Basic Principles of Bee Keeping,Textbook, Ataturk University, Faculty of Agriculture Offset, Erzurum. Gorbachev,K.A.,1928. Kabaklıtapinskiepchely. Oputnajapaseka Nr. 8‐9Tula.Alınmıstır. Bilash, G.D., Makarov, I.I., Sedikh, A.V.,1976. Zonal Distribution of Bee Races in USSR.Symposium on bee biology.Moscow.134‐142. Guler, A.,2006, Honeybee, Textbook No:55, OndokuzMayısUniversity, Faculty of Agriculture, Samsun. Güler, A.,Bek, Y.,Güven, H.,Arslan, S. 2004. The Importance of Wing Organ in Morphological Discrimination of Caucasian (Apis mellifera Caucasica) and Carniola (A. mellifera Carnica) Bee Races, Proceedings of the 4th National Zootechny Science Congress: Volume 1: Oral Presentations, 1‐3 September, Isparta. Karacaoglu, M., Fıratlı, C. 1992. Some Morphological Characteristics of Isolated Region Bees in Ardahan Province, İnci, A.,1992. Brood and Queen Bee Production Works Conducted within the TKV Integrated Beekeeping Project, Proceedings of the First Eastern Anatolia Bee Congress, Faculty of Agriculture, Ataturk University, Erzurum. İnci, A.,1995. Brood Problem of Turkey’s Beekeeping Efforts and Its Solution: The Extent of the Brood Problem in Beekeeping, Proceedings of the Second Technical Bee Congress, Ruttner, F. 1988. Biogeography and Taxonomy of Honeybees, Springen, Verlag, Heidelberg. Germany, 284p. Tregubov,V.I.,1926. Barbaszasukhoivprecehelovodstvenayughe Ukraine. Paseka No. 6 3‐6. Vinogrodova, V. M., 1976. Influence of caucasian bee. Symposium on bee biology Moscow.229‐232. BODY MEASUREMENT and SOME PRODUCTION TRAITS of ANATOLIAN WATER BUFFALO RAISED in BANDIRMA SHEEP RESEARCH STATION M.Akif YÜKSEL*, Mustafa KÜÇÜKKEBAPÇI, Mesut YILDIRIR1 1 Bandırma Sheep Research Station. 10200 Bandirma, Turkey * Corresponding author: m_akifyuksel@hotmail.com Abstract Anatolian water buffalo has been the most important animal production material in Turkey for centuries for their milk, meat and truck power. Because of the economic and social conditions the number of AWB very declined in last two decades. Anatolian Water Buffalo ex‐situ conservation flock was established in 1996 in Kocatepe Agricultural Research Institute in Afyon and transferred to Bandırma Sheep Research Station (BSRS) in 2004. The aim of the present study was to determine some characteristics of Anatolian Water Buffalo breed in BSRS. In this context, some body measurements of Anatolian Water Buffalo bred in BSRS were assessed. The overall average milk yield was found 798.47 ±17.56 kg per lactation with an average lactation length of 207.40 ± 2.71 days in Anatolian Water buffalo. Analyses results showed that Anatolan Water buffalo milk contained 4.90±0.23 % protein, 8.10±0.05 % fat, 17.40±0.36 % total solids and 4.01±0.08 % lactose. Keywords: Conservation, Anatolian Water Buffalo, body measurement, milk, growth Introduction Turkey has a great potential of animal production and animal genetic resources. Therefore, this important resources must be conserved. But the livestock inventory data show that the number of the animals have decreased since the early 1980s and the number of breeds at risk. Anatolian water buffalo has been the most important animal production material in Turkey for centuries for their milk, meat and truck power. It is more common along the coast of Black sea and also found in Eastern Anatolia (Soysal et all., 2010). According to 1974 FAO statistics, at that time there were one million buffalo heads in Turkey. From 1984 to 1997, there has been a decrease in the buffalo breeding population of 65 % and the reason for this decrease in water buffaloes has been the preferences for cattle over buffalo in the Ege and Marmara regions, where a large number of buffaloes were found in Turkey (Borghese, 2011). This trend has continued in last two decades and the number of buffaloes, which was 429.000 in 1990, decreased to 86.297 in 2009, because of the economic and social conditions (FAO., 2009). Buffalo is bred in certain regions and especially extensively and characterised mainly well adapted their local condition. AWB has black hair and leather, their horns were crescent and grew back to their necks and also notched and black. Their bodies were short and barrel‐shaped. In Turkey water buffalo meat is especially used for making sausage, which is a very popular typical product in Turkey, prepared with buffalo meat, beef and mutton spiced especially with garlic. Water buffaloes were very popular especially for their pull power in the forestry areas and very popular also for their milk fat cream traditionally suits for famous Turkish dessert. The percentage of creamy structured milk fat content was about to 13 %. This figures not stands for milk fat content. Creamy structured called ‘kaymak’ in Turkish products from buffalo milk has other constituent additionally to the milk fat (Soysal et all., 2005). th 330 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The aim of the present study was to determine some characteristics of Anatolian Water Buffalo breed in BSRS. In this context, some characteristics of milk yield and different body measurements of Anatolian Water Buffalo raised in BSRS were assessed. Material and Method The data obtained from Anatolian Water Buffalo herds raised in BSRS. A total of 601 lactation records were used for analysis of milk yield and lactation length. Animals were kept under a grazing system, receiving commercial concentrate for lactating cows. Cows were milked twice a day, with a milking machine. Milk yields were recorded for each milking. Morphometric measurements included body Length (BL), withers height (WH), chest depth (CD) and chest girth (CG) and live weight (LW). Effect of lactation number was studied on milk yield and lactation length. Analysis was done by general linear model (GLM) technique, using SPSS(1999). Tukey’s test was used to find out difference between means. Result and Discussion The overall average milk yield was 798.47 ±17.56 kg per lactation with an average lactation length of 207.40 ± 2.71 days. The data of milk yield during different lactations are presented in Table 1. The milk production was significantly lower in the first lactation than the yield in the 4nd and subsequent lactation (P<0.001). However, the yield of first lactation was not different from that of 2th and 3th lactation. Similarly, the milk yield did not differ among third to seventh lactations. The average milk yield of buffaloes raised in BSRS for first, second and third lactation period were 501.94±30.19, 795.90±35.65 and 836.88±39.69 kg respectively. The highest fat ratio was found at the first lactation as 8.70±0.51. Analyses results showed that Anatolan water buffalo milk contained 4.90±0.23 % protein, 8.10±0.05 % fat, 17.40±0.36 % total solids and 4.01±0.08 % lactose. Şekerden et all., (1999) reported lower total solids (16.6±1.64), fat (7.1±1.36) and protein (4.4±0.51) in milk of Anatolian Water Buffalo respectively. Table 1 Milk yield, and lactation length of Anataloian Water buffaloes in different lactations Lactation number Lactation milk yield Lactation length (kg) (day) n Mean SE n Mean SE 1 159 501.94a 30.19 164 176.32a 4.96 2 114 795.90ab 35.65 115 214.59ab 5.92 213.84 ab 6.59 223.28 ab 7.65 ab 3 92 4 68 836.88 ab 989.01 b b 39.69 46.16 93 69 5 53 991.30 52.29 53 223.22 6 39 929.05b 60.95 38 212.59ab 10.31 7 28 1004.85b 71.94 28 220.11ab 12.01 21 1139.06 b 23 b 13.25 10 965.31 b ab 19.17 7 946.50 b a 24.03 591 798.47 8 9 10 Overall 83.07 120,38 11 252.41 230.90 143.88 7 191.58 17.56 601 207.40 *, Means with different superscripts in the same column differ significantly (P<0.001). 8.73 2.71 Body Measurement And Some Production Traits Of Anatolian Water Buffalo Raısed İn Bandırma Sheep Research Station 331 The data of live weight and different body measurement are presented in Table 2. The birth weight, live weight at 6, 12, 24 and 48 months for male and female lambs were 31.2, 30.1 kg; 103.6, 104.2 kg; 159.3, 170.9 kg; 236.3, 294.4 kg and 477.2, 438.8 kg respectively. The average live‐weight of the adult female buffalo was found 511.1±94.6 kg and 507.67±94.45 kg for the adult males. Table 2 Least square means and standard errors for body weight (kg) and linear body measurements (cm) for Anatolian Water buffalo (male + female) as affected by age (month) group Male Age n LW n WH n BL n CD n CG 0 256 31.2+5,3 232 69.7+5.3 279 53.5+6.7 232 26.1+2.6 232 73.6+5.0 6 111 103.6+22.1 110 92.2+5.0 110 80.2+12.1 110 42.7+3.6 110 119.3+8.8 12 86 159.3+38.5 84 103.3+7.3 84 93.6+11.7 84 50.7+11.6 84 135.8+11.0 24 26 236.3+61.1 22 112.6+6.6 22 101.5+19.8 22 54.5+4.3 22 155.7+12.3 48 5 477.2+118.0 3 137.3+10.0 3 212.0+7.9 3 54.0+7.9 3 172.3+3.0 >60 3 507.67+94.4 Female n LW n WH n BL n CD n CG 0 364 30.1+5.9 280 69.3+5.4 279 54.4+6.6 280 26.8+4.4 280 74.0+5.7 6 175 104.2+24.1 147 92.1+7.8 146 82.1+9.3 148 44.0+15.4 148 117.0+14.3 12 164 170.9+43.5 123 102.5+5.9 122 94.1+10.9 123 50.6+6.4 123 139.5+10.7 24 71 294.4+74.2 32 114.5+12.7 31 101.6+18.6 32 56.5+7.1 32 154.3+29.5 48 17 438.8+81.0 7 126.2+4.3 7 119.5+4.9 7 64.4+1.9 7 166.7+53.0 >60 47 511.1+94.6 28 134.7+6.3 28 134.5+9.3 28 77.6+26.6 28 201.0+30.5 General Directorate of Agricultural Research (GDAR) is responsible to coordinate and manage to services and duties related with AnGR. GDAR have conducted programs on the conservation of AnGR since 1992 and the project of ‘Conservation of Animal Genetic Resources’ started in 1995 in the several institutions (Ertuğrul ve ark. 2009). Anatolian Water Buffalo ex‐situ conservation flock was established in 1996 in Kocatepe Agricultural Research Institute in Afyon and transferred to BSRS in 2004. A pure native Anatolian Water buffalo herds was chosen as an in‐situ conservation herds in 2005 and is continuing within the ongoing national project in Balıkesir province. Ex‐situ and in‐situ conservation play an important role in characterisation, conservation and awareness of Anatolian Water Buffao. In conclusion, Anatolian Water buffalo to be used as native genetic resource should be maintained and supported.The results of the present study indicated that parity significantly affected milk production and lactation length in Anatolian Water buffalo. The average milk yield under the management conditions is quite satisfactory. Some characteristics such as milk yield, growth performance and different body measurements of Anatolian Water Buffalo bred in BSRS were determined. Acknowledgements The authors are grateful to General Directoriate of Agricultural Research for financial and research assistance. th 332 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Borghese, A. (2011). Development and perspective of Buffalo and Buffalo market in Europe and Near East www.save‐foundation.net/Conferences/.../Buffalo%20in%20Europe.pdf Ertuğrul, M., Dellal, G., Soysal, İ., Elmacı, C., Akın, O., Arat, S., Barıtçı, İ., Pehlivan,E., Yılmaz O. (2009). Türkiye yerli koyun ırklarının korunması. U.Ü. Z.F. Dergisi 23(2); 97‐119 FAOSTAT. 2009; http://faostat.fao.org Soysal, M.İ., Tuna, Y.T., Gürcan, E.K. (2005). An Investigation on the water buffalo breeding in Danamandira village of Silivri District of Istanbul province of Turkey. Journal of Tekirdag Agricultural Faculty 2 (1). Soysal, M.İ., Gürcan, E.K., Özkan, E., Genç, S. (2010). Sustainable conservation of native animal genetic resources in Turkey. İn: Native Animal Genetic Resources of Turkey. Tekirdağ. SPSS; SPSS Base 10.0 User's Guide. SPSS inc., Chicago, IL, USA, 1999. Şekerden, Ö., Erdem, H., Kankurdan, B., Özlü, B. (1999). Factors Affecting Milk Composition and Changes in Milk Composition with Lactation Stage in Anatolian Buffaloes. Tr. J. of Veterinary and Animal Sicences 23 (1999) 505‐509. EFFECT OF BODY CONDITION SCORE ON SOME BODY MEASUREMENTS, MILK PRODUCTION AND MILKING FLOW IN FRIESIAN COWS IN YEMENI COLD AREAS Mahfoudh. A. Al‐ Hard Faculty of Agriculture and veterinary – Thamar University‐Yemen E‐mail:dralhered100@yahoo.com ABSTRACT The study was carried out to investigate the effect of body condition score (BCS) on milk production (day time \ night at 305 days), milk flow and body measurements in Friesian cows in Rusaba cows' station, Thamar, Yemen. A total of 105 Friesian cows were selected and subjected to investigation by standard techniques. The results revealed that The effect of Morning milk yield, Evening milk yield, daily milk yield, Total milk yield , Morning milk flow, Evening milk flow and Body weight was 8.80, 10.49, 5987.7 kg, 1.72, 1.89 kg/m and 504 kg) respectively. Milk production traits were influenced significantly (P<0.01) by body condition score. All traits were influenced significantly by parity with exception the body weight. Negative correlation (P<0.01) among BCS, morning, evening and daily milk production, whereas positive correlation between BCS and body weight was observed. The results of this study could be useful as base line for improving cattle dairy farms in Thamar area and other regions with similar environmental condition. Key words: Body condition score, Body measurement, milk traits. INTRODUCTION Cattle play important role in the economy of world wide countries. Great importance has been attached to the conformation traits of cattle. Body condition or cow fitness pertaining to degree of body fat at parturition influence the occurrence of metabolic disorders (Wildman et al, 1982). In 1998, Body Condition Scoring was introduced in Dutch type system. Body condition scoring can be used as the basic tool for effective management of dairy cow breeding, it is noninvasive, subjective, quick and inexpensive technique to estimate the degree of fatness (Waltner et al., 1993; Koenen et al, 2001). Cows that have an intermediate amount of fat, as estimated by body condition score (BCS), produced more milk than cows at either extreme. The body condition level is phenotypically connected with milk yield, health and reproduction performance of animals. The economic effecting of dairy cattle breeding is largely dependent on these traits (Domecq et al, 1997). Miller et al (1976) reported that cows with high milk yield have high milk flow rate. Technical developments have now made it possible to record most production characteristics objectively and the future conformation traits may be used primarily to aid the selection of characteristics important to the health and longevity of cattle and the amount of work required for their care (Ovesen, 1972). Study of milk flow during milking can provide useful information for enhancing the efficiency of milking process avoiding some common mistakes, and protecting teat integrity and udder health (Tamburini et al., 2007). Rate of milk removal and time required to milk are of economic importance in relation to the amount of labor required per unit of milk yield (Markos and Touchberry, 1970). th 334 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The differences in milk flow rates showed by the divergent breeds may reflect difference breeding goals among the breeds in the past, This includes traits aimed to maintaining or improving udder health(Walsh et al., 2007). Increase milking speed or flow is associated with decrease milking labor time and labor is a significance expense in the harvest (Ral et al.,1990; Boettcher et al.,1998; Cecchinato et al., 2007). Further more the above workers reported very slow milking cows can prolong the total time needed for milking and also disturb the milking routine. In dairy commercial farm ,for both dairy and dual purpose cattle, it is highly important to obtain knowledge of the relationship of basic energy indicator and economically important traits, therefore, this study aimed to estimate the effect of BCS on some body measurements, milk production and milking flow in Friesian cows in commercial farms, reared under cold environmental condition in Thamar, Yemen. Material and Methods: The study was carried out in Rusaba dairy station, south Sana'a Yemen. A total of 105 Friesian cows were selected randomly and examined. Body Condition Scoring (BCS)was periodically measured. Body condition score was estimated on appearance and palpation the fat around the tail head, covering pelvic bones and rib bones. BCS was scored on 2.5, 3.0 and 3.5 points scale for emaciated, Average and Obese respectively. Body measurement include heart girth, body length (distance between shoulder and hook), were measured by using the private strip partition. The yields and flow of milk data were recorded twice a day (morning and evening) after parturition. Data analysis: The data obtained from the current study were analysed by SPSSv‐10 program using the L.S.D test and one way ANOVA. The phenotypic correlation between BCS and milk yield and milk flow was determined. Result and Discussion The field observation study was carried out on Friesian cow reared in commercial dairy station, Thamar, Yemen under cold environmental condition. In this study the mean and standard errors of milk traits and body measurements are presented in Table1. As shown the mean value of heart girth (HG) , body length(BL), morning milk yield(MMY), evening milk yield(AMY), daily milk yield(DMY), total milk yield(TMY), morning milk flow(MMF),evening milk flow(AMF) , body weight(BW) and body condition score(BCS) was 188.88,167.53, 8.80,10.49,20.54,5987.70 kg ,1.72,1.89 kg/m , 504.19kg and 2.89 respectively. The result of current study are in agreement with finding of Frood and Croxton (1978) who report that cow with low of BCS to 2 points at birth have less productive performance in the season, but with high of BCS to 2.5 they have more milk production. Woods et al (2004) carried out study on Holstein‐Friesian and noticed that the daily production of milk was 14.16kg at 2.31 a body condition score and the 13.3 kg at 2.55 a body condition score. The results of effect of BCS on some body measurement, body weight and milk trait are depicted in Table 2. The mean of heart girth value recorded was 188.31,187.27 and 189.58cm respectively of cow groups with 2.5, 3.0 and 3.5 point scale, no significant difference was observed between the BCS and HG. The mean value of body length(BL) recorded dairy the experiment was 165.60,168.25 and 169.66cm respectively in cow groups with 2.5, 3.0 and 3.5 point scale respectively. Statistically, there was significantly differences (P<0.05) between BCS and BL. The mean total milk production in morning and evening was 8.80 and 10.46kg respectively. The results of this study are in agreement with finding of Chyr et al, 1974) who reached to similar results. The slightly high in mean value in current study may be due to better food and good management received by the cows, especially at evening time . there was significant difference (P<0.05) between BCS and total Effect Of Body Condition Score On Some Body Measurements, Milk Production And Milking Flow İn Friesian Cows İn Yemeni Cold Areas 335 milk yield at morning and evening . The mean value milk production emaciate (BCS=2.5) average (BCS=3) and obese (BCS=3.5) cow groups was (10.28 and 11.57) (7.89 and 8.85) and (8.85 and 10.32) kg for morning and evening respectively, the results of this study consist with finding frood and croxton (1978) and woods et al (2004) who studied the relationship between the BCS and milk yield in morning and evening in Holstein Friesian and other breeds. The mean milk flow recorded value was (1.88 and 2.08), (1.59 and 2.03) and (1.83 and 2.21) kg/min for emaciated , average and obese groups of cow for morning and evening milking time. The findings of this study are in contrary with result reported by Ruegg and Milton (1995) the difference could be attributed to human error or technique used by above worker, statistically, significant difference (P<0.05) was observed between milk flow and BSC. The mean body weight value was 476.14 , 508.10 and 567.08kg for emaciated , average and obese groups of cows respectively (Table 2). Berry et al (2002) carried out study on dairy cows and reached to similar results. All traits affected significantly by parity except Body weight(BW) as presented in Table3. The results of this study are consist of findings of Pawlina and Zwolinska (1993) who studied the relationship between the udder and body measurement, milk traits of Red and White cows in Poland. Table 1. Means and standard errors of milk traits, udder and body measurements Traits Mean Se Min Max Heart Girth (cm) 187.88 ± 0.70 170 207 Body Length (cm) 167.53 ± 0.69 146 187 Morning Milk Yield (kg) 8.80 ± 0.30 3.0 17.60 Evening Milk Yield (kg) 10.49 ± 0.23 4.40 16.80 Daily Milk Yield (kg) 20.54 ± 0.46 11.30 32.20 Total Milk Yield (kg) 5987.70 ± 158.65 2105 11657 Morning Milk Flow (min) 1.72 ± 0.05 1.08 3.36 Evening Milk Flow (min) 1.89 ± 0.04 0.92 3.39 Body Weight (kg) 504.19 ± 3.29 435 590 Body Condition Score 2.89 ± 0.30 2.5 3.5 th 336 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 2. Means and standard errors of Effect of Body Condition Score on Some body measurements ,Body Weight and milk traits І-ІІ -Ш І -Ш ІІ NS NS NS 169.66±2.06 NS NS NS 7.89±0.36 8.85±0.88 ** NS NS 11.57±0.37 9.87± 0.29 0.39 ±0.921 ** NS NS 21.51±0.74 19.41±0.55 20.20±1.65 ** NS NS 6308.22±308.38 5826.48±201.89 5987.71±158.68 NS NS NS 1.88±0.09 1.59±0.07 1.83±0.14 * NS NS 2.08±0.09 2.03±0.07 2.21±0.24 * NS NS 476.14±3.29 508.10±2.50 567.08±8.26 NS ** ** Traits Emaciate Average Obese Observation 36 57 12 Heart Girth (cm) 188.31±1.28 187.27±0.83 165.60±0.92 168.25±1.02 10.58±0.55 Body Length (cm) Morning Milk Yield (kg) Evening Milk Yield (kg) Daily Milk Yield (kg) Total Milk Yield (kg) Morning Milk Flow (min) Evening Milk Flow (min) Body Weight (kg) 189.58±2.77 * significant at the 0.05 level ** significant at the 0.01 level . The correlation coefficient between body condition and some measurements of the body studied Body length (BL) and body weight was 0.19 and 0.78 respectively and the differences were significantly (P <0.05) and (P <0.01) and consistent with these findings indicated by the Kadarmideen and Wegmann ( 2003) that the phenotypic correlation through the stages of production of the body condition score with the body weight was between (0.89‐0.64) and different to what obtained by Roesch et al (2005), who did not find any effect of the correlation coefficient the BCS with the HG, and report by the De ‐Jong (2005). Klosterman (1972)reported that weight alone was not a good measure of cow size because of the effect of body condition. The body condition scoring system takes into account a factor other than weight or frame size and suggests that the system is an indicator of degree of fitness of dairy cows. The correlation coefficient for the BCS with the traits of production milk production(morning and evening) (‐0.24 and ‐0.25), respectively, and differences were negative significant, who studied similar with Kadarmideen and Wegmann (2003) and Zotto et al (2005) in their study of Brown Swiss cows in Italy. This study found that the lower the score the greater the body condition of production of the morning and evening milk,, an inverse relationship, and thus is a good indicator encourages the conduct of the selection to this trait. There was no significant effect of the correlation coefficient the BCS in the total production of milk, consistent with the observation of Ruegg and Milton (1995). Indicates a table (4) that the correlation coefficient between the weight of the animal and the production of milk morning and evening was a negative significantly (P <0.05) and was (‐0.17) and indicates that the more the weight of the body whenever there was a decrease in production and increased food consumption may lead to increased obesity in animals. Effect Of Body Condition Score On Some Body Measurements, Milk Production And Milking Flow İn Friesian Cows İn Yemeni Cold Areas 337 Table 3. Means and standard errors of Effect of Parity on Some body measurements ,Body Weight and milk traits Traits Parity 1 Parity 2 Parity 3 Parity 4 Observation 68 8 8 21 Heart Girth (cm) Body Length (cm) Morning Milk Yield (kg) Evening Milk Yield (kg) Daily Milk Yield (kg) 185.73 ± 0.78 168.72 ± 0.88 189.75 ± 1.84 164.37 ± 1.59 191.37 ± 2.85 161.50 ± 1.32 192.80 ± 1.52 167.19 ± 1.51 Total Milk Yield (kg) Morning Milk Flow (min) Evening Milk Flow (min) Body Weight (kg) І -ІІ І -ІІІ І -ІІІІ ІІ -ІІІ ІІ -ІІІІ NS * ** NS NS NS ** NS NS NS ± 0.67 9.82 ± 0.64 ± 10.66 0.50 ± 13.11 ** ** ** * ** 0.25 9.89 ± 0.94 ± 10.08 1.17 ± 10.68 0.46 ± 12.50 NS * ** NS ** 0.39 ± 18.52 161.89 ± 5669.42 1.45 ± 19.71 344.86 ± 5317.87 1.45 ± 20.97 1.65 ± 27.21 457.20 ± 7458.19 NS NS ** NS ** * NS ** NS ** 0.04 1.71 ± 0.20 2.05 ± 0.10 1.86 ± 0.09 2.43 ± 0.06 1.99 ± 0.23 2.02 ± 0.15 1.85 ± 0.13 2.41 ± 3.72 ± 506.13 15.86 ± 503.12 15.51 ± 500.62 7.98 ± 499.66 NS * ** 0.23 7.13 245.3 ± 5502.87 -ШІ ІІІ ** ** ** ** * NS ** NS * NS NS ** NS NS NS NS NS NS NS * NS * significant at the 0.05 level ** significant at the 0.01 level . Conclusion: The traits of studied are affected by (BCS) and high significantly for BW except HG, BL, and MP. Increase evening milk yield (EMY) in comparison with morning milk yield (MMY). All traits affected by parity except BW. Although Correlation is only phenotypic between (BCS) and milk production traits are negatively significant and other traits were low except BW. Table(4) Phenotypic correlation between body measurement and production traits Traits BCS MMY EMY DM TMY MF BW 0.78** ‐ 0.17* ‐ 0.17* ‐ 0.15 ‐ 0.02 ‐ 0.08 BCS 1 ‐ 0.24** ‐ 0.25** ‐ 0.27** ‐ 0.12 ‐ 0.12 HG 0.01 0.28** 0.26** 0.30** 0.15 0.20* BL 0.19* MF ‐ 0.12 ** significant at the 0.01 level . * significant at the 0.05 level. ‐ 0.18* 0.80** ‐ 0.11 ‐ 0.07 ‐ 0.17* 0.36** 0.58** 0.27** ‐ 0.12 1 th 338 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) References Berry ,D.P; Bukley; P. Dillon; R.D. Evans. M. Rath and R.F.Veerkamp.2002.Genitic parameters for level and change Body Condition Score and Body Weight in Dairy Cows. J. Dairy Sci.85:2030‐2039. Boettcher, P.J.; J.C.M, Dekkers, and B.W. Kolstad, 1998. Development of an Udder Health Index for Sire Selection Based on Somatic cell score, Udder Conformation, and milking speed. J.Dairy Sci., 81:1157‐ 1168. Cecchinato, A.; M.Povinelli., M.Cassandro., P.Carnier., R.D. Zotto and L.Gallo.2007.Relations between different objective milking speed recording systems.Italy.J.Anim.Sci.vol.6,195‐203. Chyr, S.C., Berger, P.J. and Freeman, A.E. 1974. Relation among milk flow rates, udder measurements and udder health in pedigree selected high and low producing cows. J. Dairy Sci. 57: 616. (Abstr). De Jong,G.2005.Body Condition Score, an extra Service from hed book organization for farmers and cattle improvement. The 26th European Holstein and Red Holstein Conference. Prague. Domecq. J.I., Skidmore. A. L., Lloyd. J. W., Kaneene. J.B.(1997):Relationship between body condition scores and milk yield in large dairy herd of high yielding Holstein cows. J. Dairy Sci,80:101‐112. Frood, M. J and D.Croxton.1978.The use Condition Scoring in dairy cows and its relationship with milk yield and live weight ,anim Prod 27:285‐291. Kadarmideen.H.N and Wegmann.2003.Genetic parameters for Body Condition Score and its Relationship with Type and Production Traits in Swiss Holsteins. J. Dairy Sci.86:3685‐3693. Koenen, E.P.C., R.F. Veerkamp., P. Dobbelaar, and G.De.Jong.2001.Genetic Analysis of Body Condition Score of Lactating Dutch Holstein and Red‐and‐White Heifers.J.Dairy Sci.84:1265‐1270. Klosterman,E.W.1972.Beef cattle size for maximum efficiency.J.Anim.Sci.34:875. Markos, H.G. and Touchberry, R.w. 1970. Heritability of rates of milk flow and time required to milk.J.Dairy Sci. 53:188‐191. Effect Of Body Condition Score On Some Body Measurements, Milk Production And Milking Flow İn Friesian Cows İn Yemeni Cold Areas 339 Miller, R.H., R.E.Pearson., B.T.Weinland, and L.A.Fulton.1976.Genetic parameters of several measurement milk flow rate and milking time. J. Dairy Sci. 59:957‐962. Ovesen, E. 1972. Milking ability in relation to size and shape of teats. Anim. Prod. 15:251‐257. Pawlina, E. and Zwolinska, I. 1993. Relationships between udder and body measurements milk traits and longevity of Red and White cows. Genetica Polonica 34: 365‐372. Walsh, S; F. Buckley.; D.P. Berry., M. Rath., K. Pierce., N. Byrne and P.Dillon.2007.Effect of Breed, Feeding System, and Parity on Udder Health and Milking Characteristics .J.Dairy Sci.90:5767‐5779. Ral, G., Berglund, B., Phillipsson, J., Emanuelson, U. and Tengroth, G. 1990. Comprehensive experiments on traits affecting longevity in Swedish dairy cattle breeds. Swedish J. Agric. Res. Sweden. 20: 89‐95. Roesch, M, M.G.Doherr and J.W. Blum.2005.Performance of Dairy cows on Swiss farm with Organic and Integrated Production.J.Dairy Sci.88:2462‐2475. Ruegg, P.L and R.L.Milton.1995. Body Condition Score of Holstein cows on Prince Edward Island ,Canada: Relationships with yield, Reproductive Performance, and Disease .J.Dairy Sci.78:552‐564. Tamburini, A.; A. Sandrucci., C. Nicoletti., and L.Zanini.2007.Milking procedures and milk eject‐ion in Italian Brown cows.Ital.J.Anim.Sci.vol.6(Suppl.1),478‐480. Waltner, S.S, J.P, Mc Namara,. and J.K.Hillers.1993.Relationships of body condition score to production variables in high producing Holstein dairy cattle. Indian. J.DairySci.76:3410‐3415. Wildman, E.E; G.M. Jones; P.E Wagner and R.L.Boman.1981.A dairy cows body condition scoring system and it's relationship to selected production characteristics. J. Dairy Sci.65:495‐501. Woods, S.M, A.F. Carson, A.R.G.Wylie. and J.D.McEvoy.2004.Pre and Post Prandial Serum Leptin Concentrations During Early Lactation in First Calving Holstein‐Friesian Heifers Calving at Height and low live Weight . Agriculture Research forum2004 ,1‐2 March. Irish Grassland Animal Production Association (30th research Meeting). Zotto, R.D;P. Carnier; L. Gallo; G. Bittante and M.Cassandro.2005.Genitic relationship between Body Condition Score, Fertility, Type and production traits in Brown Swiss dairy cows. Ital. J. Anim. Sci. Vol 4(Suppl3)30‐ 32. BODY MEASUREMENT and GROWTH CHARACTERİSTİCS of SAKIZ SHEEP RAİSED in BANDIRMA SHEEP RESEARCH STATİON Mesut YILDIRIR*, İsmail ERDOĞAN, Tamer SEZENLER, M.Akif YÜKSEL1 1 Bandırma Sheep Research Station. 10200 Bandirma, Turkey *Corresponding author: mesutyildirir@hotmail.com Abstract Sakız is one of the most important breeds of sheep famous for high milk production and prolificacy. Sakız sheep are mostly raised in İzmir province of Turkey. National Domestic Animal Conservation Project has been started in 1995 and ex‐situ conservation flock was established in 1996 at Bandırma Sheep Research Station (BSRS) The aim of this paper was to determine the live weight, body measurement and lamb growth characteristics of Sakız sheep raised in BSRS. The least squares means of body weights in various ages for ewes and rams were found 52.7 and 61.1 kg, respectively. The last squares means of body measurements for body length; 69.4, 70.5 cm; wither height 72.4, 74.5 cm; chest depth 30.8, 32.2 cm and chest girth 95.2, 95.3 cm for ewes and rams respectively. The birth weight, weaning weight, live weight at 180 days and yearling live weight for male and female lambs were 3.6, 3.4 kg; 23.9, 20.4 kg; 32.5, 27.5 kg and 43.9, 35.3 kg, respectively. The average daily weight gain of lambs at weaning for male and female lams were 226.0 and 186.9 g, respectively. The effect of year, birth type and sex were significant on WW and ADG of lambs. Keywords: Conservation, Sakız sheep, body measurement, growth characteristics Introduction: Conservation of the genetic diversity to the future is important from cultural, scientific and economical aspects (Ertuğrul et al., 2009). Special attention must also be given to the maintaining genetic diversity for using marginal areas that can be used for food production only by livestock that are adapted to local conditions. This includes the 41 percent of the earth’s land surface (Anonymus, 2009). Sheep breeding have played an important role in the Turkish agricultural economy and rural society. Domestic sheep breeds adapted to the environmental conditions of different regions of the country and have the ability of low production levels. The potantial of the Sakız breed is well known. The breed is one of the most important breeds of sheep famous for high milk production and prolificacy. However the breed is under risk as an genetic resources. The origin of the Sakız breed is uncertain. It has been suggested from Hatziolos (1941) and Dimitriadis (1957) that the breed is the result of crossbreeding between local sheep of the island of Chios and breeds of Anatolia, according to Mason (1967) the original insular breed must have been derived from the Kıvırcık and Dağlıç breeds (Hatziminaoğlu, 1996). The home tract of this breed includes Aegean region surrounding Izmir in Turkey (Kaymakçı, 2006). They are kept in groups of 3‐5 animals by individual families. Commercialized milk production is 180‐200 kg after a suckling period of 40‐60 days. With good husbandry, some individuals can yield more than 500 kg of milk per lactation. Because of high milk production and lambing rate ewes feed with supplementally at production periods. In recent years, the large genetic change observed in sheep populations at Western Anatolia with the quite intensifying of agriculture were threaten the existence of native breeds (Karaca and Cemal, 1998). In order to improve prolificacy traits, the local sheep breeds were crossed with Sakız and Kıvırcık sheep breeds in Western Anatolia (Karaca and Cemal, 1998; Yılmaz et al., 2010). The Sakız breed is mostly populated in the province of İzmir and many breeders abandon keeping of this breed, due to loss of grazing grounds, lack of guidelines and changing lifestyles. For this reason, the th 342 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) number of pure Sakız sheep very declined in recent years. General Directorate of Agricultural Research have conducted programs on the conservation of AnGR since 1992 and the project of ‘Conservation of Animal Genetic Resources’ started in 1995 to protect for the most endangered breeds in ex‐situ flocks (Ertuğrul ve ark. 2009). The ex‐situ conservation flock for the Sakız sheep breed was established in 1996 in BSRS, transferred from Kumkale Agricultural Production Station. The four pure Sakız sheep flocks were included in in‐situ conservation project in 2005 in İzmir province. In this paper, some suggestions about conservation for Sakız sheep breed were given. In this context, different body measurements, live weights of ewes and growth characteristics of lambs were determined. Material and Method The data were obtained from Sakız sheep flocks maintained in BSRS. The flock were kept indoors during winter and they were offered concentrate 400–600 g/ewe/day and alfalfa 0.8‐1.0 kg/ewe/day depending on the physiological status. Lambs were kept alone with their mothers in stalls for 1 days after lambing. When lambs were 10 day old, they were fed ad libitum a creep–feed concentrate and alfalfa hay. The lambs were suckled twice a day, weaned at three months. Some body measurements; Body Length; (BL), Withers Height; (WH), Chest Depth; (CD) and Chest Girth; (CG) and Live Weight (LW) obtained from Sakız sheep and lambs. Growth traits; Birth weight (BW) was recorded for all lambs born alive. Individual lamb WW at 90 day was calculated by linear interpolation, and ADG from birth to weaning was calculated. The effects of year, dam age, birth type and sex on the growth of the lambs were determined by least squares analysis of variance (Özdamar, 2004). The differences between the means of the sub‐factors were tested by Duncan test. SPSS statistical software package program was used for the analyses (SPSS, 1999). Result and Discussion Table 1 summarize the least squares means for live body weight and linear body measurements in different age groups and sex for sheep above 1 year of age. Age had a significant influence on LW, CD and CG. The least squares means of body weights in various ages for ewes and rams were found 52.7 and 61.1 kg, respectively. The last squares means of body measurements for WH; 72.4, 74.5 cm; BL; 69.4, 70.5 cm; CD; 30.8, 32.2 cm and CG; 95.2, 95.3 cm for ewes and rams respectively. Ewes Overall Age 1 2 3 4 >5 Rams Overall Age 1 2 3 >4 Table 1. Least square means and standard errors for body weight (kg) and linear body measurements (cm) for sheep (male + female) as affected by age group n LW BL WH CD 86 52.7±0.3 69.4±0.3 72.4±0.3 30.8±0.3 *** *** NS *** 30 45.3±1.5b 67.6±0.6b 72.3±0.4 29.1±0.4b 8 53.0±2.9ab 73.3±1.2a 73.4±0.8 30.4±0.7ab a ab 7 60.2±3.2 70.7±1.3 73.7±0.9 32.0±0.7a 10 53.6±2.7ab 70.2±1.1ab 72.0±0.7 31.1±0.6ab a ab 31 57.3±1.5 69.6±0.6 72.2±0.4 32.3±0.4a n LW BL WH CD 35 61.1±2.4 70.5±0.9 74.5±0.8 32.2±0.6 * * NS NS 19 56.38±2.9b 68.3±1.1b 74.2±1.0 31.1±0.7 73.8±1.6ab 75.5±1.6 33.6±1.1 5 67.2±4.6ab a 74.7±2.7a 76.3±2.6 35.3±1.8 8 79.7±7.5 b ab 71.4±2.1 73.4±2.0 32.4±1.4 3 56.6±5.8 CG 95.2±0.3 *** 87.0±1.2b 94.6±2.4ab 102.1±2.5a 97.3±2.1a 101.0±1.2a CG 95.3±1.3 NS 92.9±1.6 97.9±2.5 104.3±4.0 95.0±3.1 a,b: The differences between the means of groups marked by various letters in the same column are significant *:P<0.05, ***: P < 0.001 Body Measurement And Growth Characteristics Of Sakız Sheep Raised İn Bandırma Sheep Research Station 343 Table 2 and summarize the least squares means for linear body measurements in different age Ggroups and sex for lambs. The sex of lambs had a significant influence on WH, CD and CD at 90 days. Male lambs had higher values of WH,CD and CG compared to those of the females at 90 days. Age Birth Male Female 90 day Male Female 180 day Male Female Yearling Male Female Table 2. Least square means and standard errors for linear body measurements (cm) for lamb (male + female) as affected by age group n BL WH CD NS 20 32.1±0.9 37.9±0.7 12.1±0.4 12 31.4±1.2 37.2±0.9 12.5±0.5 NS ** *** 50 56.8±0.8 60.3±0.6 24.3±0.3 35 54.3±0.9 57.5±0.8 22.1±0.4 * NS NS 22 60.4±1.1 66.7±0.8 27.5±0.5 18 64.3±1.2 65.3±0.9 27.1±0.5 NS NS NS 12 67.0±1.0 72.6±1.1 30.0±0.6 15 67.4±0.9 72.1±0.9 28.3±0.6 CG 38.3±1.0 37.8±1.3 *** 71.4±0.9 66.6±1.1 NS 78.5±1.3 79.8±1.5 * 90.6±1.4 86.1±1.3 The least square means and standard errors of the live weights of the lambs at BW, WW (90D), LW180, YLW, and ADG (90) are shown in Table 3. The live weights of lambs for male and female were 3.6 and 3.4 kg for BW; 23.9 and 20.4 kg for WW; 32.5 and 27.5 kg for LW180; 43.9 and 35.3 kg for YLW; and 226.0 and 186.9 g for ADG, respectively. The results of the present study are in agreement with the findings of Ceyhan et all., (2007). The effect of age of dam, year and sex on BW were found to be non significant, whereas the effect of birth types was significant (P<0.05). Table 3. Least‐square means (LSM) and standard errors (SE) of the live weights of lambs at different ages (kg) and average daily gain (g) at 90 days. Investigated factors Age 2 3 4 >5 Year 2008 2009 2010 2011 Sex Male Female Birth type Single Twin Triplet Overall BW n 42 42 36 88 n 67 42 55 39 n 103 105 n 51 126 31 208 NS 3.4±0.1 3.5±0.1 3.5±0.1 3.6±0.1 NS 3.4±0.1 3.6±0.1 3.5±0.1 3.6±0.1 NS 3.6±0.1 3.4±0.1 *** 3.9±0.1a 3.5±0.1a 3.1±0.2b 3.5±0.1 WW n 28 31 29 71 n 53 34 37 35 n 81 78 n 36 99 24 159 NS 21.3±1.2 22.2±1.1 23.8±1.2 22.0±0.7 *** 24.0±0.8a 19.6±1.0b 19.8±0.9b 24.7±1.0a *** 23.9±0.7a 20.4±0.7b *** 26.4±0.9a 21.5±0.6b 19.1±1.2b 22.2±0.5 LW180 n 25 29 29 63 n 47 31 37 31 n 74 72 n 30 92 24 146 *** 25.1±1.6b 32.2±1.4a 33.2±1.4a 29.5±1.0ab *** 27.2±1.0c 24.0±1.2c 32.5±1.1b 37.1±1.3a *** 32.5±0.9a 27.5±0.9b NS 31.7±1.5 29.8±0.9 28.5±1.7 29.9±0.7 YLW n 12 18 14 31 n 40 1 32 2 n 34 41 n 14 51 10 75 NS 33.6±3.5 40.3±2.8 44.7±3.2 38.2±2.1 30.3±1.2 36.2±7.6 49.5±1.4 52.6±5.4 *** 43.9±1.9a 35.3±1.8b NS 36.6±3.2 38.5±1.6 46.1±3.8 39.2±1.4 ADG n 28 31 29 71 n 53 34 37 35 n 81 78 n 36 99 24 159 NS 198.8±12.9 207.0±12.3 223.6±12.7 203.2± 8.1 *** 228.3± 8.6a 177.0±10.8b 177.5±10.3b 234.6±10.7a *** 226.0±7.2a 186.9±7.4b *** 247.1±10.7a 199.4± 6.5b 177.4±13.2b 206.8± 5.4 a,b,c: The differences between the means of groups marked by various letters in the same column are significant ***: P < 0.001 th 344 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) In conclusion, based on the results obtained in this study, the Sakız sheep lamb’s growth performances from birth to 12th month weight and ADG are quite high in BSRS. The effects of year, age of dam, sex and type of birth have significant effect on some growth traits of lambs. Sakız breed is an important reservoir of genetic variation and of genetic uniqueness, and their extinction would cause a loss of diversity. Sakız sheep to be used as native genetic resource should be maintained and supported. Acknowledgements The authors are grateful to General Directoriate of Agricultural Research for financial and research assistance. REFERENCES; Anonymous, (2009). Contrıbutıons of smallholder farmers and pastoralısts to the development, use and conservatıon of anımal genetıc resources. FAO‐Commıssıon on genetıc resources for food and agrıculture Intergovernmental technıcal workıng group on anımal genetıc resources for food and agrıculture. Fifth Session Rome http://www.fao.org. Ceyhan, A., Erdoğan, İ. and Sezenler, T., (2007). Some Production Characteristics of Kıvırcık, Gokceada and Sakız Breeds of Sheep Conserved as Gene Resources. Journal of Tekirdag Agricultural Faculty. 4(2):211‐ 218. Dimitriadis, I. (1957). Lesson of sheep and goat production (in Greek). S.Gartaganis (Publisher). Thessalonaki, 137 pp. Ertuğrul, M., Dellal, G., Soysal, İ., Elmacı, C., Akın, O., Arat, S., Barıtçı, İ., Pehlivan,E. and Yılmaz O. (2009). Türkiye yerli koyun ırklarının korunması. U.Ü. Z.F. Dergisi 23(2); 97‐119. Hatziholos, B. (1941). The problem of the animal raising in Greece. Greek publishing society, Society anonymus Athens. 576 pp. Hatziminaoğlu, I., Goergoudis, N., Zervas, N. and Boyazoğlu, J. (1996). Prolific breeds of Greek. in: Prolific sheep. CAB International, Wallingford, UK. pp77‐91. Karaca, O. and Cemal, I. (1998). Conservatıon and use of sheep genetıc resources in western Anatolia. Ege Bölgesi 1. Tarım Kongresi 7‐11 Eylül 1998 – Aydın. Kaymakci, M. (2006). Advanced sheep breeding. Sheep and Goat Breeders Association, Publication No:1 Izmir, Turkey. Mason, I.L. (1967). The sheep breeds of the Mediterranean. FAO, Publised by commonwealth Agricultural Bureaux, 215 pp. Özdamar K. (2004). Paket Programlar ile İstatistiksel Veri Analizi I. Kaan Kitabevi. ISBN: 975‐6787‐09‐0. Eskişehir. SPSS, (1999). SPSS Base 10.0 User's Guide. SPSS inc., Chicago, IL, USA, 1999. Yılmaz, M., Ayhan, V. and Bardakcıoğlu, H.E. (2010). Nomadic sheep breeding Turkey (A case example of Isparta). Journal of Animal and Veterinary Advances. 9 (22); 2829‐2834. PREIMPLANTATION GENETIC DIAGNOSIS (PGD) AVAILABILITY IN ANIMAL GENETIC RESOURCES PROTECTION N. BİLGEN*1, B. ÇINAR KUL1 and O. ERTUĞRUL1 1 Department of Genetics, Faculty of Veterinary Medicine, Ankara University *Corresponding author: nuketbilgen@gmail.com ABSTRACT Preimplantation genetic diagnosis (PGD or PIGD) is to analyze genetic defects of preimplantation stage embryos or oocytes. Obtained DNA from an embryo or an oocyte is used for genetic tests to improve livestock health and production. If an embryo has genetic defect as in structural chromosome abnormalities, inherited disorders or mitochondrial disorders do not show any symptoms in cellular level. These kinds of diseases, such as chromosomal anomalies, Bovine Leukocyte Adhesion Deficiency (BLAD) or Deficiency of Uridine Monophosphate Synthase (DUMPS) are generally cause abortion or death after birth. But they can be detected on preimplantation stage embryos by PGD. In this method the cell which will be analyzed can be obtained from 5‐6 days old embryos. Analyses include karyotyping, whole genome amplifying, genome wide analysis, traditional PCR and fluorescent in situ hybridization (FISH). Cryopreserved embryos can be analyzed with PGD methods. Then the chosen healthy embryos can be implanted. Thus PGD method is important to prevent the loss of time and funds. PGD method allows to embryo selection according to their sex, detection of the disease related genetic background and valuation of the production traits using Marker Assisted Selection (MAS). PGD method is useful for any molecularly characterized and economically important traits. Key Words: Preimplantation Genetic Diagnosis (PGD), Genetic Resources, Inherited Disorders, Livestock, Marker Assisted Selection (MAS) INTRODUCTION The improvement of livestock health and production is possible with recent advances in molecular biology. It started with embryo sexing by polymerase chain reaction (PCR) in 1990’s, then fluorescent in situ hybridization (FISH) methods and continued with fragment and sequence analyses and finally single nucleotide polymorphisms. Through the polymorphisms, marker assisted selections are improved and now they are in use for many economically important traits and also for detection of many inherited disorders. Before fertilization of oocyte with a sperm or before implantation of embryo, it is possible to test for important traits or inherited disorders. But, it is necessary to obtain DNA from an embryo or an oocyte to perform these analyses. EMBRYO BIOPSY PROCEDURES Biopsy could cause embryo damage therefore a successful biopsy procedure is one of the prerequisites of PGD (Polisseni et al., 2010). There are three methods to carry out PGD. The first one is to test blastomeres which can be obtained on the 5‐6th day after fertilization. This method is performed through a hole creation in the zona pellucida. In the second procedure non‐embryo forming cells as in trophoectoderm cells can be used. And the third method is to examine the first and second polar bodies which are the by‐products of meiosis I and meiosis II, respectively. But there is also a disadvantage on the third method that it can be used in case of maternally derived genetic damages as in dominant mutations, translocations and aneuploidy (Adiga et al., 2010). th 346 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) MOLECULAR GENETIC DIAGNOSIS METHODS Molecular genetic diagnosis analyses mainly include karyotyping, fluorescent in situ hybridization (FISH), traditional PCR, whole genome amplifying and genome wide analysis. Karyotyping, Fluorescent in Situ Hybridization (FISH) and Traditional PCR Karyotyping is a test to examine chromosomes in a sample of cells. It helps to count the number of chromosomes and to look for structural changes in chromosomes (Figure 1). In FISH test, fluorescent marked probes are used; the probes bind to only those parts of the chromosome, which they show a high degree of sequence similarity. By FISH presence or absence of specific DNA sequences on chromosomes and the sex of an embryo can be detected (Garcia‐Herreros et al., 2010) (Figure 2 and 3). With traditional PCR it is easy to test for diseases which follow Mendelian inheritance. PCR method also enables to perform further molecular analysis. But PCR is not error free, clinical use of single‐cell PCR data is accompanied by some risk since it has not been possible to confirm the genotype of any one embryonic cell or polar body (Zhang et al., 1992). Figure 1. RGB‐banded cattle chromosome arranged according to ISCNDA ideogram (Fries and Ruvinsky,1999). Preimplantation Genetic Diagnosis (Pgd) Availability In Animal Genetic Resources Protection 347 Figure 2. FISH p.E5.1 probe signal on cattle chromosome number 5 (Ahmad et al., 2007). Figure 3. (A) FISH‐painted control slides with male mitotic chromosomes, exhibiting signals on the whole X (green) and Y chromosomes (red) and specific probe for EGFR gene localized on autosomal chromosomes 4p12 (small red signal). (B) Two haploid sperm cells: left with X chromosome (green) and single small signal of EGFR gene; right with Y chromosome (red) and single small signal of EGFR gene (Bugno et al., 2010). Whole Genome Amplifying and Genome Wide Analysis The disadvantages of PCR can be prevented by whole genome amplifying. Only very small DNA samples are available for PGD analysis whole genome amplifying which could prove useful in these cases. When whole genome of preimplantation stage embryo completed it is possible to perform genome wide analysis as in microarray (Figure 4). Microarray chips are served by different companies for many livestock. And it is also possible to design custom analysis for desired traits. th 348 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 4. Approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. (http://en.wikipedia.org/wiki/File:Microarray2.gif) CONCLUSION Cryopreserved embryo is one of the important conservation methods of genetic resources. But it is important to test embryo for inherited diseases which could cause abortion or dead after birth. Also it is useful for determining chromosomal aberration and more importantly production traits by MAS. Traditional PCR, karyotyping and FISH can be used for single gene diseases or chromosomal anomalies. However for MAS, whole genome amplifying followed by genome wide analysis must be performed before implantation of an embryo. REFERENCES 1. Adiga SK, Kalthur G, Kumar P, Girisha KM (2010): Preimplantation diagnosis of genetic diseases Vol. 56(4) 2. Ahmad A., Thomsen P. D.. Babar M. E. (2007): Fluorescent in‐situ hybridization of cattle and sheep chromosomes with cloned human fragile‐X DNA 3. Bugno M., Jablonska Z., Tischner M., Klukowska‐Rötzler J., Pienkowska‐Schelling A., Shelling C., Slota E.)2010): Detection of sex chromosome aneuploidy in equine spermatozoa using fluorescent in situ hybridizatin. Reprod Domest anim., 45(6):1015‐9 4. Fries R and Ruvinsky A. (1999): Genetics of Cattle, CABI, Wallingford, England. 5. Garcia‐Herreros M, Bermejo‐Alvarez P, Rizos D, Gutierrez‐Adan A, Fahey AG & Lonergan P 2010 Intrafollicular testosterone concentration and sex ratio in individually cultured bovine embryos. Reproduction, Fertility and Development 22 533‐538. 6. Wikipedia, DNA Microarray: http://en.wikipedia.org/wiki/File:Microarray2.gif,29/06/2011 7. Polisseni J., De Sa W. F., De Oliveira Guerra M., Machado M. A., Serapiao R.V., De Carvalho B. C., De Almeida Camargo L. S. and Peters V. M. (2010): Post‐biopsy bovine embryo viability and wholegenome amplification in preimplantation genetic diagnosis, Fertility and Sterility Vol. 93(3) 8. Zhang L., CuI X., Schmitt K., Hubert R., Navidit W., and Arnheim N. (1992): Whole genome amplification from a single cell: Implications for genetic analysis Proc Natl Acad Sci USA 89 DAGLIC, THE HARDY SHEEP OF THE CENTRALANATOLIANMOUNTAINS IS LOSING ITS ALTITUDE Necdet AKAY1, Mehmet KÖSE2, Ahmet Hamdi AKTAŞ1, Seyit ÜMÜTLÜ1 1 Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü 2 Dicle Üniversitesi Veteriner Fakültesi ABSTRACT This study was initiated in 2005 within the scope of flock protection at the origin program with16 rams and 184 sheep at four breeders in Tasagil Village of Bolvadin Township in AfyonkarahisarProvince. There was no interference to flock management except the exchanges of rams at mating. In general the sheep were mustered at high plateaus in spring and summer seasons while they were kept and fed in barns in other seasons. Each year 15‐20% of the flock were altered by new generation. The live weights, reproductive performance, wool weights and body measurements of sheep and live weights, body measurements and surviving ability of lambs were monitored in 2009 and 2010. The birth and twining rate of Daglic sheep in 2009 and 2010 were 96.7‐97.8% and 3‐4% respectively. Lamb production was 1.0% in both years. The weights of male lambs at birth, three and six month age in 2009 and 2010 were 4.1, 3.5; 22.8, 29.5; 40.3 and43.0 kg respectively. The weights of female lambs for the same period were 4.0, 3.4; 20.5, 25.4; 34.5 and 37.6 kg respectively. The surviving ability of lambs at weaning in 2009 and 2010 were 97.8% and 96.2% respectively. Live weights of adult sheep were 70.8 kg for rams and 45.6 kg for ewes. Fleece production was 3,5 in rams and 2.1 kg in ewes. Daglic is a fat tail sheep breed and most of its production characteristics are lower than other native sheep breeds. Therefore its population has been decreasing day by day as a result of crossbreeding with high productive sheep breeds. This situation has lead Daglic to the brink of extinction. It is believed to be beneficial for country’s sheep production that Daglic breed that is well adapted to the mountainous regions should be protected in its origin and needs to be reared at sustainable conditions. Key Words: Daglic Sheep, Reproductive Performance, Live Weights, Body Measurements and Wool Characteristics INTRODUCTION Protection of local genetic resourcesis crucial forthe future of animal production in Turkey. Our local genetic resources have been well adapted to their living areas for centuries and therefore they are able to continue their existence in hard conditions. This has not happened according to a plan, but it occurred through natural adaptation of the animals. The long process of adaptation is a big obstacle for the breeders to test new sheep breeds. Instead of making a bid for long adaptation of a new sheep breed, the idea of protecting our local breeds, that are adapted to their areas, led this study to be initiated in 2005. Daglic is one of the most significant local sheep breeds and used to be widespread, notably in Afyon, Konya,Eskişehir, Isparta, Burdur, Kütahya and UşakProvinces. However various crossbreeding attempts caused dramatic decreases in Daglic populations putting this breed into the position of losing its natural being. Daglic is a fat tailed sheep with a small body size. Although these characteristics enable Daglic to be more resistantinadverse climatic conditions, they are undesirable for the market. The breeders often face difficulties in selling their lambs even at low prices because th 350 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) of the consumer’s preference for lambs with lean tails. Due to faster growth rates of high productive sheep breeds which enable farmers to rear lambs in a shorter period, the breeder choose to crossbreedDaglic with high producing rams with lean tails. Therefore Daglic sheep is on the brink of extinction now. Local Animal Genetic Resource Protection Project was started with 16 Daglic rams and 184 ewes at four breeders in Tasagil Village of Bolvadin Township in Afyonkarahisar Provice. Introduction of any different breed of rams other than Daglıc to the flock was not allowed. Only ram exchanges between flocks were operated in order to prevent close relativity. There was not any intervention to the breeding conditionsand traditional breeding programswere applied. Every year, 20% percent of the lambs at 6 month old age were selected to renew the flocks and the reminderof the male lambs was sold. Therefore, there was no record of the efficiency of male lambsafter six month age. Birth weight, birth type and dirty fleece weight records were taken by breeder. MATERIAL AND METHOD MATERIAL A total of 200 sheep, 16 rams and 184 ewes in 4 different flocks which belong to TasagilVillagebreeders of BolvadinTownship in Afyonkarahisar Proviceconsisted of the animal material of the study. The numbers of the animals in each farm were 6 rams and 65 ewes,3 rams and 47 ewes, 4 rams and 41 ewes, 3 rams and 31 ewes. METHOD In breeder conditions, traditional flockmanagement was carried on without any interference. While flocks were kept in barns in winter, they were mustered on plateausduring April‐October period. Followingthe exchanges of ramsamong sheep farms, natural matingtook places in plateaus July onwards and births started in barns inJanuary. Birth weights and mother‐lamb records were taken by breeders. Shearing was made in plateau and dirty fleece weights were measured by breeders. Flock controls, which were periodically made in certain period of years, lambs 90.days and 180.days measurements and sheep measurements were done. Thelive weight, height at withers, height at rump, body length, chest width and chest depthwere determined. RESULTS Reproductive Performance: In this study the findings about fertility for first (2009) and second (2010) years are presented in table 1. Table 1.Prolificacy characteristics of Daglic sheep Year Sheep numbers Parturient Sheep Lambing rate % Prolific Parturient Sheep 2009 184 180 97,8 5 2010 184 178 96,7 8 Prolific Number of Fecundity lambing (%) lambs born 3 4 185 1,01 186 1,01 Daglıc, The Hardy Sheep Of The Centralanatolianmountains Is Losing Its Altitude 351 Survival rate : Findings about survival rates at weaning (90.days) are presented inTable 2. Table 2. Surviving ability of Daglic lambs at weaning (90. day) Number of lambs born 0‐30 days dead lambs 30‐60 days dead lambs 60‐90 days dead lambs Till at weaning of dead lambs totally Live lambs Survival rates at weaning of lambs % 2009 185 2 1 1 4 181 97,8 2010 186 3 ‐ 4 7 179 96,2 Year Body measurements : Liveweightsof lambs at birth, 90. days and 180. days and body measurements of lambs and mature sheep and average live weights of sheep are presented in Tables 3,4 and 5. Table 3. Liveweights of Daglic lambs at birth, 90 and 180 days old of age, kg ( x ± s x ) n n n Year Birth 90. days 180. days Male 89 4,1±0,19 87 22,8±0,42 85 40,3±0,60 Female 96 4,0±0,17 94 20,5±0,33 91 34,5±0,34 Male 97 3,5±0,19 93 29,5±0,79 89 43,0±0,54 Female 89 3,4±0,15 86 25,4±0,73 82 37,6±0,49 2009 2010 Table 4.Body measurements of Daglic lambs at birth, 90 and 180 days old of age, cm ( x ± s x ) Withers Rump Body Length Chest Width Chest Year n Old Height Height Depth Male 87 90. days 55,8±0,40 54,7±0,38 51,1±0,44 65,3±0,55 21,3±0,19 85 180. days 65,9±0,40 64,9±0,48 58,0±0,58 79,9±0,47 26,4±017 94 90. days 53,3±0,40 52,3±0,36 49,9±0,45 63,8±0,49 20,3±0,16 91 180. days 61,9±0,25 62,5±030 56,0±0,32 77,5±0,39 24,8±0,13 93 90. days 60,4±0,57 60,7±0,53 52,3±0,55 74,8±0,76 23,6±0,22 89 180. days 63,6±0,51 64,9±0,52 59,3±0,36 89,2±0,54 27,2±0,19 86 90. days 57,3±0,57 57,1±0,52 50,4±0,72 71,7±0,97 21,9±0,27 82 180. days 60,5±0,55 61,2±0,58 57,2±0,45 88,3±0,63 25,8±0,21 2009 Female Male 2010 Female th 352 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 5. Body measurements,cm ( x ± s x ) and liveweights,kg ( x ± s x ) of mature Daglic sheep Withers Rump Body Chest n Live Weight Chest Depth Height Height Length Width Female (18 29 40.2±1.06 63.2±0.44 63.6±0.49 58.2±0.50 85.5±1.11 27.0±0.27 mounths) Ewe 155 45.6±0.39 67.0±0.22 66.5±0.22 60.1±0.25 90.4±0.45 29.9±0.12 Ram 16 70.8±1.49 72.7±1.16 73.5±0.95 62.9±1.31 96.0±1.16 31.3±0.44 Fleece efficiency : The values for dirty fleece efficiency are presented in Table 6. Table 6. Dirty fleece weights of Daglic Sheep, kg ( x ± s x ) n Fleece weight Ram 9 3,5±0,27 Ewe 133 2,1±0,04 General 142 2,2±0,05 Year 2010 DISCUSSION Daglic is a small and fat tailed sheep breed. With these characteristicsit was adapted to the steep and mountainous areasin Turkey. However these characteristics may not be desirable for today’s market conditions. It is now almost impossible to find pure Daglic flocks due to crossbreeding of Daglic with higher producing sheep breeds. Therefore it is ensured to continue the existence of pure Daglic flocks with this study and awareness of breeders was raised in order to keep this pure breed as long as possible. Despite birth rates of Daglic were high, their twining rate was low (5) compared to other breeds as it was expected. 3‐4% twining rate was rather low than that (31.25%) reported by M.Tekerli et al (5) in 2000. Daglic sheep has got high surviving abilityin arid lands with poor plant cover and under unfavourable conditions. In this study the values that were found in the first and second years are very close to each other and also to the ones those M. Tekerli et al. findings in 1999 and 2000. The twining rate for Daglic sheep is low as birth weight in comparison to other breeds. Accordingly, the development in lambs is slow and this affects the lamb sales negatively. In this study, despite the decreasing birth rates in the second year, there was an increase in liveweight at 90.days and 180.days. This may be because of the higher rainfall than average. It is clear that average mature live weight and body sizes are higher than those reported. This could be due to measurement method or according to breeder’s declaration. 15 years ago large body sized rams from different breeds were used in flock for two years but decrease in the lambs surviving ability lead to give up and return to the their own breed again. The fleece of Daglic sheep, which have rough and mix fleece characteristic, are used for weaving rug or carpet. Nowadays the usage of synthetic fibers instead of fleece cause decrease in the value of fleece of this breed. The value received from this study is relatively high than Togay C. et al. study about rams but it is low from the value that they found about ewes. It is thought that the reason for these differences could be because of the breeder who took the dirty fleece weights. Daglıc, The Hardy Sheep Of The Centralanatolianmountains Is Losing Its Altitude 353 Despite the anxiety of marketing in the area, the Daglic sheep breeders’ awareness should be raised not only with persuasion method but also using other methods in order to keep this breed’s existence which has the amazing characteristic of adaptation to the poor conditions. Also, it will be beneficial to increase the population of protection at the origin studies and provide progression. REFERENCES 1. Prof.Dr. Akçapınar H. ( Koyun yetiştiriciliği S.110, Ankara 2000 ) 2. Prof.Dr. Aytuğ C.N., Prof.Dr.Yalçın B.C., Prof.Dr. Alaçam E., Prof.Dr. Türker H., Prof.Dr. Gökçen H.,Dr. Özkoç Ü. ( Koyun‐Keçi Hastalıkları ve Yetiştiriciliği S.389, İstanbul 1990 ) 3. Prof.Dr. Kaymakçı M., Prof.Dr. Sönmez R. ( Koyun Yetiştiriciliği S.91, İstanbul 1992 ) 4. Togay C., Utkanlar N., İmeryüz F., Örkiz M. ( Çifteler Harası Dağlıç Koyunlarının Beden Ölçüleri ve Bazı Yapağı Özellikleri Üzerinde Araştırmalar ( Lalahan Zootekni Araştırma Enstitüsü Dergisi 1961 Sayı:10, S.54‐73 ) 5. Tekerli M.,Gündoğan M.,Akıncı Z.,Akcan A. ( Akkaraman,Dağlıç,Sakız ve İvesi Koyunlarının Afyon Koşullarındaki Verim Özelliklerinin Belirlenmesi. Lalahan Hayvancılık Araştırma Dergisi 2002,42(2)29‐32 ) CONSERVATION OF DENIZLI AND GERZE CHICKEN BREEDS Dr. Neval ÖZDOĞAN Lalahan Central Livestock Research Institue ‐Ankara Abstract The origin of Denizli Breed which is one of the local chicken breeds of Turkey is Denizli city and its territory. The comb type can be mostly single. The plumage colour on body is black in the female.The neck, shoulder, saddle, wings, breast and abdomen feather is black or specific colour in the males. According to these colour, the males are called as demir‐kır (grey and black), pamuk – kır (white and black), kefi sarı (dark yellow and black), al (dark red or brown and black), siyah (black). The males are famous with long crowing. Adult weight of males is 2090g, adult weight of females is 1820g. Egg production reaches to approximately 114 eggs in a year. The aim of breeding is egg production and also it may rear as a hobby. The breed has been conserved ex situ in vivo method in Lalahan Central Livestock Research Institute The origin of Gerze Breed is Gerze district in Sinop city province. The comb type is V shaped. The body is covered with black feather. The tail feathers of males seem in green‐black colour under the light. Adult weight of males is 1860g and adult weight of females is 1520 g. Egg production reaches approximately 88 eggs in a year. The aim of breeding is egg production and also it may rear as a hobby. The breed has been conserved ex situ in vivo method in Lalahan Central Livestock Research Institute. Key words: Denizli, Gerze, animal genetic resources, conservation A poultry conservation programme known as Denizli and Gerze conservation project was initiated at Lalahan Central Livestock Research Institue by Turkısh Republic of Ministry of Agriculture and Rural Affairs in 1997 .Aim of the project is to ensure Denizli and Gerze conservation flocks according to a well defined concept by FAO and to increase the knowledge about these breeds. Method The conservation method is ex situ in vivo and the breeding plan is based on random breeding flock. The conservations flocks are not subjected to artificial or natural selection.Minimum 100 females and 100 males are used to generate next generation. Generation interval is 2 years on average. Characteristics of the chicken breeds Denizli Gerze External features, Comb‐‐‐‐‐‐‐ Single (mostly) V shaped Eyes‐‐‐‐‐‐ medium and bolted medium Ear lobes‐‐‐ red or lightly whiteness on them. white th 356 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Noses‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ Feathers‐‐‐‐‐‐‐‐‐‐‐‐ Shank colour‐‐‐‐‐‐‐‐‐ small black in female grey and black (demir‐kır), white and black (pamuk – kır), dark yellow and black ( kefi sarı dark red or brown and black ( al ) gray prominent glossy black in both of females and males, tail feathers green‐black shine in the male black (siyah) in male gray Size‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ medium medium Egg colour‐‐‐‐‐‐‐‐‐‐‐ white white Behaviour‐‐‐‐‐‐‐‐‐‐‐‐‐‐a ggressive ,the males are famous on long crowing sensitive General characteristics, Egg productivity, Egg production (number)‐‐‐‐ 114 Egg weight(g)‐‐‐‐‐‐‐‐‐ 54 Body weight, Hatch weight(g)‐‐‐‐‐‐‐‐‐‐ Adult weights of male(g)‐‐‐ 38 2090 Adult weights of female (g)‐‐ 1820 88 50 36 1860 1520 CONSERVATION OF NATIVE ÇINE ÇAPARI SHEEP BREED AS GENETIC RESOURCE O. KARACA1, O. YILMAZ1 and İ. CEMAL1* 1 Department of Animal of Sciences, Faculty of Agriculture, Adnan Menderes University, Aydın, Türkiye * Corresponding author: cemal_i@yahoo.com Abstract Çine Çaparı is a local fat‐tailed native sheep breed originating in mountains (especially in mountain Madran) of Aydın province of Turkey. In the last two to three decades, the number of purebred Çine Çaparı sheep has very declined due to backcrossing of breed with rams of Kıvırcık and prolific Sakız (Chios) breeds. Consequently, this process were put them in danger of extinction. A conservation program termed as “Adnan Menderes University – Çine Çaparı Conservation Program (ADÜ‐ÇÇKP)” was established in 1996 to characterize and conserve this endangered breed. Studies for establishing a conservation flock at Adnan Menderes University were also initiated in same year. In mountainous villages only two flock including purebred animals were remained. Members of all other flocks were turned to a synthetic form, namely Karya. The main reasons for breeders to keeping this breed are the easiness of management, its resistance to diseases and high temperatures. In this paper, studies performed until today on characterization and conservation of Çine Çaparı sheep were briefly summarized. Key Words: Sheep, Çine Çaparı, genetic resources, conservation. Introduction Agricultural biodiversity includes the diversity of the cultivated plants and domestic animals utilized by humankind for the production of food and other goods and services. The livestock species (over 40 species) contributing to today’s agriculture and food production are shaped by a long history of domestication and development. The term animal genetic resources (AnGR) is used to include all animal species, breeds and strains (and their wild relatives) that are of economic, scientific and cultural interest to humankind in terms of food and agricultural production for the present or in the future (Rege and Gibson, 2003; FAO, 2007, Ertuğrul et al, 2005). With the introduction of industrial farm production systems bio‐diversity is vanishing at rapid rate (a rate 50‐100 times higher than the losses expected through natural processes). Every year about 34000 plant and 5200 animal species were extinct. Non‐adoption of breeding plan and unrestricted interbreeding among different breeds, growing trend of global reliance on a limited number of selected breeds, degradation of ecosystems, consumer request, diseases and natural disasters are among the major reasons for extinction of farm animal genetic resources (Ertuğrul et al, 2005). Sheep in Turkey’s animal husbandry have a great genetic potential together with high numbers and with wide breed and local type diversity which formed according to different ecological conditions. The large genetic change observed in sheep populations at Western Anatolia with the intensifying of agriculture were threaten the existence of native Turkish sheep breeds in last decades (Karaca and Cemal, 1998). In the short period of time of last two to three decades, some breeds have gone extinct (Ödemiş breed) or endangered (Dağlıç, Çine Çaparı, Sakız, Kıvırcık breeds). th 358 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) In this paper, studies on characterization and conservation of endangered native Çine Çaparı sheep breed were briefly summarized. General Characteristics of Çine Çaparı Breed This fat‐tailed sheep breed was originated from mountainous regions of Aydın Province that belong to Aegean region of Turkey (Western Anatolia). This breed was also called as Madran sheep because the main raising origin is mountain Madran that separates the two districts of Aydın Province, Çine and Bozdoğan. The Çine Çaparı sheep are well adapted to local environmental conditions that can be defined as extensive. They are carpet wool type and are resistant to diseases.The animals are white and sometimes have from light brown to dark black spots on the feet and stomach. While males have spiral horn, females have no horn. This is a calm breed and flock management is also very easy (Karaca et al, 1999). Photographs of Çine Çaparı ram and ewe are given in Figure 1. Figure 1. Çine Çaparı Ram and Ewe Current Situation of the Breed Çine Çaparı is a common sheep breed in Aydin till 1980’s. In the last 20 to 30 years, the number of purebred Çine Çaparı sheep has very declined due to backcrossing of breed with rams of Kıvırcık and prolific Sakız (Chios) breeds. Consequently, this process were put them in danger of extinction. Efforts for establishing a conservation flock at Adnan Menderes University were started in 1996 for characterization and conservation of this endangered breed. A conservation program termed as “Adnan Menderes University – Çine Çaparı Conservation Program (ADÜ‐ ÇÇKP)” was formed in 1996 to determine characteristics of breed and to start conservation activities. Afterwards, a conservation flock of Çine Çaparı was established at Adnan Menderes University with animals purchased from several private breeders’ flocks. Currently, in mountainous villages (Tatarmemişler and Dereköy) only two flock which in turn have 49 and 67 mature sheep were remained. Members of other sheep flocks were turned to a synthetic form, namely Karya, due to intense backcrossing efforts of breeders using Kıvırcık and Sakız (Chios) breeds to create a thin‐tailed synthetic sheep form. Animal numbers and photographs of the remained two flocks and the conservation flock established Adnan Menderes University are given in Figure 2. The risk of extinction of these two private breeders’ flocks is high due to insufficient incomes of breeders.The main reasons for the existed two breeders to keeping this breed are the easiness of flock management and resistance of the breed to diseases and high temperatures. Conservation Of Native Çine Çaparı Sheep Breed As Genetic Resource 359 Figure 2. Situation of Çine Çaparı Sheep Flocks Efforts to Define and Conserve Genetic Diversity within Breed The first research studies to define morphological and performance characteristics of the breed were started in Adnan Menderes University in 1996. These two breeders’ flocks are controlled periodically by the researchers in Department of Animal Sciences, Faculty of Agriculture, Adnan Menderes University, Aydın. Performance data for some traits and pedigree information are recorded and mating plans were applied in established conservation flock and in remained two breeders’ flocks to minimize inbreeding (Karaca et al, 1999a,b; Karaca et al, 2004). Some molecular genetics researches (Binbaş and Cemal, 2007; Erdoğan, 2010; Cemal et al., 2011) were done to define genetic diversity within breed. A ram exchange program among existed flocks was also realized to minimize inbreeding. Some of the applications performed by researchers at breeders and ADÜ‐ÇÇKP conservation flocks are summarized in Table 1. Table 1. Applications performed in breeders’ and ADÜ‐ÇÇKP Conservation Flocks Applications Breeders’ ADÜ‐ÇÇKP Flock Conservation Flock Performance data recording + + Pedigree information recording + + Mating planning to minimize inbreeding + + Change of rams between flocks + + Estrus synchronization and hand mating ‐ + Laparoscopic or cervical insemination ‐ + th 360 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) A financial support program for breeders of endangered livestock breeds including Çine Çaparı sheep was started in 2005 by the Turkish Ministry of Food, Agriculture and Husbandry. This agricultural support was motivated breeders to maintain their flocks. Çine Çaparı sheep breed was registered as a native sheep breed in 2008 by the “Registration Committee of Animal Breeds” that are belong to Ministry of Food, Agriculture and Husbandry in 2008. On the other hand, studies for ex situ in vitro conservation of Turkish livestock breeds were started within the “In Vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources‐I (TÜRKHAYGEN‐I)” project (http://www.turkhaygen.gov.tr/en/). The aim of the mentioned project is the genetic characterization of breeds of some animal species (cattle, water buffalo, sheep, goat and horse) and establishment of banks from DNA and viable cells (gametes, embryos, somatic cells and tissue samples) through cryopreservation. Genetic material from Çine Çaparı sheep breed will also be stored in this bank. Morphological and Yield Characteristics of the Çine Çaparı Many research studies are being conducted for the characterization and conservation of endangered Çine Çaparı sheep by the research team in Adnan Menderes University, Aydın. Results from some studies were briefly summarized as follow: The average daily milk yield, lactation length and lactation milk yield of Çine Çaparı ewes (n=20) were reported by Karaca et al. (1999a) as 333±22.2 ml, 146±8.5 day and 47.694±2.571 liter, respectively. In same study, mean weights of lambs (n=23) at birth, 2.5 and 5 months age were found as 3.80, 14.30 and 20.89 kg, respectively. Means estimated for body weights and some body measurements of ewes are also determined (Table 2). Table 2. Body measurements characteristics in Çine Çaparı sheep Traits N Mean±SE Body Weight (kg) 62 38.06±1.097 Height at withers (cm) 62 63.63±0.553 Height at rump (cm) 62 65.29±0.574 Body length (cm) 62 61.17±0.556 Chest width (cm) 62 29.62±0.387 Front chest width (cm) 62 18.13±0.271 Chest girth (cm) 62 81.06±0.946 Length of Head (cm) 62 18.98±0.446 Forehead width (cm) 62 10.43±0.128 Tail Length (cm) 62 35.97±0.884 Tail width (cm) 62 24.53±0.893 Conservation Of Native Çine Çaparı Sheep Breed As Genetic Resource 361 In an another study (Erdoğan, 2010), least square means for average daily milk yield, lactation length and lactation milk yield of Çine Çaparı ewes (n=40) reported as 0.521 kg, 159.5 day and 81.78 kg, respectively. In a study implemented by Karaca et al. (1999b) that Çine Çaparı lambs (n=11) fed with concentrate feed for a period of 63 day and lambs were slaughtered at the end of fattening period, means for live weights at the beginning, final weights, average daily gain, cold carcass weight and dressing percentage were reported as 25.4 kg, 38.7 kg, 211.4 g, 19.0 kg, 48.8%, respectively. Estimated means reported by Karaca et al. (2000) for litter size and ovulation rate of Çine Çaparı ewes along with repeatability of litter size are summarized in Table 3. Table 3. Reproductive performances of Çine Çaparı ewes Traits Mean±SE Litter size (n=143) 1.07±0.023 Ovulation rate (n=22) 1.23±0.123 Repeatability of litter size (136 records of 34 ewes) 0.04 Simple statistics for some semen characteristics of Çine Çaparı rams reported by the Yılmaz et al. (2009) were given in Table 4. Table 4. Simple statistics for some semen characteristics of Çine Çaparı rams Variable N Mean Std. Dev. Semen volume (cm ) 43 0.87 0.36 0.50 1.50 41.2 Mass motility 43 4.33 0.78 3.00 5.00 18.0 43 5.20 2.94 1.25 12.00 56.5 Semen concentration (x10 /mm ) 43 1.67 0.23 1.26 2.16 13.6 Total number of spermatozoa per ejaculate (x109/ejaculate volume) 43 1.44 0.61 0.63 2.81 42.3 3 Percentage of dead sperm cells (%) 6 3 Min Max CV (%) CV: Coefficient of variation Laparoscopic artificial insemination technique was firstly used by the Karaca et al. (2009) for testing its success in endangered Çine Çaparı sheep breed under conservation. The use of this technique is very important for controlling mating to construct pedigree data. The insemination success obtained as 69.57% and 63.04% in 2003‐2004 and 2008‐2009 lambing periods, respectively. Simple statistics obtained from pooled data of two breeding season for reproductive parameters of laparoscopically inseminated Çine Çaparı ewes were summarized in Table 5 (Karaca et al., 2009). th 362 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 5. Simple statistics of reproductive parameters for laparoscopically inseminated Çine Çaparı ewes Parameters N Mean Std. Dev. Min Max CV (%) Gestation length (day) 43 149.23 2.20 143.00 153.00 1.5 DBSR‐BOA(h) 67 40.49 9.47 16.16 58.55 23.4 DBBOA‐LAI(h) 67 19.59 8.22 3.59 40.44 42.0 AI success rate (%) 69 65.21 47.98 0.00 100.00 73.6 CV: Coefficient of variation DBSR‐BOA(h): Duration between sponge removal and beginning of aestrus (h) DBBOA‐LAI(h): Duration between beginning of aestrus activity and laparoscopic AI (h) Inbreeding coefficients and genetic relationships estimates reported by Karaca et al. (2004) for pedigree data recorded between 1995‐2003 years from animals in ADÜ‐ÇÇKP Conservation Flock are summarized in Table 6. The observed low mean values for inbreeding coefficients and genetic relationships are good indicator of efforts revealed in ADÜ‐ÇÇKP to conserving genetic diversity within breed. Table 6. Mean inbreeding coefficients (FX) and genetic relationships (RXY) for ADÜ‐ÇÇKP Conservation Flock members (18 ♂ + 98 ♀,) FX RXY Between males 0.0000 0.0580 Between males and females ‐ 0.0224 Between females 0.0013 0.0150 Between all the animals 0.0011 0,1790 The wool yield and wool characteristics of Çine Çaparı were investigated by Altın et al. (1999). In the mentioned study, least squares means obtained for Çine Çaparı sheep were 35.6 kg for body weight at shearing, 1.18 kg for greasy wool weight, 72.75% for clean fleece percentage, 8.73 cm for staple length, 13.41 cm for fiber length, 11.51% for coefficient of variation of fiber length, 82.18% for true fiber percentage, 12.79% for medullated fiber percentage, 2.72% for heterotypic fiber percentage, 2.30% for kemp fiber percentage, 79.46% for 1 minute resilience and 87.20% for 5 minute resilience. Molecular Genetic Researches on Çine Çaparı Sheep Random Amplified Polymorphic DNA (RAPD) markers (24 arbitrary primers) was used by Binbaş and Cemal (2007) to determine within breed genetic diversity in endangered Çine Çaparı sheep. Genetic similarities and distances among animals within flock and between three flocks (a total sample of 72 animals) were also obtained. In the study in question, genetic similarities between individuals within flock were ranged between 0.4468 and 0.8511 for ADÜ‐ÇÇKP conservation flock, 0.4894 and 0.8723 for Erdoğan Aktürk’s (EA) flock, and 0.5745 and 0.8723 for Mustafa Vural’s (MV) flock, respectively. Genetic distances were ranged between 0.1613 and 0.8056 for ADÜ‐ÇÇKP flock, 0.1366 and 0.7147 for the EA flock, and 0.1366 and 0.5543 for the MV flock. The similarities between flocks were ranged from 0.8439 to 0.9037 and, genetic distances were ranged from 0.0902 to 0.1698. Dendogram given in Figure 3 was formed by Binbaş and Cemal (2007) according to genetic distances between all individuals in three flocks. Majority of individuals belonging to each flock was gathered together in the dendogram. This is particularly more pronounced for flock of MV. Similarly, individuals of EA and ADÜ‐ÇÇKP Conservation Flocks clustered separately. These results indicate that genetic similarities within each flocks was more than similarities between flocks. ADU AD U2 EA AD U1 7 AD U0 1 AD U0 4 AD U1 4 AD U03 31 EA 15 EA 18 0.05 0 27 EA2 6 363 EA ADU10 EA25 ADU18 05 ADU 2 U0 AD 9 U1 AD 8 U0 AD 3 U1 AD 22 U AD EA05 Conservation Of Native Çine Çaparı Sheep Breed As Genetic Resource EA 24 32 EA 6 U1 AD 07 EA EA EA 1 15 ADU0 30 4 EA0 4 9 EA28 E A0 8 EA23 EA06 EA10 ADU25 EA01 ADU24 ADU2 ADU E A 02 3 EA 0 21 EA1 6 EA 3 EA 0 9 EA 13 MV 0 2 U1 AD 21 EA MV 0 M V0 6 U2 AD 17 EA 2 EA1 EA 29 1 13 MV 5 MV0 ADU11 EA20 ADU06 MV03 MV04 MV08 MV1 4 EA 22 AD U0 7 EA 19 6 7 0 V1 M 11 MV 02 MV 12 MV M V0 9 11 ADU: ADÜ‐ÇÇKP Conservation Flock, EA: Erdoğan Aktürk’s flock, MV: Mustafa Vural’s flock Figure 3. Dendogram of genetic distances between all individuals in three Çine Çaparı sheep flocks In the study reported by Cemal et al. (2011), DNA samples of 123 animals from existed 3 flocks were genotyped with 10 microsatellite markers to determine genetic diversity in endangered Çine Çaparı sheep. The number of alleles observed per microsatellite marker ranged from 7 (OarCP34) to 17 (OarFCB193), with an average of 11.5 alleles per locus. Total number of alleles for the investigated 10 microsatellite markers was found as 104, 72 and 45 for ADÜ‐ÇÇKP, EA and MV flocks, respectively. The considerable differences for allele numbers in flocks indicate high genetic variability in ADÜ‐ÇÇKP flock versus the other two breeders’ flock, EA and MV. The observed allele numbers shows the existence of unique alleles for flocks. The means on expected heterozygosity (He) and observed heterozygosity (Ho) for the whole Çine Çaparı population under conservation were 0.727 and 0.789, respectively. The UPGMA dendrogram, based on genetic distance, showing the relationship among the existed Çine Çaparı sheep flocks are given in Figure 4. The highest genetic similarity (0.8262) was observed between ADÜ‐ÇÇKP conservation flock and Erdoğan Aktürk’s flock. The results obtained in the study in question will help to interpret the genetic structure of indigenous Çine Çaparı sheep and benefit to the future efforts for conservation of this breed. th 364 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 4. Dendrogram of genetic distances between three Çine Çaparı flocks The genetic polymorphism for β‐Lactoglobulin (β‐LGB) gene in Çine Çaparı sheep population was investigated by Erdoğan (2010) using PCR‐RFLP method in 128 animals from all conservation population that comprising three flocks. Only A and B alleles of β‐LGB gene were reported, but none of the animals have C allele. The observed frequencies for AA, AB and BB genotypes estimated as 0.078, 0.453 and 0.469, respectively. The allele frequencies reported as 0.3047 and 0.6953 for A and B alleles, respectively. Conclusion The genetic variation in animals has been occurred in a very long evolutionary process. With the process of domestication, some animal species separated into distinct reproductive groups within its geographical range. Over many generations the reproductively isolated groups begin to diverge as a result of artificial or natural selection. Turkey has an important position for domestication being as a part of Fertile Crescent. Therefore, native breeds of sheep, goat and cattle have an important level of diversity. We have a chance that majority of alleles are not fixed in the Turkish sheep breeds because these breeds are not exposed to intense selection efforts. Up to date many of the livestock breeds have become extinct or have declined to numbers which put them in danger of extinction due to genetic changes directed to production. Transferring the genetic diversity within breeds to the future have great important from cultural, scientific and economical aspects. In Turkey’s animal husbandry, sheep have a great genetic potential together with high numbers and, wide breed and local type diversity which formed according to different ecological conditions. In recent years, the large genetic change observed in sheep populations at Western Anatolia with the quite intensifying of agriculture were threaten the existence of native breeds. The most frequent causes of genetic change stems from the crossing of such breeds with other, more popular, genotypes. Although the tendency towards intensive production in western Anatolia, a large part of the country suitable for extensive production. The traditional extensive production systems are still a common practice for the breeders at the various parts of the country. Therefore, native breeds like Çine Çaparı are very important for farmers of extensive breeding system. Studies for the characterization and conservation of indigenous breeds in Turkey in last decade are encouraging. Efforts given for characterization and conservation of Çine Çaparı sheep breed are a good example of conservation activities. The trend of decrease in the animal number was changed to trend of increase with efforts of researchers at Adnan Menderes University and supports of Minisry of Food, Agriculture and Animal Husbandry. The ongoing studies have stopped the process of extinction of breed and guaranteed the future of the breed. Conservation Of Native Çine Çaparı Sheep Breed As Genetic Resource 365 REFERENCES Altın, T., Karaca, O., Cemal, İ., Atay, O. (1999) Çine Çaparı ve Çine Tipi (yöresel sentetik) koyunların yapağı verimi ve özellikleri [The Wool Yield and Wool Characteristics of Çine Çaparı and Çine Type (Regional Synthetic) Sheep]. Uluslararası Hayvancılık’99 Kongresi, s.760‐765, 21‐24 Eylül 1999, Ege Üniversitesi Ziraat Fakültesi, İzmir. Binbaş, P., Cemal, İ. (2007) Yerli Gen Kaynağı Çine Çaparı Koyunlarda Genetik Çeşitliliğin RAPD Belirteçleri ile Belirlenmesi [Detection of Genetic Diversity in Indigenous Çine Çaparı Sheep by RAPD Markers]. 5. Ulusal Zootekni Bilim Kongresi, Poster Bildiri, 5‐8 Eylül 2007, Yüzüncü Yıl Üniversitesi, Van. Cemal, İ., Karaca, O., Yılmaz, O., Binbaş, P. (2011) Yerli Gen Kaynağı Çine Çaparı Koyunlarda Genetik Çeşitliliğin Mikrosatellit Gen Belirteçleri ile Tanımlanması [Identification of Genetic Diversity in Indigenous Çine Çaparı Sheep Breed with Microsatellite Markers]. ZRF‐07030 nolu Proje Bitirme Raporu, Adnan Menderes Üniversitesi, Bilimsel Araştırma Projeleri (BAP). Erdoğan, F. (2010) Yerli Gen Kaynağı Çine Çaparı Koyunların Süt Verim Özellikleri ve β‐Laktoglobulin Gen Polimorfizmi [Milk Yield Characteristics and Β‐Lactoglobulin Gene Polymorphism in Indigenous Çine Çaparı Sheep]. M.S. Thesis. xi+50 pages. Adnan Menderes Üniversitesi, Fen Bilimleri Enstitüsü, Aydın (Supervisor: Dr. İbrahim Cemal). Ertuğrul, M., Dellal, G., Elmacı, C., Akın, O., Karaca, O., Altın, T., Cemal, İ. (2005) Hayvansal Gen Kaynaklarının Koruma ve Kullanımı [Conservation and Use of Animal Genetic Resources]. Türkiye Ziraat Mühendisliği VI. Teknik Kongresi, 3‐7 Mart 2005, Ankara. FAO (2007) The State of the World’s Animal Genetic Resources for Food and Agriculture, edited by Barbara Rischkowsky & Dafydd Pilling. Rome. Karaca, O., Cemal, İ. (1998) Batı Anadolu koyunculuğunda genetik kaynakların korunma ve kullanımı [Conservation and Use of Sheep Genetic Resources in Western Anatolia]. Ege Bölgesi 1.Tarım Kongresi, s.573‐582, 7‐11 Eylül 1998, ADÜ Ziraat Fakültesi, Aydın. Karaca, O., Çetiner, Ş., Cemal, İ. (1999a) Çine Çaparı koyunların kimi özellikleri ve genetik kaynak olarak korunması olanakları [Some Characteristics and Conservation Possibilities of Çine Çaparı Sheep Breed as Genetic Resource]. Uluslararası Hayvancılık’99 Kongresi, s.558‐563, 21‐24 Eylül 1999, Ege Üniversitesi Ziraat Fakültesi, İzmir. Karaca, O., Cemal, İ., Atay, O. (1999b) Çine Çaparı, Çine Tipi ve Menemen X Çine Tipi (F1) Kuzularda Kimi Besi ve Kesim Özellikleri [Some Fattening and Slaughter Characteristics of Çine Çaparı, Çine Type and Menemen x Çine Type (F1) Lambs]. Uluslararası Hayvancılık’99 Kongresi, s.766‐770, 21‐24 Eylül 1999, Ege Üniversitesi Ziraat Fakültesi, İzmir. Karaca, O., Cemal, İ. (2000) Ovulation rate of some sheep genotypes under extensive management system in Aydin region. Book of Abstracts of the 51st Annual Meeting of the European Association of Animal Production, p.309, The Hague, The Netherlands. Karaca, O., Cemal, İ., Altın, T. (2004) Yerli Çine Çaparı Koyun Irkının Genetik Kaynak Olarak Korunması Çalışmaları [Studies on the Conservation of Native Çine Çaparı Sheep Breed as Genetic Resource]. 4. Ulusal Zootekni Bilim Kongresi, 01‐03 Eylül 2004, Süleyman Demirel Üniversitesi, Isparta, Cilt 1 (Sözlü Bildiriler), s.33‐38. Karaca, O., Cemal, I., Yilmaz, O., Yilmaz, M. (2009) Effect of Laparoscopic Insemination on Reproductive Performance of Indigenous Çine Çaparı Sheep. International Scientific Conference (BALNIMALCON‐ 2009): Challenges of the Balkan Animal Industry and the Role of Science and Cooperation. May 14‐16, 2009. Trakia University, Stara Zagora, Bulgaria. Rege, J.E.O. and Gibson, J.P. (2003) Animal genetic resources and economic development: issues in relation to economic valuation. Ecological Economics, 45: 319‐ 330. Yilmaz, O., Karaca, O., Cemal, I., Yilmaz, M. (2009) Semen Characteristics of Karya and Çine Çapari Sheep at Mating Season. International Scientific Conference (BALNIMALCON‐2009): Challenges of the Balkan Animal Industry and the Role of Science and Cooperation. May 14‐16, 2009. Trakia University, Stara Zagora, Bulgaria. CHANGES OF THE HORSE BREEDING IN THE LAST CENTURY IN TURKEY Özlem GÜCÜYENER HACAN1, Halil AKÇAPINAR2 1 Afyon Kocatepe University, Faculty of Veterinary, Department of Animal Science, Afyon 2 Ankara University, Faculty of Veterinary, Department of Animal Science, Ankara Abstract After domestication, horses have been used for different purposes for humanity. In the history of the Turks, it has been known to the horses have a prominent place. Equestrian sports and horse racing have always been given great importance by Turks. Over time, through the mechanization in agriculture, transportation and military, horses have lost the importance in these areas, but continue to be used racing and sports purposes. Therefore, the number of horses declined, in consequence of the decreasing in the usage of horses. In this study, horse breeding and crossbreeding studies in the state farms of Turkey in the last century have been summarized. Key Words: Crossbreeding studies, horse breeding, horse number, native breeds, state farms. Introduction The horse is reported to have been domesticated in Central Asia in the 3rd millennium BC (1, 7, 16). Once it had been domesticated, the horse was used for meat, milk and as a mount. Over time, it began to be used as a vehicle for transportation, agriculture, service and war, and it has served mankind for centuries. When motorized vehicles began to be used in agriculture and the military as a result of industrial development, the importance of the horse in these areas declined. However, it has grown increasingly important in racing and sports (5, 11, 14). Fluctuations in the Horse Population In 1909, there were approximately 855,000 horses in Turkey, but wars led to a steady decline due to factors such as the loss of a significant number of breeding stock and adverse economic conditions, as well as insufficient and disorganized breeding programs. By the 1930s, this number had fallen to 490,000 (3). With the operation of stud farms and stallion depots, the number of horses increased reaching 1,312,000 in 1961. However, due to the widespread use of machinery in agriculture, transportation and the military, changing national conditions and needs which meant reduced dependence on horses, the horse population once again began to decline, and by 2009, there were only 179,855 horses in the country (3). A graph of the fluctuations in the horse population in Turkey over the years is provided in Figure 1 (3, 6, 14, 15, 16). th 368 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 1. Graph of fluctuations in the horse population in Turkey by year Changes in Breeding Interest in horse breeding waned when machinery was became widely used in agriculture and transportation (1950s) and the cavalry units were dissolved with the creation of motorized forces in the military (1959). As a result, there was a transition from breeding draft horses and riding horses for use in agriculture, transportation and the military to breeding horses for racing and sports. In addition to amble racing and the game of jerid, in recent years, there have been developments in jump racing, horse training, three‐day races and horse endurance races (11, 14). The growing importance of horse racing has led to significant development in the breeding of Arabians and Thoroughbreds. Turkey is a leader in terms of countries that use Arabian horses as a race horse. Until recently, horse breeding took place at seven stud farms (Karacabey, Çifteler (Anadolu), Sultansuyu, Konya, Karaköy, Çukurova and Altındere), which were later converted to Agricultural Enterprises. Now, Arabian horses are bred at the Karacabey, Anadolu and Sultansuyu enterprises and at many private stud farms. The breeding of Thoroughbreds, however, only takes place at private stud farms (5, 14, 15, 17). Imported Breeds and Cross Breeding Efforts The need for breeding stock in the breeding program that was launched scientifically in 1924 was met with local acquisitions (Arabian stallions and mares brought from Şanlıurfa and its environs), the breeding stock that remained from the palace, and Arabians imported from Irak (1930), Syria (1932) and Lebanon (1936) (2, 8, 9, 12). In addition, Nonius horses were brought to the Karacabey stud farm from Hungary (1923), Haflingers from Austria (1961) and Thoroughbreds from England (1928, 1973) for breeding and cross‐breeding (5, 14, 17). The cross between Nonius stallions brought from Hungary (1923) and domestic mares resulted in the Karacabey Nonius while the cross between Arabian stallions acquired from the region of Urfa (1924) and domestic mares resulted in the Karacabey Halfbred Arabian. The cross between Haflinger stallions brought from Austria (1961) and domestic mares led to the development of the Karacabey Halfbred Haflinger. Furthermore, Percheron, Hannover and Anglo‐Norman breeds were imported and used for insemination to develop heavy draft (for agriculture), light draft (for carriages) and riding animals. With the advent of machinery in agriculture and the military, the Nonius and Haflinger breeding program was eventually phased out (4, 10, 17). Changes Of The Horse Breedıng In The Last Century In Turkey 369 Discussion Over time, different breeds of horses were introduced for different purposes depending on changing national conditions and needs and cross‐breeding programs were developed. Some of these were popular with the people and continue to be bred, while others were gradually phased out. The absence of regular record‐keeping and the cross‐breeding has made it difficult to find pure blooded domestic horses. The influence of Arabian, Persian, Thracian, Russian, Circassian, Hungarian and Mongolian horses are most evident in domestic horses (4, 5, 14, 15). For these reasons, domestic horse breeds fall into certain classifications, according to which horse are identified as domestic Anatolian, Uzunyayla, Malakan, Ponies and other regional types. The protection of domestic horse breeds which are resistant to disease and adapted to environmental conditions is critical both in terms of the gene pool and cultural diversity (13, 14). REFERENCES 1) AKÇAPINAR, H., ÖZBEYAZ, C. (1999). Hayvan Yetiştiriciliği Temel Bilgileri. Kariyer Matbaacılık Ltd. Şti. ISBN: 975 ‐ 96978 ‐ 0 ‐7. 2) AKÇAPINAR, H., ÖZBEYAZ, C., ÜNAL, N. (2010). Ankara Üniversitesi Veteriner Fakültesi Zootekni A. B. D. Görüş Yazısı (Tarım ve Köyişleri Bakanlığı Yüksek Komiserler Kurulu’na). 3) ANONYMOUS. (2010). Statistical databases. Access Address: [http://www.fao.org]. Date of Access: 30.08.2010 4) ARITÜRK, E. (1957). Karacabey Yarımkan Arap Atlarının Beden Ölçüleri ve Formları Üstünde Araştırmalar. Ankara Üniversitesi Veteriner Fakültesi Dergisi., 5 (3‐4): 145‐166. 5) ARPACIK, R. (1999). At Yetiştiriciliği. Şahin Matbaası. ISBN: 975 – 95817‐2‐8. 6) BATU, S. (1939). Karacabey Yarımkan Araplarının Beden Ölçüleri Üstünde Araştırmalar. Yüksek Ziraat Enstitüsü Çalışmalarından, Sayı: 91, Ankara. 7) BİLGEMRE, K. (1949). Özel Zootekni II, At Yetiştirmek. Ankara Üniversitesi Ziraat Fakültesi Yayınları. No: 9. 8) ÇELEBİ, M. (1990). Türkiye’de Arap Atlarının Yetiştirilmesi. 21st Asian Racing Conference. 1‐8 July, İstanbul. 9) ÇELEBİ, M. (1995). Türkiye’de Arap Atı Yetiştiriciliği. Türk Kültüründe At ve Çağdaş Atçılık. Naskali G E. Türkiye Jokey Kulübü Yayınları. Resim Matbaacılık, İstanbul. 10) DÜZGÜNEŞ, O. (1953). Türkiye Hayvan Yetiştirme Müesseselerinde Saf ve Yarımkan Arap Atlarının Yetiştirme, Vücut Yapılışı ve Verimleri ile Bunların Birbirleri ile Mukayeseleri. Ankara Üniversitesi Ziraat Fakültesi Yayınları: 38, Ankara. 11) KÖSTEM, R. (2000). Tarihsel Sürecinde Atçılığımızın Yapısı ve Yarışçılığımızın Oluşumu. Türkiye Jokey Kulübü Yayınları. Veliefendi Hipodromu. 34730 Bakırköy İstanbul. 12) KUTLUCA, A. (1992). Anadolu Tarım İşletmesinde Arap Atı Yetiştiriciliğinin Dünü, Bugünü, Yarını, Seminer. Ankara Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı, Ankara. 13) ÖZBEYAZ, C., ERBAŞ, S., YAKAN, A. (2005). Türkiye Yerli At Irkları ve Korunması. Ulusal Atçılık Sempozyumu. 18‐20 Eylül, Ankara. 14) ÖZBEYAZ, C., AKÇAPINAR, H. (2006). At Yetiştiriciliği Ders Notları. Ankara Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı, Ankara. 15) SAİD, Z. (1940). Türkiye’de Atçılığın Ehemmiyeti ve Araştırma Mevzuu. Ankara Yüksek Ziraat Enstitüsü Çalışmalarından. Sayı:62, Ankara. 16) YARKIN, İ. (1962). Atçılık. Ankara Üniversitesi Ziraat Fakültesi Yayınları: 40, Ders Kitabı: 20. 17) YAŞAR, A. (1996). Osmanlı Döneminde ve Cumhuriyet Tarihinde Haralar. Ankara Üniversitesi Sağlık Bilimleri Enstitüsü Doktora Tezi, Ankara. GENETIC POLYMORPHISM OF β ‐ CASEIN (β–CN) IN IRAQI COW MILK Talib Ahmed Jaayid Animal Production Department, College of Agriculture, Basrah University, IRAQ Abstract This study was carried out at the Animal Farm, Hartha Research Station, College of Agriculture, Basrah University and several farms in Basrah Provence, Republic of Iraq. Fifty skim milk samples taken from cow were analyzed by polyacrylamide gel electrophoresis (PAGE) to detect the genetic polymorphism of β‐casein (β–CN) and gene distribution for this gene. In this study, we demonstrated that there was a genetic polymorphism in samples. Variations in electrophoretical pattern in the milk proteins have been observed. The bovine casein containing five fractions (αs1, αs2, β, κ and γ). Five genetic types of β–CN were revealed (А1А1, A2A2, ВВ, A1A2 and А1В) in cow casein caused by three alleles of that locus (A1, A2 and B). These fractions are controlled by codominant autosomal genes according to the Mendelian laws of inheritance. Differences in gene frequencies between alleles were observed. Key words: Iraqi Cow, Genetic Polymorphism, β‐Casein, Biodiversity Introduction In ruminants’ milk there are 6 major milk proteins types, which are coded by 6 non‐allelic genes specifically expressed in mammary epithelial cells during lactation: αS1‐casein (αs1‐CN), αS2‐ casein (αs2‐CN), β‐casein (β–CN), κ‐casein (K‐CN), β‐lactoglobulin (β ‐LG) and α‐lactoalbumin (α‐LA). The mutations occurring in these genes structure during the years, lead to the appearance of many alleles in these loci. These variations, named generically polymorphisms, are caused by genes restructuration (substitution of a nucleotide with another, deletions, insertions etc), which can have as effects: modification of genes expression levels, inactivation of genes expression and modification in amino acid sequence of the proteins codified by these genes (Khaertdinov, 1989). Can be defined the genetic polymorphism from the biological concept: The occurrence of different forms, stages, or types in individual organisms or in organisms of the same species, independent of sexual variations. Chemical concept: Crystallization of a compound in at least two distinct forms. Polymorphic differences occur on the amino acid level allowing singular peptide polymorphism to be Detected and utilized as a polymorphic biochemical marker. There are three types of markers: Morphological Markers, Biochemical Markers and Molecular Markers (Wetermeier, 1993; Winfrey, 1997; Chawla, 2000). Studies on milk protein polymorphism have been developed with various different finalities; to point out milk protein chemical evolution and find some eventual similarity with other proteins; to verify relationships between different species or breeds; to monitor variations that happen in the time or in the space for a particular animal population; to understand, and this is the most important aim, the biological significance of genetic variants (Russo and Mariani 1978). One of the most important milk proteins related to the technological properties of milk are β‐ CN. β–CN molecule consists of a single polypeptide chain, which contains 209 amino acids residues, having a molecular weight of 23982 kDa (Creamer and Richardson, 1975). Electrophoresis in starch and polyacrylamide gels revealed the existence of molecular forms of β ‐ casein, which differ in amino acid composition and electrophoretic mobility, which are designated as A1, A2, A3, B, C, D and E (Peterson and Kopfler, 1966; Aschaffenburg, 1968). It is now 14 genetic variants were identified so far: A1, A2, A3, B, C, D, E, A3m, B2, A4, H, F, A5 and G (Mashurov, 1980; Farrell et al., 2004). The th 372 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) presence of cows in the genotype B‐allele β‐CN has an impact on improving the technological properties of milk (Rampilli, et al., 1988; Jakob, 1994; Jakob and Puhan, 1994; Tong et al., 1994). The absolute content of β ‐ casein in milk is 0.7 ‐ 1.0 g/100 ml (McLean et al., 1984; Ng‐Kwai‐Hang, 1984; Khaertdinov, 1992; Afanasyev, 1996; Khaertdinov and Jaayid, 2002). Many researchers studied genetic polymorphism and milk composition in the ruminants (Tepol, 1979; Khaertdinov and Gatullin, 2000), but in farm animals in Iraq, such as cows, sheep and goats, this issue has not been studied enough. Nowadays, some cientific studies on molecular genetics are done in Iraq. We already started on the native animals such as Buffalo (Jaayid et al., 2011), Sheep (Jaayid et al., 2011), fish (Jaayid and Aziz, 2009; Jaayid et al., 2011) and presently it is applied on cow because they represent a very important genetic resources for Iraqi agricultural‐economics, so that it is necessary to us study such these breeds by molecular genetics as there are many local breeds in Iraq and many foreign breeds were hybrid causing loses in the genetic materials and thus losing the biodiversity. Our study is to fill the gap in this important aspect and to enlighten on the genetic situation commencing of southern region. Materials and methods Preparation of casein Fifty Individual milk samples from hybrid and native cow were collected from Hartha Research Station, Basrah University and from private herds of the Basrah province. The milk collection period between 2‐3 months from the stage of lactation. To remove fat from the milk used refrigerated centrifuge (2150 rpm for 20 min.), Then separated casein in a centrifuge after making the pH of milk ْ for 30 minutes then up to 4.6 to 4.7 by adding several drops of acetic acid then incubating at 37◌C separated the whey from casein by centrifugate (2150 rpm for 15 min.). Separation of genetic variants of β‐Cn The variants of casein were separated by vertical polyacrylamide gel electrophoresis (PAGE) under acetic condition (pH=0.3) (Table 1) by the method of Khaertdinov (1989). This method used to separate the A allele of the β‐Cn to A1, A2 and A3. For it uses one buffer solution for gel solution and electrode buffer solution from formic acid and acetic acid, respectively, as in the table below. Because the acetic acid, gel polymerization it is difficult, to quickly this process, added 8 µl of a solution consisting of 0.1 ml (0.2 mM) of silver nitrate. The polymerization will get up to 15‐20 minutes. The genetic variants were identified by their electrophoretic mobility of cow’s milk as described by Khaertdinov (1989). Genetic Polymorphism OF β ‐ Casein (β–CN) in Iraqi Cow Milk 373 Table 1: System of gel for electrophoresis of casein at pH 3.0 System of gel Gel solution Separating Staking Component parts in solution 1 Formic acid 25 ml; Glacial acetic acid 86 ml; TEMED 6.25ml 1 part No 1 In 250 ml 8 ml solution 0.1, 0.2 N 0.1, 0.2 N AgNo2 2 Acrylamide 40.0 g; MBA 1.2 g Component of solution in mixture No 1 part No 2 2 part No 3 4 part No 3 No. Component parts in solution Component of solution in mixture pH 3.0, 10%, (small porou) Electrode buffer solution 4 Acrylamide 20.0 g; MBA 2 g 1 part No 1 In 100 ml 1 part No 4 2 part No 3 7.7% acetic acid Pools upper lower + ‐ 8 ml solution AgNo2 In 100 ml 3 PSA 1.67 g; Urea 9M In 250 ml Statistical analysis The alleles frequency in the β‐CN fractions were estimated by direct counting of the genotypes. Calculating the gene frequency loci studied conducting, genotypes based on the frequency, using the following formula: q = 2(x1x1) + (x1x2) + (x1x3)....... (x1xn) 2N Where q = frequency gene of x1, x1x1 = the number of homozygous animals for x1, x1x2 x1x3 = the number of heterozygous animals for х1, x1xn N= the total number of investigated animals. Theoretically, the expected distributions of genotypes were determined by the formula of Hardy‐Weinberg equilibrium: (p+q)2=p2+2pq+q2, Where p, q = alleles frequency, E = p2 N (for homozygote) E = 2pq (for heterozygote), where E ‐ theoretically expected number of animals of a given genotype. For system with more than two alleles, used a formula: th 374 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) (p + q + r) 2 = p2 + q2 + r2 +2 pq +2 pr +2 qr. Results and discussion The bovine casein containing five proteins (αs1, αs2, β, κ and γ). The vertical polyacrylamide gel electrophoresis under acetic condition (PAGE) allows for the simultaneous typing of several alleles at casein loci, as well as the detection of many genotypes for β‐CN. Analysis in the present work (Figure 1 and 2) revealed polymorphism for many caseins, also identified Five genetic types of β–CN were revealed (А1А1, A2A2, ВВ, A1A2 and А1В) in cow casein caused by three alleles of that locus (A1, A2 and B). These fractions are controlled by codominant autosomal genes according to the Mendelian laws of inheritance (Table 2). Differences in gene frequencies between alleles were observed. The gene frequencies of β‐CN were: A1: 0.39, A2: 0. 47 and B: 0.14. The predominant genotype was A2A2 (38%) then А1А1 and А1В (20%), respectively. The order of anodic mobility decreased from A to B as follows: A1>A2>B> By PAGE. The result 0f the present study revealed that alleles frequency distribution identified in β‐Cn gene correspond with that demonstrated by Bonvillani et al. (2000) and Basheer (2011). They found only two alleles (A and B), Perhaps because of the Acetic acid conditions, PAGE at pH 3.0 gave a good separation of the β‐CN (Khaertdinov, 1989), while This results are consistent with many studies in this direction by Mahe et al. (1999), they found A1, A2 and B alleles. Also Hanusova et al. (2010) and Miluchova et al. (2009) found two alleles (A1 and A2), while Thompson et al. (1964) found three alleles (A, B and C). In regards to the allele frequency of of this gene for European cattle, allele A1 and A2 are of the most allele spread in cows and also allele B is the most spread, too but in comparison with A1 and A2, B was low frequency, while the allele frequency of B in Normandy and Jersey breeds was higher (45‐ 30%) then Montbeliarde breeds and Italian Brown (10‐25%). Allele A3 was rare as it is found in some breeds while the remaining detected alleles of this gene were rare. (Mahe et al., 1999). Table 2. Distribution of Frequency of β‐CN genotypes and gene frequency in hybrid and native cow. Gene Β‐Cn Genotypes No. of animals Gene frequencies No. % A1 A2 B A1A1 10 20 0.39 0.47 0.14 A2A2 19 38 BB 2 4 A1A2 9 18 A 1B 10 20 Conclusion: the genetic analysis of main protein hybrid and native cow population in Iraq has been fulfilled for the first time. The genetic polymorphism of β‐CN has been found to be conditioned by three alleles A1, A2 and B. Through the above results it can be concluded that the β‐CN gene may constitute a genetically similar to that cow in the world and thus can take advantage of this mosaic in the number of alleles in the selection program and improvement of native cow and try to decipher the reasons for similarities and differences between domestic animals themselves and between them and foreign animals, especially close to the geographical area to the Iraq. Genetic Polymorphism OF β ‐ Casein (β–CN) in Iraqi Cow Milk 375 REFERENCES Afanasiev, M.P. 1996. Genetic structure, protein composition and technological properties of milk Kholmogory, Hungarian Holstein‐Friesian and their hybrids. Abstract. Dissertation, Candidate. Biol. Nauk., Kazan, P. 24. Aschaffenburg, R. 1968. Genetic variants of milk proteins: their breed distribution. J. Dairy. Res., 35: 447‐460. Basheer m, P. 2011. Genetic variations in milk components and the effect of milk protein genetic variant on heat stability. International Journal of Pharma and Bio Sciences. 2: 511‐520. Bonvillani, A.G, Di Renzo, M.A and Tiranti I, N. 2000. Genetic polymorphism of milk protein loci in Argentinian Holstein cattle. Genetics and Molecular Biology. Genet. Mol. Biol., 23. Chawla, H.S., 2000. Introduction to Plant Biotechnology; Science Publishers Inc, Enfield, USA. Creamer, L.K., Richardson, B.C. 1975. A new genetic variant of b‐casein. "New Zealand Journal of Dairy Science and Technology", 10, 170‐171. Farrell, H.M., Jimenez‐Flores R., Bleck, G.T, Brown, E. M., Butler, J. E, Creamer, L.K., Hicks, C.L., Hollar, C.M., Ng‐Kwai‐Hang, K.F., Swaisgood H.E., 2004. Nomenclature of the Proteins of Cows’ Milk‐Sixth Revision. J. Dairy Sci., 87:1641–1674. Hanusova, E., Huba, J., Oravcovám, M., Polák, P., Vrtková, I. 2010. Genetic Variants of Beta‐Casein in Holstein Dairy Cattle. in Slovakia. Slovak J. Anim. Sci., 43: 63–66. Jaayid, T.A. and Aziz. N.M. 2009. Study of transferrin polymorphism in a population of Carp (Cyprinus carpio) Marsh Bulletin 4(2)(2009) 162‐168. Jaayid, T.A., Yousief, M.Y Zaqeer, B.F. and Owaid, J.M. 2011. Genetic polymorphism of transferrin in Arabi sheep breed. Dayala international conference. 3‐4 April. In prese. Jaayid, T.A., Yousief, M.Y., Owaid, J.M. and Aziz, N.M. 2011. A study of biochemical polymorphism in Carp (Cyprinus carpio): Detect new alleles in transferrin. ROAVS, 2011, 1(x), xxx. Jaayid, T.A., Yousief, M.Y., Zaqeer, B.F., Owaid, J.M. 2011. Genetic polymorphism of kappa casein in Iraqi buffalo using polymerase chain reaction ‐ restriction fragment length polymorphism. Jakob E., Puhan Z., Fries R. 1994. Genetic polymorphism of milk proteins/ 2/ Allele and haplotype frequencies in Swiss cattle breeds. Schweizerische Milchwirtschaftliche Forschung. 23: 12‐19. Jakob, E. 1994. Genetic polymorphism of milk proteins. Mlejelarstvo. 44: 197‐217. Khaertdinov, R. A. (1989) Recommendations for the qualitative and quantitative analysis methods of milk proteins in polyacrylamide gel electrophoresis. Moscow, Russia. Khaertdinov, R. A. 1992. Use of milk genofond protein to dairy cattle selection. the Abstract. thesis Sciences. Sank peter burg. Pushkin. Khaertdinov, R. A. And Gataulin, A. M. 2000. The selection to increase protein and improvement of technological properties of milk‐Kazan, Russia. Khaertdinov, R. A. And Jaayid, Т .А. 2002. Structure of milk proteins in прекос breed sheep. Uchoniye zapisky K.S.A.V.M., 173: 169‐175. Mahe et al. (1999. Mahe, M.F., Miranda, G., Queval, R., Bado, A., Zafindrajaona, P.S., Grosclaude, F. 1999. Genetic polymorphism of milk proteins in African Bos taurus and Bos indicus populations. Characterization of variants αs1‐Cn H and k‐Cn. J. "Genetics Selection Evolution" 31: 239‐253. Mashurov, A.M. 1980. Geneticheskie markery v selektsii zhivotnyh. M.: Nauka, ‐, 315p. McLean, D.M., Graham, E.R.B., Ponzoni, R.W. 1984. Effect of milk protein genetic variants on milk yield and composition. J. Dairy Res., 51: 531‐546. Miluchova, M., Trakovicka, A., Gabor, M. 2009. Analysis of polymorphism of beta casein of Slovak Pinzgau cattle by PCR‐RFLP for allels A1 and A2. Lucrări Ş inţifice‐Zootehnie şi Biotehnologii, Universitatea de Ş inţe Agricole şi Medicină Veterinară a Banatului Timişoara. 42: 288‐292. Ng‐Kwai‐Hang, K.F., Kroeker, E.M. 1984. Rapid separation and quantification of major caseins and whey proteins of bovine milk by polyacrylamide gel electrophoresis J. Dairy Sci., 67: 3052‐3056. th 376 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Peterson, R.F. and Kopfler, F.C. 1966. Detection of new types of β‐casein by polyacrylamide gel electrophoresis at acid pH: A proposed nomenclature. Biochem. and Biophis. Res. Commun. 4: 388‐392. Rampilli, M., Caroli, A., Bolla, P., Pirlo, G. 1988. Relazioni tra genotipi lattoproteici, composizione del latte nel corso della lattazione. Sci., Tecnica Lattiero‐Casearia. 39: 262‐279. Russo, V., Mariani, P. 1978. Polimorfismo delle proteine del latte e relazioni tra varianti genetiche e caratteristiche di interesse zootecnico, tecnologico e caseario. Rivista di Zootecnia e Veterinaria. 6: 289‐ 304. Tepel, I. 1972. Chemistry and physics of milk.‐Moscow, Russia. P. 159. Thompson, M.P.. kiddy, C.A. Johnston, J.O., weinberg, R.M. 1964. Genetic polymorphism in caseins of cows’ milk. ii. confirmation of the genetic control of β‐casein variation. J dairy sci., 47: 378‐381. Tong, P.S., Farkye, N.Y., Medrano J.F. 1994. Effect of genetic variants of milk proteins on the yield of Cheddar cheese. Brussels, Belgium; Inter. Dairy Federat., P.179‐187. Wetermeier, R. 1993. Electrophoresis in Practice; VCH, New York, USA. Winfrey, R.W 1997. Unraveling DNA: Molecular Biology for the Laboratory; Prentice Hall, Upper Saddle River, NJ, USA. THE COMPARISON of SOME REPRODUCTION TRAITS and LAMBS GROWTH PERFORMANCE of EX‐SITU and IN‐SITU CONSERVED of KIVIRCIK SHEEP Tamer SEZENLER1*, Mesut YILDIRIR1, Ayhan CEYHAN2, İsmail ERDOĞAN1 1. Bandırma Sheep Research Station. 10200 Bandirma, Turkey 2. Nigde University, The Vocational School of Bor. 51700 Bor / Nigde‐Turkey * Corresponding author: tsezenler@hotmail.com Abstract This study was carried out to investigate some reproductive traits, growth performance of lambs and the survival rate of the ex‐situ and in‐situ conserved of Kivircik sheep breed Bandirma Sheep Research Station in Balikesir of Marmara region and Kırklareli province of Thrace region from 2007 to 2011. The ex‐situ and in‐situ of Kivircik herds are constituted of the project for the conservation of the indigenous breeds in Turkey as genetic resources. The differences in lambing and infertility rates between herds were significant (P<0.01). But the herds had not a significant effect on single and prolific lambing rate, fecundity and litter size. Lambing rate, prolific lambing rate, fecundity and litter size for ex‐situ and in‐situ conserved of Kivircik ewe herds were found 74.7% and 84.1%, 27.4% and 29.9%, 1.27 and 1.30, 0.95 and 1.10 lambs, respectively. The effect of year, age of ewe, type of birth, conserved type, and sex on birth weight, weaning weight and daily weight gain were significant (P<0.01). But the effect of birth type on weaning weight was not significant (P>0.05). The birth weight, weaning weight and daily live weight gain of the ex‐situ and in‐situ conserved of lambs were 3.721 kg and 4.209 kg, 25.401 kg and 25.642 kg, 0.362 kg/day and 0.358 kg/day, respectively. The average survival rate of lams of ex‐situ and in‐situ lambs were 89.1% and 95.2% respectively, and the differences between the herds (ex‐situ and in‐ situ) were significant (P<0.01). The results of this study showed that in‐situ conserved of Kıvırcık lambs had higher growth performance and lamb survival rate than ex‐situ conserved of Kıvırcık lambs, but ewes had similar fecundity and litter size except for lambing rate. Key Word: Kıvırcık sheep, conservation, ex‐situ, in situ reproduction, growth Introduction The sheep population of Turkey is approximately 21.7 million in 2009 year. Meat and milk production from sheep are consist of approximately 18.0 % and 6 %, respectively in Turkey. There has been a 47% decrease in sheep population in Turkey during to the last two decades and this decline continues (TUİK 2009). Sheep breeding are primarily useful for meat, wool, and milk production the relative importance of each varying with the country and has a great genetic potential together with different breeds and local types adapted to different ecological conditions. Indigenous sheep breeds are valuable livestock sources for specific geography. Many indigenous sheep breeds reared across wide range of Turkey and their impotence is irrefutable for economy, rural employing and human food. Additionally sheep and their products occupy an irreplaceable position in costume of Turkish daily life (Ulutaş et al., 2008). th 378 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) White Karaman, Red Karaman, Cine Caparı, Daglic, Karakul, Awassi, Herik, Kivircik, Tuj, Karayaka, Gökçada (Imroz), Hemsin sheep breeds are under risk. The main native sheep breed of Thrace and Marmara region is the Kivircik (Ertuğrul et al., 2009, Soysal et al., 2003, Gönül 2001). The Kıvırcık sheep is a medium‐sized local breed of sheep in the part of Thrace like as Istanbul, Edirne, Kırklareli, Tekirdag. The breed is mainly kept for its meat and milk is mostly used for making a special kind of white cheese which is very popular in Turkey. The wool of better quality than the other 3 local breeds and in young animal it can be used in worsted manufacture. Also the quality of meat has the best taste among the breeds of sheep (Koyuncu et al., 2007, Kaymakçı, 2006, Cemal et al., 2005, Yalçın, 1986). In different studies carried out to investigate the reproduction, lamb growth performance, and survival rate of Kivircik sheep in Turkey. The ewes birth rate were 72.4‐94.9 %, twinning rate was 8.0‐ 44.5%, litter size was 1.02‐1.51, survival rates at weaning was 79.8‐ 97.0% (Altinel et al., 2000, Altinel et al., 2001, Yılmaz et al., 2003, Koyuncu, 2005, Ceyhan et al., 2007, Koyuncu et al., 2007, Ceyhan et al., 2011). In addition lamb growth was inspected, birth weight, weight at weaning, daily live weight gain birth to weaning period of lambs were found 3.0‐4.4 kg, 17.6‐38.17 kg and 0.267‐0.290 kg/day, respectively (Altinel et al., 2000, Yılmaz et al., 2003, Cemal et al., 2005, Ceyhan et al., 2006, Ceyhan et al., 2007; Ceyhan et al., 2011). The idea carried on by FAO as global strategy for the management of Farm Animal Genetic Sources was initiated in 1993 and Turkish government has stared animal genetic conservation project since 1995 and General directorate of agricultural research of Ministry of Agriculture and rural affairs are responsible to represent the country in FAO's DAD‐IS frame work. This programme was started in‐situ and ex situ conservation. In‐situ conservation of species in their natural habitats is considered the most appropriate way of conserving biodiversity. Conserving the areas where populations of species exist naturally is an underlying condition for the conservation of biodiversity. Ex‐situ conservation is the preservation of components of biological diversity outside their natural habitats Establishment/support of breed conservation programmes directed toward specific breeds, which could include in situ or ex situ programmes for endangered breeds; supporting farmers willing to use breeds of lower productivity in today’s economic situation (Ruane, J., 1999, Goncagül, 2001, Soysal et al., 2003 and Soysal et al., 2004). The aim of this study was to evaluate some reproductive traits and lambs growth performance of ex‐situ and in‐situ conserved of Kıvırcık sheep herd in the Marmara and Thrace region. Material and Methods This study was carried out in Bandirma Sheep Research Station and Kırklareli province in the years 2007 and 2011. The purebred samples of Kivircik breed, which was gathered in the Station for the conserved of this breed as genetic resources, were used in the study. The ex‐situ herd of sheep was collected from a number of villages, which still have pure‐bred samples of these breeds, by an expert committee formed by the Station for the conserved of genetic resources project in Marmara Region. The in‐situ herd of Kıvırcık bred was conserved natural habit of Kırklareli province as genetic resource. The two herds were managed in different condition in the Station and breeder barn. The ewe herd was kept indoors during the winter months and then taken to pasture as the weather conditions improved. All ewes were mated with the selected rams. The suckling program of the lambs lasted for three months (90th days) on the average. During this program, grass hay and lamb grower feed were given to the lambs to get the rumen improvement faster. To determine the reproductive traits of the ewes, as the lambing rate, and rate of infertility of ewes, rate of single births, and rate of prolific births, fecundity, and litter size traits were determined for each herd. The Comparison Of Some Reproduction Traits And Lambs Growth Performance Of Ex‐Situ And In‐Situ Conserved Of Kıvırcık Sheep 379 The survival rates of the lambs were evaluated up to the age of weaning (90th days). To determine these traits all the lambs that died and the reasons of death were recorded. The statistical analyses for some reproductive traits and survival rate traits were done using the chi‐square test. The lambs were weighed at birth, and weaning time with a scale sensitive to 0.1 kg. The birth and weaning weights of lambs were given in Least‐Squares Means. The effects of some environmental factors that affect lamb growth performance were determined using the least‐ squares means method and the significance between the groups was determined with Duncan’s test using SPSS (1999). The model below was used to determine the extent to which the factors affected birth weight and weight at weaning of lambs. = µ + ai + bj + ck + dl+ xm+ eijklmn Yijklmn Symbols in this model are defined as; Yijkl, live weight of lamb at the age examined; µ, overall mean; ai, effect of conservation type; bj, effect of birth type; ck, effect of sex, dl, effect of age, xm, effect of year, and, eijklnm, random error. In the model used, it was assumed that there were no significant interactions between the factors investigated and the sum of the effects of the subgroups of factors were assumed to be zero. Result and Discussion Reproduction of Ewes The reproductive results of two conservation type (the ex‐situ and in‐situ) of Kivircik ewes are given in Table 1. The average lambing, infertility prolific lambing rate, fecundity and litter size for ex‐ situ and in‐situ of Kivircik ewes were 74.7% and 84.1%, 25.3% and 15.9%, 27.4% and 29.9%, 0.95 and 1.10, 1.27 and 1.30 lambs. The effect of herd on lambing rate and infertility rate were significant (P<0.01, P<0.05). But the herd effect was not found significant on the ewes’ single, prolific lambing rates, fecundity and litter size (P>0.05), The 84.1% lambing rate is calculated by in situ conserved ewes in the present study is higher than the rates in some studies (Ceyhan et al., 2007, Koyuncu et al., 2007, Ceyhan et al 2006, Koyuncu et al., 2005, Horoz et al., 2003, Yılmaz et al., 2003, Altınel et al., 2001,) and lower than those in others (Koyuncu, 2005 and Koyuncu et al., 2001). On the other hand the 74.7% lambing rate results are found lower (Ceyhan et al., 2003, Yılmaz et al., 2003, Koyuncu et al, 2001) and found well agreement with results (Horoz et al., 2003, Altınel et al., 2001)., The possible reason for lower results is the difference farm, year and season. Number of lambs at birth per ewe was 1.30 for in situ conserved Kıvırcık ewes and 1.10 for the ex‐situ conserved ewes. Ceyhan et al., (2011), Koyuncu et al., (2007), Ceyhan et al., (2007), Ceyhan et al., (2003), and Yılmaz et al., (2003) found similar results when comparing Kıvırvcık ewes. But, Altınel et al., (2001), Altınel et al., (2000), and Koyuncu (2000) found higher value for our litter size results. th 380 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1. The reproduction traits of the Ex‐situ and In‐situ Herd of Kivircik ewes. Years 2007 2008 2009 2010 2011 General Conservation Type Ewes exposed Lambing rate % Infertility Ewes single lambing Ewes prolific lambing Fecundity n % n % n % n 81 73.0 NS 30 27.0 NS 141 1.15 NS 105 65.6 NS 55 34.4 NS 215 1.16 n n Ex‐Situ (Bandırma) 123 111 90.2 NS 12 9.8 In‐Situ (Kırklareli) 185 160 86.5 NS 25 13.5 Ex‐Situ (Bandırma) 229 139 60.7 * 90 39.3 * 127 91.4 * 12 8.6 In‐Situ (Kırklareli) 184 129 70.1 * 55 29.9 * 103 79.8 * 26 20.2 Ex‐Situ (Bandırma) 203 119 58.6 ** 84 41.4 ** 88 73.9 NS 31 In‐Situ (Kırklareli) 181 154 85.1 ** 27 14.9 ** 105 68.2 NS Ex‐Situ (Bandırma) 178 156 87.6 NS 22 12.4 NS 101 64.7 In‐Situ (Kırklareli) 192 169 88.0 NS 23 12.0 NS 117 Ex‐Situ (Bandırma) 196 169 86.2 * 27 13.8 * In‐Situ (Kırklareli) 170 155 91.2 * 15 8.8 Ex‐Situ (Bandırma) 929 694 74.7 ** 235 In‐Situ (Kırklareli) 912 767 84.1 ** 145 NS: not significant, *:P<0.05 and **P<0.01 NS ** Litter size % NS 1.27 NS NS 1.34 NS 151 0.66 1.09 ** ** 155 0.84 1.20 ** 26.1 NS 150 0.74 * 1.26 ** 49 31.8 NS 215 1.12 * 1.32 ** NS 55 35.3 NS 211 1.19 NS 1.35 NS 69.2 NS 52 30.8 NS 221 1.15 NS 1.31 NS 107 63.3 NS 62 36.7 NS 231 1.18 NS 1.37 NS * 108 69.7 NS 47 30.3 NS 202 1.19 NS 1.30 NS 25.3 ** 504 72.6 NS 190 27.4 NS 884 0.95 NS 1.27 NS 15.9 ** 538 70.1 NS 229 29.9 NS 996 1.10 NS 1.30 NS The Comparison Of Some Reproduction Traits And Lambs Growth Performance Of Ex‐Situ And In‐Situ Conserved Of Kıvırcık Sheep 381 Growth of Lambs Live weights of lambs at birth and weaning weight at 90th day of age are presented in Table 2. Table 2. Live weights and daily live weight gain of the Ex‐situ anda In‐situ lambs, kg. Birth Weight Investigated Traits n Weaning Weight X ± Sx Conservation Type Daily live weight gain X ± Sx n ** X ± Sx n ** ** Ex‐Situ (Bandırma) 884 3.721 ±0.021b 601 25.401 ±0.065 601 0.241 ±0.001a In‐Situ (Kırklareli) 996 4.209 ±0.020a 703 25.642 ±0.059 703 0.239 ±0.001b Ages ** ** ** 2 327 3.636 ±0.035c 321 17.145 ±0.091d 321 0.150 ±0.002d 3 378 3.953 ±0.031b 375 22.910 ±0.081c 375 0.211 ±0.001c 4 353 4.045 ±0.032a 353 27.391 ±0.083b 353 0.259 ±0.001b 5 338 4.020 ±0.034a 255 34.640 ±0.102a 255 0.340 ±0.002a 6 305 4.146 ±0.035a ‐ ‐ ‐ 7 179 3.988 ±0.047b ‐ ‐ ‐ Year ** ** ** 2007 355 3.828 ±0.033 241 24.376 ±0.101 241 0.229 ±0.002d 2008 307 3.660 ±0.036c 234 25.029 ±0.106 d 234 0.238 ±0.002c 2009 353 3.985 ±0.034b 310 25.738 ±0.090c 310 0.243 ±0.002b 2010 432 4.118 ±0.030a 266 26.002 ±0.095b 266 0.243 ±0.002b 2011 433 4.233 ±0.029a 253 26.462 ±0.097a 253 0.247 ±0.002a Birth Type c ** e NS ** Single 1042 4.265 ±0.019a 773 25.509 ±0.057 773 0.237 ±0.001b Prolific 838 3.664 ±0.022b 531 25.534 ±0.070 531 0.243 ±0.001a Sex ** ** b ** b 669 0.222 ±0.001b 635 0.258 ±0.001a Female 909 3.858 ±0.021 669 23.825 ±0.060 Male 971 4.072 ±0.020a 635 27.218 ±0.064a Overall mean 1880 3.965 ±0.015 1304 25.521 ±0.044 1034 0.240 ±0.001 NS: not significant, **P<0.01, a, b,c, The differences among the means of groups carrying various letters in the same column are significant. The effects of conservation type, age of dam, year, birth type, and sex on birth weight, weaning weight and daily live weight gain at 90th day of lambs were investigated. The effect of year, age of ewes, type of birth, herd, and sex on birth weight, weaning weight and daily weigh gain was significant (P<0.01). But the effect of birth type on weaning weight was not significant (P>0.05). The birth weight, weaning weight and daily live weight gain of the ex‐situ and in‐situ managed lambs were 3.721 and 4.209, 25.401 and 25.642, 0.241 and 0.239 kg, respectively. The lambs which are managed in‐situ herd were heavier growth performance than ex‐situ conserved herd of the lambs. th 382 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The average birth weight of ex‐situ and in situ lambs were also in general agreement with the finding birth weight of 3.80 to 4.28 kg for same sheep breeds reported by Ceyhan et al., (2007), Ekiz and Altınel (2006), Ada et al., (2004), Yılmaz et al., (2003), Altınel et al., (2001), and Altınel et al., (2000). The average birth weights results were also heavier than by Ceyhan et al., (2011), Cemal et al., (2005) and Ceyhan et al., (2003). Our finding of the weaning weight for the ex‐situ and in‐situ conserved lambs were lower than that of same bred lambs in some other studies (Ceyhan et al., 2011, Ceyhan et al., 2007, , Ceyhan et al., 2006, Ada et al., 2004, Ceyhan et al., 2003, Yılmaz et al., 2003, and Altınel et al., 2001), however our results were higher than reported by Ekiz and Altınel 2006, Cemal et al., 2005). The average daily live weight gain at 90th day of the ex‐situ and in‐situ conserved of Kıvırcık lambs in the present study were lower then Kıvırcık lambs results (Ceyhan et al., 2011, Ceyhan et al., 2007, and Ceyhan et al., 2006). Survival of Lambs Survival rates of lambs until 90th day of age are shown in Table 3. The mean survival rate of lams of ex‐situ and in‐situ conserved lambs were 89.1% and 95.2%, respectively, and the differences between the conservation types were significant (P < 0.01). One of the important characteristics of lambs is high survival rate at the age of weaning. In‐situ managed lambs had a very satisfactory survival rate (95.2%) until weaning age than ex‐situ managed lambs. This situation can be related to offer the good condition of lambs during birth to weaning age. Profitable lamb breeding is possible only if the survival rate of lambs is high at weaning. The average survival rate at weaning period (90th days), in‐situ lams had better performance than the ex‐ situ lambs. This result showed that the in‐situ management of Kıvırcık lambs had some positive effects on the survival rates of the ex‐situ lambs. The survival rates until weaning of the in‐situ Kıvırcık lambs in the present study were higher (Ceyhan et al., 2011, Ceyhan et al., 2008, Ekiz, et al., 2006, Koyuncu et al., 2007, Koyuncu 2005, Altınel et al., 2001, Altınel et al., 2000), but were lower than those of purebred Kıvırcık lambs in some other studies (Ceyhan et al., 2007, Ceyhan et al., 2003, Yılmaz et al., 2003, Koyuncu et al., 2001). Survival rates at the age of weaning of the ex‐situ conserved of Kıvırcık lambs were determined to be similar given in references (Ekiz et al., 2006, Koyuncu et al., 2007, Altınel et al., 2001 Altınel et al., 2000), but were found lower than those of purebred Kıvırcık lambs (Ceyhan et al., 2011, Ceyhan et al., 2008, Ceyhan 2007, Koyuncu 2005, Yılmaz et al., 2003,). The Comparison Of Some Reproduction Traits And Lambs Growth Performance Of Ex‐Situ And In‐Situ Conserved Of Kıvırcık Sheep 383 Table 3. The number and survival rates of the Ex‐situ and In‐situ conserved of Kivircik lambs Survival at 90th day Investigated characteristics Number of lambs born n Conservation type % ** Ex‐Situ (Bandırma) 884 778 89.1 In‐Situ (Kırklareli) 996 948 95.2 Ages NS 2 327 303 92.7 3 378 360 95.2 4 353 307 91.2 5 338 309 91.4 6 305 275 90.2 7 179 164 91.6 Years NS 2007 355 334 94.1 2008 307 297 91.2 2009 353 331 93.8 2010 432 393 91.0 2011 433 398 91.9 Birth type NS Single 1042 962 93.3 Prolific 838 773 92.4 Sex NS Female 909 827 90.0 Male 971 909 93.6 NS: not significant, *:P<0.05 and **P<0.01 The results of this study showed that the in‐situ conserved of Kıvırcık lambs had better growth performance and survival rate than the ex‐situ conserved of Kıvırcık lambs. Similarly, the in situ Kıvırcık ewes’ reproductive performance could be increased when kept conserved native breeding area in Kırklareli province. Turkish government should be support especially in situ programme for Kıvırcık bred. In this way supporting farmers willing to use this bred of lower productivity in today’s economic situation. th 384 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Ada, M., Ceyhan, A., Sezenler, T., Özder, M., Köycü, E. (2004) Farklı Kondüsyon Puanına Sahip Kıvırcık Koyunlarında Aşım Dönemi Ek Yemlemenin Kuzu Verimi Üzerine Etkileri. Çukurova Üniversitesi, Ziraat Fakültesi Dergisi. 19 (1): 89‐96. Altınel, A., Evrim, M., Güneş, H., Özcan, M. (2001) Studies on The Possıbility to Increase Lamb Meat Production By Commercial Crossbreeding in Marmara Region. J. Fac. Vet. Med. Univ. Istanbul. 27(2): 495‐500. Altinel, A., Gunes, H., Yilmaz, A., Kirmizibayrak, T., Akgunduz, V. (2000) Comparison of the important production traits of Turkish Merino and indigenous Kivircik sheep breeds. J. Fac. Vet. Med. Univ. Istanbul. 26 (2): 527‐542. Cemal, İ., Karaca, O., Altın, T., Kaymakçı, M. (2005) Live Weights of Kıvırcık Ewes and Lambs in Some Periods under Extensive Management Conditions. Turk. J. Vet. Anim. Sci., 29:1329‐1335. Ceyhan, A., Erdoğan, İ., Kaptan, C., Taluğ, A.M., Ada, M. (2006) Saf Kıvırcık Siyahbaşlı Alman F1 (Siyahbaşlı Alman x Kıvırcık) ve (Siyahbaşlı Alman x F1) G1koyunların Bandırma Koşullarındaki Üreme Performansları Üzerine Bir Araştırma. Çukurova Üniversitesi, Ziraat Fakültesi Dergisi. 21(1): 37‐44 Ceyhan, A., Sezenler, T., Erdogan, I., Torun, O. (2011) The Improvement Studies on Mutton Sheep for Marmara Region Conditions: I. Fertility, Lamb Survival and Growth Performance of Lambs. Turk. J. Vet. Anim. Sci. 2011; 35: 79‐86 Ceyhan, A., Torun, O., Erdoğan, İ. (2003) İmroz, Kıvırcık ve Merinos Yerli Koyun Irklarında Canlı Ağırlık ve Yapağı Özellikleri. Çukurova Üniversitesi, Ziraat Fakültesi Dergisi. 18(4): 101‐108. Ceyhan,A., Erdoğan, E., Sezenler, T. (2007) Gen Kaynağı Olarak Korunan Kıvırcık, Gökçeada ve Sakız Koyun Irklarının Bazı Verim Özellikleri. Tekirdağ Ziraat Fakültesi Dergisi. 4 (2): 211‐218. Ekiz, B., Altınel, A., (2006) The Growth and Survival Characteristics of Lambs Produced by Commercial Crossbreeding Kıvırcık Ewes with F2 Rams with the German Black‐Headed Mutton Genotype. Turk. J. Vet. Anim. Sci. 30: 507‐512. Ertuğrul, M., Dellal, G., Soysal, I., Elmacı, C., Akın, O., Arat, S., Barıtçı, I., Pehlivan, E., Yılmaz, O. (2009) Türkiye Yerli Koyun Irklarının Korunması. Journal of Agricultural Faculty of Uludag Universit, 23(2): 97‐119 Goncagül, T. (2001) Farm Animal Diversity in Turkey. OECD Expert meeting on Agri‐Biyodiversty Indicator. 5‐8 November 2001. Zürich, Switzerland. Horoz, H., Kaşıkçı G., Ak, K., Alkan, S., Sönmez, C. (2003) Controlling the Breeding Season Using Melatonin and Progestagen in Kıvircik Ewes. Turk. J. Vet. Anim. Sci., 27: 301‐305. Kaymakçı, M. (2006) İleri koyun Yetiştirciliği. Geliştirilmiş İkinci Baskı. İzmir İli Damızlık Koyun‐ Keçi Yetiştiriciliği Birliği Yayınları No.1, Bornova, İzmir. Koyuncu, M. (2005) Reproductive performance of Kıvırcık Ewes Accelerated lambing management. Pakistan Journal of Biyological Sciences. 8(11):1499‐1502. Koyuncu, M., Karauzun, S.,. Ozis, S., (2007) Potential for Early Breeding of Kivircik (Western Thrace) Ewes. Bulgarian Journal of Agricultural Science, 13: 555‐561. Koyuncu, M., Uzun,S. Sengül, L. (2001) Synchronization of Oestrus and the Possibilities of Improving Reproductive Performance by using Progestagen and Different Doses of PMSG in Kıvırcık Ewes. Turk. J. Vet. Anim. Sci. 25:971‐974. Ruane, J. (1999) A critical review of the value of genetic distance studies in conservation of animal genetic resources. Anim. Breed. Genet. 116: 317–323. Soysal, M.I., Ozkan, E., Gurcan, K. (2003) The status of native farm animal genetic diversity in Turkiye and in the World. Trakia Journal of Sciences. 1 (3): 1‐12. Soysal, M.I., Tuna, Y.T., Gurcan, E.K., Ozkan, E. (2004) Farms in Turkey sustainable development in the preservation of animal genetic resources in Turkey and in the World. Trakia Journal of Sciences. (3): 47‐ 53. SPSS, (1999) SPSS Base 10.0 User's Guide. SPSS inc., Chicago, IL, USA. Ulutaş, Z., Aksoy, Y., Şirin, E., Saatçi, M. (2008). Introducing the Karayaka Sheep Breed with its traits and Influencing Factor. Pakistan Journal of Biological Sciences. 11(7); 1051‐1054. Yalçın. C. (1986) Sheep and goats in Turkey. FAO, Animal Production and Health Paper; Rome, pp. 49‐53. Yılmaz, A., Ozcan, M., Ekiz, B., Ceyhan, A., Altınel A. (2003) The production characteristics of the indigenous Imroz and Kivircik sheep breeds in Turkey. Animal Genetic Resources Information. 34: 57‐66. CONSERVATION OF AQUATIC GENETIC RESOURCES Yusuf Bozkurt Mustafa Kemal University, Faculty of Fisheries, Department of Aquaculture, Hatay, Turkey Corresponding author: yfbozkurt@yahoo.com Abstract Conservation of genetic material from aquatic species through preservation methods is an important strategy to conserve genetic diversity. Conservation strategies benefit from advances in preservation and reproductive technologies. Choosing of type of genetic material to be preserved for different species highly depend on objectives, technical feasibility, costs and practical circumstances. In aquaculture, despite the progress in breeding techniques, one of the methods to preserve aquatic genetic resources is rearing of live individuals. On the other hand, preservation of aquatic genetic resources using live individuals carries risks related to problems in rearing system, infection with pathogens, loss of genetic diversity and loss of fitness with respect to the natural habitats. Cryopreservation is considered a secure method for the ex situ preservation of biodiversity, providing opportunity to preserve representative samples and further reconstruct the original strain, population or variety, after the required environmental restoration. Keywords: conservation, genetic diversity, ex situ preservation, aquaculture Introduction Aquatic genetic resources comprise all finfish and aquatic ivertebrate genetic material that has actual or potential value for capture fisheries and aquaculture. This includes DNA, genes, gametes, individual organisms, wild or farmed and research species and organisms that have been genetically altered. (FAO, 2008). Global diversity in domestic animals is considered to be under threat. Worldwide, a large number of domestic animal breeds is endangered, in a critical status or extinct already. There is worldwide consensus about the global decline in domestic animal diversity and the need to conserve genetic diversity (FAO, 2004). The vast majority of aquatic genetic resources are found in wild populations of fish, invertebrates and aquatic plants. Domestication of aquatic species has not proceeded to the same level as it has in crop and livestock sectors (Anonymous, 2000). According to FAO, there are more than 1000 common aquatic species that are harvested by humans in major fisheries and thousands of additional species are harvested in small‐scale fisheries. The number of species in aquaculture is growing and several important species rely on the collection of broodstock or seed from natural populations (Hiemstra et al. 2006). Siltation in the upstream reduces water flow and water depth, impairing the opportunity of riverine fish to feed, navigate, and migrate and spawn. Construction of embankments for flood control and dams interferes directly or indirectly with fish migration, reproduction and ultimately survival of species. Deepening of channels by removing silt is a temporary and costly solution to improve habitat (Bart, 1999). For this reason, more effective and immediate measures are needed to protect and conserve threatened and endangered species. Importance of Conservation for Aquaculture Domestication and genetic improvement of most farmed fish are far behind those for cultivated plants and livestock. Captive reproduction and breeding programmes have been established for many species of farmed fish but not for all. Therefore, some fish are stil farmed as th 386 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) wild types or as undomesticated population that are close to wild types. If domestication of fish is defined as continious controlled reproduction for more than three generation can be termed as domesticated (FAO, 2008). As new technologies for captive reproduction become available, the farming of wild and undomesticated fish will diminish but wild Fish Genetic Resources will remain important for aquaculture, for use in fish breeding programmes and related research. This is analogous to the continuing importance of the wild relatives of cultivated plants as sources of genetic diversity to be tapped by plant breeders, despite huge progress in plant genomics. The same will apply to farmed fish, even as fish genomics advance and modern genetic technologies are increasingly used in aquaculture (FAO, 2008). Therefore, it is important first to recognize that wild Fish Genetic Resources are vital for the future sustainability and profitability of aquaculture and secondly to invest adequately in their characterization and conservation so as to ensure their continiued availability. Conservation Methods There are several options to conserve genetic diversity. In general, in situ conservation or conservation by utilization is preferred as a mechanism to conserve breeds. A breed has to evolve and adapt to changing environments and efforts to create a need for products or functions of the breed should be promoted (Hiemstra et al. 2006). Conservation without further development of the breed or without expected future use is not a desirable strategy. However, in addition to in situ conservation, methods or techniques to maintain live animals outside their production or natural environment (ex situ live) or through cryopreservation of germplasm (ex situ) are set up to preserve (germplasm of) rare breeds as well as the more widely used commercial breeds. Moreover, cryopreservation of germplasm is a very good ex situ strategy to conserve existing allelic diversity for future use (Hiemstra et al. 2006). Wherever aquaculture development and conservation of wild Fish Genetic Resources for aquaculture are undertaken, concurrent provisions should be made for all necessary current and foreseen in situ and ex situ conservation of wild Fish Genetic Resources. In situ Conservation By convention, the distinct varieties, strains and breeds of cultivated plants, farmed fish and livestock are called in situ genetic resources when located in the farms that are their natural surroundings. Their free‐living wild relatives in nature are also called in situ genetic resources (FAO, 2008). In situ wild Fish Genetic Resources are found only in natural or relatively undisturbed habitats. The two main requirements for in situ conservation of any population of wildlife in any protected area are: 1) to maintain a genetically effective population size, and 2) to pay equal attention to the management of their habitats, so as to prevent their degradation or loss (FAO, 2008). In situ conservation of threatened and important wild Fish Genetic Resources should not be abandoned. Small population of wild Fish Genetic Resources conserved in situ contribute to the overall conservation effort for a given species and are particularly important where they represent rare or sole remaining examples of a genetically distinct local population such as riverine or lacustrine race. In situ conservation of wild Fish Genetic Resources has operational and oppurtinity costs and these must be recognized and shared by public and private beneficiaries (FAO,2008). The ideal strategy for conservation of threatened and endangered species is through in situ (conservation of the ecosystem or habitat to maintain them in their natural environment) protection/restoration of the native habitat of the species. Unfortunately, this is costly and requires a great deal of time as habitat restoration is clearly a slow process. Conservation of Aquatic Genetic Resources 387 Ex situ Conservation Conservation of Fish Genetic Resources as live fish is called in vivo conservation. All in situ conservation of wild Fish Genetic Resources is in vivo, as fish population of various sizes. The ex situ conservation of wild Fish Genetic Resources can be either in vivo as individuals or population held in research establishments and aquaria, or in vitro as cryopreserved sperm, and more rarely as embryos and as any tissues containing DNA (FAO, 2008). Ex situ conservation of wild Fish Genetic Resources as cryopreserved sperm is by far the most important technology available. The absence of comparable technology for cryopreservation of the eggs and embryos of all farmed finfish and most of farmed aquatic invertabrates means that cryopreserved sperm can only be used to fertilize eggs from live females. However, cryopreservation of sperm is still a very important means of conserving wild Fish Genetic Resources and for providing wild Fish Genetic Resources in breeding programmes and related research (FAO, 2008). Ex situ conservation of wild Fish Genetic Resources should be considered first as complementary to their in situ conservation, with high emphasis on the latter. As recommended above for in situ conservation, all efforts to conserve threatened and important wild Fish Genetic Resources ex situ are valuable and contribute to the overall conservation of genetic diversity for a given species (FAO, 2008). There is a growing interest in ex situ conservation strategies, serving a variety of objectives. In many countries ex situ conservation represents an integral component of conservation strategies. Some strategies focus primarily on preservation of germplasm of rare breeds, but in general there is consensus that ex situ collections should be established for all breeds with the aim to capture as much allelic or genetic diversity in conservation programs as possible (Hiemstra et al. 2006). Where in situ conservation or use of animal genetic resources is not necessarily dependent on high‐tech approaches or facilities, the efficiency and efficacy of ex situ conservation strategies will certainly benefit from advances in cryopreservation and reproductive technology. Since ex situ conservation activities are in general rather costly, debate is going on about priorities, different methodologies and future use and benefits of cryopreservation and reproductive technology (Hiemstra et al. 2006). Ex situ conservation via cryopreservation has many potential practical applications. For example, maturation of males and females in a number of species is asynchronous. Also, maintaining sperm in cold storage would facilitate artificial fertilization and subsequent seed production. Conclusion Cryogenic sperm banks comparatively less costly than live gene banks although some initial investment for equipment, maintenance and collection would be required. In addition, cryogenic gene banking avoids the risk of contamination and requires little space and minimal facilities. Furthermore, broodstock management, genetic improvement programmes and gene banking will help to improve and production and profitability as well as assist in protection and conservation of wild resources. REFERENCES Anonymous (2000). Research and Development of Appropriate Genetic Biotechnologies for The Fıshery Sector in Developing Countries. Electronic Forum on Biotechnology in Food And Agriculture. Bart, A. N. (1999). Biodiversity and Ex Situ Fish Genetic Conservation. AARM. Newsletter. Vol. 4(4) 6‐8. FAO (2004). Conservation Strategies for Animal Genetic Resources, by D.R. Notter. Background study paper No. 22. Commission on Genetic Resources for Food and Agriculture. Rome. FAO (2008). Aquaculture Development‐Genetic Resource Management. FAO Technical Guidelines for Responsible Fisheries. S.J. Hiemstra, S.J., Van der T. Lende and Woelders, H. (2006). The Potential of Cryopreservation and Reproductive Technologies for Animal Genetic Resources. The Role Of Biotechnology in Exploring And Protecting Agricultural Genetic Resources, (FAO) Edited by Ruane, J. and Sonnino, A. CRYOPRESERVATION AND AQUACULTURE Yusuf Bozkurt Mustafa Kemal University, Faculty of Fisheries, Department of Aquaculture, Hatay, Turkey Corresponding author: yfbozkurt@yahoo.com Abstract Cryopreservation of reproductive cells and embryos is part of a subject that comprises a considerable theoretical knowledge. Cryopreservation makes possible the almost indefinite storage of desirable genes. This can substantially increase the efficiency of selective breeding of cultured species as is done with domesticated animals. Cryopreservation of sperm has been successful for many fish species and the protocols have been well developed. On the other hand, cryopreservation of eggs and embryos has been successful only in oysters. Researches on cryopreservation of teleost eggs and embryos continue. In addition, cryogenic gene banking of fish gametes is now possible for sperm cells from several species. Cryobanking of sperm has considerable advantages over breeding in captivity in terms of costs, labour and security; since thousands of samples from different generations can be maintained in a minimum space, without the risk of loss caused by disease or genetic drift over time. Moreover, transportation and management of cryopreserved samples are relatively simple, allowing greater flexibility in designing recovery programs. Also, it is possible to recover genotypes from cryopreserved sperm using androgenesis to produce viable diploid organisms with paternal only inheritance. Keywords: cryopreservation, fish gametes, gene banks, reproduction Introduction The role of aquaculture in food production, economic development and food security is now well recognized. As the fastest growing food production sector, aquaculture is now becoming increase its importance as a major source of dietary protein. The number potential species can be used in aquaculture is rapidly increasing. However, aquaculture is dependent on the spawning of fish under conditions that may be very different from those which pertain in their natural habitat. Cryopreservation of gametes and embryos is a key issue in the development of reproductive technologies that providing the possibility to preserve genetics from rare or valuable breeds, giving insurance against death, infertility or illness and enabling semen and embryos to be marketed or to be exported. For biological, clinical, and animal breeding research, banks of frozen tissues, cultured cells, blood, cartilage, sperm, and embryos have been established in many countries (Leung and Jamieson, 1991; Tiersch and Mazik, 2000; Tekin et al., 2003; Akçay et al., 2004). Taking the work on embryo preservation as an example, the studies on mouse, sheep, cattle, rabbit, rat, hard clam and oyster have been well conducted and reported (Whittingham, 1980; Rao, 1989; Lai et al., 1990; Yoshino et al., 1993; Steponkus et al., 1990; Chao et al., 1997). Just as cryopreservation has many practical applications in breeding terrestrial plants and animals, cryopreservation also offers the same potential in the artificial propagation of many aquatic animals (Yavas and Bozkurt, 2011). Furthermore, cryopreservation has a significant role in such concerns as aquatic biodiversity, eco‐toxicology, and environmental conservation. Long‐term preservation of sperm is commonplace in cattle breeding and is being adopted in aquaculture. Creation of sperm banks to stock genetic potential of valuable males for selection programmes, or banking for routine sperm handling, are being adopted in some fish farms (Tiersch and Mazik, 2000). th 390 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) It should be known well that, long‐term storage of sperm in liquid nitrogen is a valuable technique for genetic resources preservation. Fish sperm cryopreservation has been widely used in aquaculture, and over 200 fish species sperm has been cryopreserved. The use of cryopreserved spermatozoa can be delayed from the date of collection and adjusted to the moment of ova processing. The benefits (Billard and Zhang, 2001) of this technique include: (1) Storage of sperm for handling routine in those species requiring artificial insemination. (2) Crossbreeding programming independently of the maturation period or availability of breeders. (3) Utilization of all the sperm from species or individuals with a large production. (4) Transport of gametes or embryos between farms instead of breeders. (5) Marketing of well‐characterized and standard quality sperm. (6) Hybridization between species with different maturation periods. (7) Reduction of the synchronization treatments. (8) Year‐round supply of gametes. While, cryopreservation of sperm has been successful for many species, and the protocols have been well developed, cryopreservation of eggs and embryos has been successful only in oysters. Research into teleost egg and embryo is going on (Bart, 2000). General Cryopreservation Procedure Cryopreservation of aquatic animal cells comprises the following issues (Leibo, 2000). 1) Collection of cells and estimation of cell numbers and viability. 2) Suspension of cells in a solution of a cryoprotective additive and transfer into a sample container. 3) Cooling of cells to low subzero temperatures under conditions to assure almost total cell dehyration. 4) Storage of cells in LN2 at ‐196ºC to assure long‐term stability. 5) Warming of samples to physiological temperatures. 6) Removal of the CPA and assay of cell function to determine survival and normality. Conventional methods of cryopreservation, such as the use of a styrofoam box filled with liquid nitrogen or a programmable freezer, rely on comparatively slow, controlled cooling during early ice formation. They have been proven suitable for sperm cryopreservation but not always reliable for embryo cryopreservation. The essence of cryopreservation is to effect cell dehydration and concentration of the cytosol in a controlled and minimally injurious manner so that ice crystallization in the cytosol is precluded or minimized during quenching in liquid nitrogen (Leibo, 2000). Conventional cryopreservation procedures present a rather complex set of interacting variables that must be all optimized at the same time. Usually this is done in a trial and error manner. It must be repeated for each type of specimen because several of the variables are intrinsic parameters characteristic of the specimen. In case where a large number of different specimens are under consideration, or if the specimen contains different cell types such as organs and tissues, the optimal set of conditions for all the individual cell types of the specimen must be determined to minimize the probability of cryoinjuries (Leibo, 2000). Cryopreservation and Aquaculture 391 Ice Crystal Formation During rapid cooling, intracellular ice formation occurs over a broad range of subfreezing temperatures in a diverse array of biological cells. Both ice crystal formation and solute concentration contribute to cell damage in the freezing process. If solute concentration alone caused cell damage, a very rapid rate of cooling would be ideal for the freezing process, since there would be insufficient time for water to leave the cells (Tiersch and Mazik, 2000). In contrast, if intracellular ice damage were the sole contributory factor to cell damage, a very slow rate of cooling would be most ideal, because this would provide the maximum time for water to leave the cells. Because both solute concentration and intracellular ice formation contribute to cell damage, an ideal cooling rate should be neither too fast nor too slow. Characterization of the temperature distribution at which intracellular ice formation occurs is of primary importance in predicting the probability of intracellular ice formation during freezing (Pitt et al., 1991). Cryoprotectant Toxicity Low toxicity and high water solubility are essential considerations for a chemical to be cryoprotective. Cryoprotectants should be non‐ or minimally toxic, able to penetrate cell membranes easily, and able to bind either with electrolytes or with water molecules (Chao et al., 1994). The apparent toxicity of cryoprotectants is dependent on type and concentration, the equilibration time, and the temperature during loading. The stage of embryonic development is also a critical factor in various biological systems. Cryoprotectants are essential, but their toxicity may cause gamete mortality in pretreatment and post‐thawing. It is necessary to determine the point of equilibrium between cryoprotective efficiency of cryoprotectants and the toxicity tolerance of the cell types to be cryopreserved (Chao et al., 1994). Vitrification Vitrification is the rapid cooling of liquid medium in the absence of ice crystal formation. The solution forms an amorphous glass as a result of rapid cooling by direct immersion of the embryos in a polyethelene (PE) straw into liquid nitrogen. The glass retains the normal molecularrionic distributions of a liquid but remains in an extremely viscous, supercooled form. The glass is devoid of all ice crystals, and the embryos are not subjected to the physical damage that is associated with ice crystal formation during freezing which is peculiar in conventional cryopreservation method. Vitrification is a simple and less expensive alternative to conventional freezing. Procedures for vitrification of biological specimens consist of five steps. They are (1) loading, which is the equilibration of the specimen in a solution containing permeating cryoprotectants; (2) dehydration of the specimen in a concentrated solution that will vitrify; (3) plunging the specimen in liquid nitrogen; (4) warming the specimen; and (5) unloading, by dilution and removal of the cryoprotectant from the cytosol (Tiersch and Mazik, 2000). Conclusion Cryopreservation also has a significant role to play in such concerns as aquatic biodiversity, ecotoxicology, and environmental conservation. Regarding aquatic organisms, sperm cryopreservation has been successful in a number of finfish and shellfish species. On the other hand, egg and embryo cryopreservation remains a major challenge. In both gamete and embryo research, major work is limited to species that are commercially cultured. The potential for application of cryopreservation in aquatic organisms calls for more vigorous research efforts in this area. th 392 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES Akçay, E., Y. Bozkurt, S. Seçer and N. Tekin (2004). Cryopreservation of mirror carp semen. Turkish Journal of Veterinary and Animal Sciences, 28 (5), 837‐843. Bart, A.N. (2000). New Approaches in Cryopreservation of Fish Embryos, In: Cryopreservation in Aquatic Species. Tiersch, T.R. and P.M. Mazik, Editors. World Aquaculture Society, Baton Rouge, Louisiana. Pp. 179‐187. Bilard, R. and Zhang, T. (2001). Techniques of genetic resource banking in fish. In: Watson PF, Holt WV, editors. Cryobanking the genetic resource wildlife conservation for the future. London: Taylor and Francys, p. 145–70. Chao, N.H., Chiang, C.P., Hsu, H.W., Tsai, C.T. and Lin, T.T. (1994). Toxicity tolerance of oyster embryos to selected cryoprotectants. Aquat. Living Resour. 7, 99–104. Chao, N.H., Lin, T.T., Chen, Y.L., Hsu, H.W. and Liao, I.C. (1997). Cryopreservation of early larvae and embryos in oyster and hard clam. Aquaculture 155, 31–44. Lai, A.C.H., Ryan, J.P. and Saunders, P.M. (1990). Ultrarapid cryopreservation of mouse oocytes and embryos: effect of cell stage and culture in vitro. Assisted Reprod. Technol.rAndrol. 1, 320–330. Leibo, S.P. (2000). Sources of variation in cryopreservation. In: T.R. Tiersch and P.M. Mazik, Editors, Cryopreservation In Aquatic Species, World Aquaculture Society, Baton Rouge, Louisiana, pp. 75–83. Leung, L.K.P. and Jamieson, B.G.M., (1991). Live preservation of fish gametes. In: Jamieson, B.G.M. (Ed)., Fish Evolution and Systematics: Evidence from Spermatozoa. Cambridge Univ. Press, Cambridge, United Kingdom, pp. 245–269. Pitt, R.E., Myers, S.P., Lin, T.T. and Steponkus, P.L. (1991). Subfreezing volumetric behavior and stochastic modeling of intracellular ice formation in Drosophila melanogaster embryos. Cryobiology 28, 72–86. Rao, K.G., (1989). Cryopreservation of carp sperm. Fish Genetics in India: Proceedings of the Symposium on Conservation and Management of Fish Genetic Resources of India, 11–13 April, 1986. Curr. Trends Life Sci., vol. 15, Today and Tomorrow’s Printers and Publishers, New Delhi, India, pp. 193–198. Steponkus, P.L., Myers, S.P., Lynch, D.V., Gardner, V., Bronshteyn, V., Leibo, S.P., Rall, W.F., Pitt, R.E., Lin, T.T. and Macintyre, R.J. (1990). Cryopreservation of Drosophila melanogaster embryos. Nature 345, 170– 172. Tekin, N., S. Seçer, E. Akçay and Y. Bozkurt (2003). Cryopreservation of rainbow trout (Oncorhynchus mykiss) semen. The Israeli Journal of Aquaculture‐Bamidgeh, 55 (3), 208‐212. Tiersch, T.R. and Mazik, P.M. (Eds)., (2000). Cryopreservation in Aquatic Species. World Aquaculture Society, Baton Rouge, LA, 439 pp. Yoshino, T., Kojima, T., Shimizu, M. and Tomizuka, T. (1993). Cryopreservation of porcine blastocysts by vitrification. Cryobiology 30, 413–422. Whittingham, D.G., (1980). Principles of embryo preservation. In: Ashwood‐Smith, M.J., Farrant, J. (Eds)., Low Temperature Preservation in Medicine and Biology. Medical, London, England, pp. 65–83. Yavaş, İ. and Y. Bozkurt (2011). Effect of different thawing rates on motility and fertilizing capacity of cryopreserved grass carp (Ctenopharyngodon idella) sperm. Biotechnology and Biotechnological Equipment, 25 (1), 2254‐2257. POLYMORPHISM OF PIT1 GENE AND ITS ASSOCIATION WITH GROWTH AND BODY COMPOSITION TRAITS IN IRANIAN COMMERCIAL BROILER LINE Z. RODBARI1, M. ALIPANAH1, H.R. SEYEDABADI2, C. AMIRINIA2, B. TAHERI DEZFULI*3 1. Department of Animal Science, Zabol University, Iran. Department of Animal Biotechnology, Animal Science Research Institute of Iran, Karaj, Iran. 3. Department of Animal Science, Agriculture and Natural Resources Research Center of Khuzestan, Ahwaz, Iran. *Baharah_tah2003@yahoo.com 2. Abstract Pit‐1 is a pituitary‐specific transcriptional factor that has been shown to play a critical part both in cell differentiation during organogenesis of the anterior pituitary and as a transcriptional activator for pituitary gene transcription. The current study was designed to investigate the associations of Pit‐ 1 gene polymorphism on chicken body growth and body composition traits. Genomic DNA was extracted from 120 chickens from Iranian commercial broiler line. Two polymorphisms of the Pit‐1 gene were found with restriction fragment length polymorphisms. The association between these polymorphisms with chicken growth and body composition traits were analyzed using single marker analysis. Polymorphisms in Pit‐1 gene were significantly (P<0.1) associated with body growth and body composition traits. This research suggests that Pit‐1 gene could be a candidate locus or linked to a major gene(s) that affects growth and body composition traits in the chicken. Key words: Iranian broiler lines, growth and body composition traits, Pit‐1 gene, PCR‐RFLP. Introduction Commercial selection of meat‐type chickens has become complex as it must take into consideration a great number of objectives, all related to the reduction of costs and the improvement of quality of the final product (Barton, 1994). Many economically important traits of domestic animals, such as growth, egg production, and body composition are controlled by quantitative trait loci. Classical quantitative genetics can not independently decompose individual gene effects from the multiple genes associated with the variation of complex and quantitative traits. With the advances of the cutting edge molecular biology, sequencing of the entire genome, and comparative genomics, candidate gene approach, facilitated by results of the comparative genomic study, has been proven to be powerful for studying the genetic architecture of complex traits and is a far more effective and economical method for direct gene discovery. It has been widely applied in identification of genes responsible for economically important traits in animals. Marker‐assisted selection (MAS) can be used to increase selection efficiency and make further improvements in production traits. Genetic markers linked with QTL allow for direct selection of genotype (Lamont et al., 1996). To improve production and fitness traits simultaneously, molecular markers associated with one or both sets of traits may be useful. Understanding the genetic control of growth in chickens will provide an opportunity for genetic improvement of production performance and physiology (Li et al., 2003). The pituitary‐specific transcription factor (POU1F1) is a protein which binds to and transactivates promoters of Growth Hormone (GH), Prolactin (PRL) and Thyroid‐ Stimulating Hormone Chain (TSHB)‐encoding genes (Bodner et al., 1988; Ingraham et al., 1988; Steinfelder et al., 1992) and the pituitary‐specific transcription factor gene (Pit 1) itself in animal anterior pituitary (McCormick et al., 1990; Sornson et al., 1996). There are seven exons in Pit 1 and mutations in these exons cause hypoplasia of the pituitary gland and deficiencies of GH, PRL and th 394 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) TSHB (Aarskog et al., 1997; Holl et al., 1997). The chicken Pit 1 has been cloned and its cDNA sequence reported (Van As et al., 2000), Mutations in the chicken Pit 1 may regulate the expression of GH by altering the POU1F1 binding ability to the promoter of GH gene, which ultimately resulted in growth variation. With crucial role in the differentiation of anterior pituitary and the regulation of the Prolactin (PRL), Growth Hormone (GH) and Thyroid‐Stimulating Hormone (TSH) genes, the chicken Pit 1 gene is regarded as a key candidate gene for production traits (Nie et al., 2008). The main goal of the current work was to identify single nucleotide polymorphisms (SNP) in the Pit 1 gene, develop PCR‐RFLP methods to detect those DNA polymorphisms in Iranian commercial broiler line, and evaluate associations between Pit 1 SNP and growth and body composition traits. Materials and methods Chicken Populations Iranian commercial broiler line were used in the current study. All birds had free access to feed and water. The individuals were raised in floor pens and fed comercial corn‐soybean diets that met NRC requirements. The fifteen generation individuals from Iranian commercial broiler line (n=120) was used in the present study. Live BW was measured at 6 wk of age. Chickens were slaughtered, carcasses were eviscerated and dissected. Carcass weight (CW), breast muscle weight (BMW), drumstick weight (DW) back weight (BAKW), wing weight (WINW) and abdominal fat weight (AFW) traits were determined. DNA Extraction Whole blood samples were collected from 120 chickens at 6 weeks of age. Genomic DNA were extracted using salting‐out method with some modifications (Javanrouh et al., 2006). Optimization inclues utilization of separate buffer instead of Buffy coat isolation. Chloroform for DNA phase isolation and achievment to purified DNA and sodium accetate for more concentrated DNA. The optimize porotocol would be more safe, simple, cheap and rapid. PCR Amplifications and Genotyping The Pit 1 primers (5' GGA CCC TCT CTA ACA GCT CTC 3'; 5' GGG AAG AAT ACA GGG AAA GG 3') were chosen based on the primers design by Nie et al. (2008), to ampify a 599bp within intron 5 of the Pit 1 gene. Fifteen μl of each PCR reaction contained; 1X PCR buffer; 2mM MgCl2; 0.25μM primers; 200 μM dNTPs; 1 unit of Taq polymerase; 150 ng/reaction genomic DNA and ddH2o. Thermal cycling included initial denaturation at 94oC for 5 min, 35 cycles of 94oC for 1 min, 61oC for 1 min, 72oC for 1 min, and an extension at 72oC for 7 min. Two single nucleotide polymorphism (SNP) of the Pit 1 gene were detected by digesting 10 μl of the PCR product with MspI and TaqI restriction endonuclease at 37oC and 65oC overnight respectively. Restriction patterns were visualized by agarose gel electrophoresis and ethidium bromide staining. Statistical Analysis Data were subjected to the MIXED precedures of SAS (SAS Inst. Inc., CARY, NC) with genotype, line and sex as fixed effects; Sire and Dam as random effects according to the models: yijkl = μ + Genotypei + Sexj + Linek+ Sire(Line) + Dam (Line Sire) + eijkl In the formula, Y was the respons variable, µ represents population mean, and e stands for the random error. Significant differences between least‐squares means of the different genotypes and haplotypes were calculated using a contrast test. Polymorphism Of Pit1 Gene And its Association With Growth And Body Composition Traits In Iranian Commercial Broiler Line 395 Results Allele frequency The genotype and allele frequencies at Pit1‐Taq1 loci calculated by PopGene.S2 software, are shown in Table 1. The A allele was more frequent than B allele and AA genotype was more frequent than other genotypes in this population. The Chi‐square test (P<0.05) indicated that the genotype distributions were not in Hardy–Weinberg equilibrium (Table 1). The genotype and allele frequencies at Pit1‐MspI loci calculated by PopGene.S2 software, are shown in Table 2. The A allele was more frequent than B and C alleles and AA genotype was more frequent than other genotypes in this population. The Chi‐square test (P<0.05) indicated that the genotype distributions were not in Hardy–Weinberg equilibrium (Table 2). Disagreement of the genotype frequencies with the Hardy– Weinberg equilibrium expections tested indicated that Pit1 gene frequency was significantly different (P<0.05) in this population. Identification of Polymorphism and PCR‐RFLP Analysis The transition of C into T SNP, locating at the intron 5 of the Pit 1 gene creates a restriction site for Taq1 endonuclease. The 599‐bp fragment was digested with Taq1 restriction enzyme. The restriction enzyme Taq1 digested PCR producted had fragments of 599 bp for AA homozygotes, fragments of 599, 467 and 132 bp for AB heterozygotes and 467 and 132 bp for BB homozygotes( figure 1). There were significant associations between the genotypes of Pit1‐Taq1 loci and BW6, BAKWT, BMW and WINW (P≤ 0.1). There were no significant associations between the genotypes of Pit1‐ Taq1 loci and CW, DW and AFW (P>0.1; Table 3). The transition of A into G SNP and transversion C into G SNP, locating at the intron 5 of the Pit 1 gene creates a two restriction site for Msp1 endonuclease. The 599‐bp fragment was digested with Msp1 restriction enzyme. The restriction enzyme Msp1 digested PCR producted had fragments of 599bp for AA homozygotes, fragments of 599, 500 and 99 bp for AB heterozygotes, fragments of 500 and 99 bp for BB homozygotes, fragments of 599, 321 and 278 bp for AC heterozygotes, fragments of 500, 321, 278 and 99 bp for BC heterozygotes and fragments of 321 and 278 bp for CC homozygotes ( figure 2). There were significant associations between the genotypes of Pit1‐Msp1 loci and CW, DW, BAKWT and WINW (P≤ 0.1). There were no significant associations between the genotypes of Pit1‐ Msp1 loci and BW6, BMW and AFW (P>0.1; Table 4). Discussion The candidate gene approach is a very powerful method to investigate associations of gene polymorphisms with economically important traits in farm animals (Rothschild and Soller, 1997). Many studies have examined growth, skeletal, and immune function traits using the candidate gene approach in chickens (e.g., Zhou et al., 2001; Amills et al., 2003; Li et al., 2003). The Pit1 gene was selected as a candidate gene to investigate associations of gene polymorphisms with growth and body composition in Iranian commercial broiler line. Growth is a composite of complex developments that result from genetic, nutritional, and environmental factors (Scanes et al., 1984). The current study was studied two mutation of the Pit1 gene. Disagreement of the genotype frequencies with the Hardy–Weinberg equilibrium expections tested indicated that Pit1 gene frequency was significantly different (P<0.01) in this population. This may be due to the high selection program done in population as meat chicken. In this study, For Pit1‐Taq1 loci, there were significantly higher BW6, BMW, WINW and BAKWT in birds that were of the BB genotype than those of the AA and AB genotypes (P≤ 0.1; Table 3). This result was similar to results of Nie et al. (2008). For Pit1‐MspI loci, there were higher CW, DW, WINW th 396 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) and BAKWT in birds that were of the CC than other genotypes. The other single nucleotide polymorphism in intron 5 of the PIT1 gene that was associated with body composition traits in chicken. The positive relationship between genotype CC and CW, DW, WINW and BAKWT traits indicates that the PIT1 SNP is a potential molecular marker for body composition traits in chicken. Therefore, it was presumed that it might have a QTL that affected the and body composition traits in chicken in this region, and allele C was linked with the QTL of high body composition traits.In previous study, variations of the PIT1 gene were related to fatty trait in pig (Brunsch et al., 2002). However, none of these polymorphisms was significantly associated with any of chicken fatty trait (P> 0.1). This result was similar to results of Nie et al. (2008). The consistency of identifying significant associations of the Pit1‐Taq1 and Pit1‐MspI with growth and body composition traits in multiple independent studies suggests that use of Pit1 variation may be valuable for efficient genetic selection for growth in broiler chickens. Conclusion In summary, the broiler chickens have undergone intensive breeding with so many objectives that should be simultaneously considered to reduce costs, improve health and product quality. So, several traits such as growth and body compositin traits have been included in selection indices. In addition to difficulty of measurement of these traits, the corrolations among of them are complex. MAS can be an ideal option to improve selection programs. The results from the current study indicated that a SNP marker in the Pit1 gene is associated with growth and body composition traits in chickens growing to market weight and is, therefore, a potential marker for molecular MAS programs in commercial broiler line in Iran. REFERENCES Aarskog, D., Eiken,H.G., Bjerknes,R. and Myking,O.L.(1997).Pituitary Dwarfism In The R271W Pit‐1 Gene Mutation. European Journal of Pediatrics, 156: 829‐834. Amills, M., Jimenez,N., Villalba,D., Tor,M., Molina,E., Cubilo,D., Marcos,C., Francesch,A., Sanchez,A. and Estany, J. (2003). Identification Of Three Single Nucleotide Polymorphisms In The Chicken Insulin‐Like Growth Factor 1 and 2 Genes And Their Associations With Growth And Feeding Traits. Poultry Science, 82:1485–1493. Barton, N.F.(1994).Breeding Meat type Poultry for the Future Targets for Selection, Limits to Performance and Market Requirements for Chicken. Proceeding of 9th European Poultry Conference, Glasgow, UK. pp. 33–38. Bodner, M., Castrillo,J.L., Theill,L.E., Deerinck,T., Ellisman,M. and Karin,M.(1988).The Pituitary‐Specific Transcription Factor GHF‐1 is a Homeobox‐ Containing Protein. Cell, 55:505‐518. Brunsch,C., Sternstein, I., Reinecke,P. and Bieniek,J.(2002).Analysis of Associations of PIT1 Genotypes With Growth, Meat Quality and Carcass Composition Traits In Pigs. Journal of Applied Genetics, 43:85‐91. Ingraham, H.A., Chen,R.P., Mangalam,H.J., Elsholtz,H.P., Flynn,S.E., Lin,C.R., Simmons,D.M., Swanson,L. and Rosenfeld, M.G.(1988).A Tissue‐Specific Transcription Factor Containing a Homeodomain Specifies a Pituitary Phenotype. Cell, 55: 519–29. Holl,R.W., Pfaffle,R., Kim,C., Sorgo,W., Teller,W.M. and Heimann,G.(1997).Combined Pituitary Deficiencies of Growth Hormone, Thyroid Stimulating Hormone and Prolactin Due to Pit‐1 Gene Mutation: A Casereport. European Journal of Pediatrics, 156: 835‐837. Javanrouh,A., Banabazi,M.H., Esmaeilkhanian,S., Amirinia,C., Seyedabadi,H.R. and Emrani, H. (2006). Optimization On Salting Out Method For DNA Extraction From Animal And Poultry Blood Cells. The 57th Annual Meeting of the European Association for Animal Production. Antalya, Turkey. 21‐25 August. Lamont, S.J., Lakshmanan, N., Plotsky,Y., Kaiser,M.G., Kuhn,M., Arthur,J.A., Beck,N.J. and O’Sullivan, N.P. (1996). Genetic Markers Linked to Quantitative Traits In Poultry. Animal Genetics, 27:1–8. Li,H., Deeb,N., Zhou,H., Mitchell,A.D., Ashwell,C.M. and Lamont,S.J.(2003).Chicken Quantitative Trait Loci For Growth And Body Composition Associated With Transforming Growth Factor‐Beta Genes. Poultry Science. 82:347–356. McCormick,A., Brady,H.L., Theill,E. and Karin,M.(1990).Regulation Of The Pituitary‐Specific Homeobox Gene GHF1 By Cell Autonomous And Environmental Cues. Nature, 345: 829‐832. Polymorphism Of Pit1 Gene And its Association With Growth And Body Composition Traits In Iranian Commercial Broiler Line 397 Nie,Q., Fang,M., Xie,L., Zhau,M., Liang,Z., Luo,Z., Wang,G., Bi,W., Liang,C., Zhang,W. and Zhang,X.(2008).The PIT 1 Gene Polymorphism Were Associated With Chicken Growth Traits. BMC Genetics, 9: 20‐29. Rothschild,M.F. and Soller,M.(1997).Candidate Gene Analysis To Detect Genes Controlling Traits Of Economic Importance In Domestic Livestock. Probe Newsletter for Agriculture Genomic, 8: 13‐20. Scanes,C.G., Harvey,S., Marsh,J.A. and King,D.B.(1984).Hormones And Growth In Poultry. Poultry Science, 63:2062–2074. Sornson, M.W., Wu,W. and Dasen,J.S.(1996).Pituitary Lineage Determination By The Prophet of Pit‐ 1Homeodomain Factor Defective In Ames Dwarfism. Nature, 384: 327‐333. Steinfelder,H.J., Radovick,S. and Wondisford,F.E.(1992).Hormonal Regulation Of The Thyrotropin Beta‐Subunit Gene By Phosphorylation Of The Pituitary‐Specific Transcription Factor Pit‐1. Proceedings of the National Academy of Sciences of the United States of America. 89: 5942–5. Van As,P., Buys,N., Onagbesan,O.M. and Decuypere,E.(2000).Complementary DNA Cloning And Ontogenic Expression Of Pituitary‐Specific Transcription Factor Of Chickens (Gallus Domesticus) From The Pituitary Gland. General and Comparative Endocrinology, 120: 127‐136. Zhou,H., Buitenhuis,A.J., Weigend,S. and Lamont,S.J.(2001).Candidate Gene Promoter Polymorphisms And Antibody Response Kinetics In Chickens: Interferon‐Gamma , Interleukin 2 And Immunoglobulin light Chain. Poultry Science, 80:1679‐1689. 599bp 467bp 132bp Figure 1. PCR‐RFLP pattern for Pit1 gene with Taq1digestion. 599bp 321bp 500bp 278bp 99bp Figure 2. PCR‐RFLP pattern for Pit1 gene with Msp1digestion th 398 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) TABLE 1. Genotype and gene frequency of Pit1‐Taq1 loci in chicken population Genotype frequency Chi‐square test (χ2) Gene frequency AA AB BB A B 0.61 0.32 0.07 0.77 0.23 p< 0.05 0.00 TABLE 2. Genotype and gene frequency of Pit1‐Msp1 loci in chicken population. Genotype frequency Chi‐square test (χ2) Gene frequency AA AB BB AC BC CC A B C p< 0.05 0.55 0.083 0.3 0 0.008 0.058 0.592 .346 0.062 0.00 TABLE3. Effects of Pit1‐Taq1 genotype on growth and body composition (least squares means) Trait P‐value AA AB BB BW6(g) 0.065 2649.7± 34.58 a 2557.85± 42.07 b 2729.65± 83.28 a CW(g) 0.213 1827.1± 23.01 1788.35± 28.76 1886.95± 56.95 BMW(g) 0.067 600.74± 9.67ab 579.3±10.79 b 627.35± 21.6a DW(g) 0.607 527.3± 7.8 519.65± 9.54 537.80± 18.74 WINW(g) 0.075 209.63± 2.54 ab 202.46± 3.10 b 213.98± 6 a BAKW(g) 0.034 410.6± 6.18 ab 390. 7± 7.35 b 420± 25.06 a AFW(g) 0.418 23.93± 1.56 21.88± 1.70 26.85± 3.09 a,b 1 Means with no common superscripts differ significantly (P<0.1) BW6(g)= Body Weight at 6 week; CW= carcass weight ; BMW= breast muscle weight; DW= drumstick weight; WINW= Wing weight; BAKW= back weight , AFW= abdominal fat weight TABLE4. Effects of Pit1‐Msp1 genotype on growth and body composition (least squares means) Trait P‐value AA AB BB CC BW6(g) 0.258 2590.4± 36.58 2704.85± 77.07 2664.95± 45.28 2538.7± 96. 8 CW(g) 0.032 1776.1± 23.81c 1872.6± 51.36ab 1865.85± 56.95b 1879.55± 63.95a BMW(g) 0.24 584.04± 9.47 608.3±20.29 518.65± 11.6 593.95± 25.6 DW(g) 0.087 514.58± 7.8b 545.22± 17.11ab 534.80± 9.9b 555.24± 21.3a WINW(g) 0.055 203.23± 2.54 b 213.16± 3.10 ab 211.92± 3.3 ab 216.48± 7.2 a BAKW(g) 0.004 392.3± 0.09 b 423.8± 13.35 ab 416.22± 7.06 b 435.6± 16.32 a AFW(g) 0.948 22.95± 1. 6 22.78± 3.4 24.15± 1.9 24.55± 4.2 a,b 1 Means with no common superscripts differ significantly (P<0.1) BW6(g)= Body Weight at 6 week; CW= carcass weight ; BMW= breast muscle weight; DW= drumstick weight; WINW= Wing weight; BAKW= back weight , AFW= abdominal fat weight ESTIMATES OF (CO)VARIANCE COMPONENTS FOR DIRECT AND MATERNAL EFFECTS ON BIRTH WEIGHT OF KARAYAKA LAMBS Z. Ulutas 1*, E. Sirin, Y. Aksoy1, A. Sahin1 1. Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey *Correspondence: Prof. Dr. Z. Ulutas, Gaziosmanpasa University, Faculty of Agriculture, Department of Animal Science, 60250 Tokat, Turkey; E‐mail: zulutas@gop.edu.tr Abstract The aim was to estimate the genetic parameters for birth weight of Karayaka lambs by separating direct genetic, maternal genetic and maternal permanent environmental effects. Data were collected on 1013 birth weight records of Karayaka Lambs during the period from 2005 ‐ 2010. Variance components and genetic parameters for direct and maternal effects were estimated using the ASREML in animal model. Depending on the model, direct heritability varied from 0.37 to 0.55 for birth weight and maternal heritability ranged from 0.101 to 0.271 for birth weight.When fitted in models, estimates of genetic correlation between direct and maternal effects were high and negative for birthweight. Key words: Karayaka lambs, birth weight, ASREML, variance components Introduction The Karayaka sheep is one of the major indigenous sheep breeds of Black Sea Region in Turkey. They are a carpet‐wool breed kept also for meat and milk production. They are classified as a long‐ thin tailed breed. One of the important breed characteristics in sheep breeding is lamb birth weight. Profitability of sheep production for meat depends to a great extent on lamb birth weight, so selection objectives concentrate on this trait. Birth weight is used as a first measure of growth performance in animals. Birth weight is the easiest and most reliable measure of growth during the pre‐natal period. It is also an important factor affecting growth and development during the postpartum period. Many factors affect the birth weight. This trait has been reported to be associated with age at first calving. These factors include direct genetic effects, maternal genetic effects and environmental factors,which affect both the lamb and its dam. Hence, to achieve optimum genetic progress in a selection program both the direct and maternal components should be taken into account (Meyer, 1992; Maria et al. 1993; Ekiz et al. 2004).Environmental factors are also known to be important in growth and the trait is under polygenic control. There are no reports on maternal effects and correlation between additive direct and additive maternal effects calculated using REML algorithms for birth weight of Karayaka lambs. The aim of this study was to estimate genetic parameters for birth weight of Karayaka lambs by fitting six animal models, attempting to separate direct genetic, maternal genetic and maternal permanent environmental effects. In addition, the genetic correlation between additive direct and additive maternal effects was estimated. Results from earlier studies concerning direct and maternal genetic effects on the birth weights of lambs are summarized in Table 1. th 400 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1. Reported estimates of genetic parameters for direct and maternal effects on birth weight in different breeds of sheep. Breeds h2d m2 c2 ram Researchers Romanov 0.04 0.22 0.10 ‐0.99 Maria and ark., 1993 Romanov 0.07 0.13 0.32 ‐0.13 Tosh and Kemp (1994) Polled Dorset 0.12 0.31 0.27 ‐0.35 Tosh and Kemp (1994) Hampshire 0.39 0.22 0.37 ‐0.56 Tosh and Kemp (1994) Konya Merinosu 0.15 ‐ ‐ ‐ Ozturk et al. (1996) Swedish Finewoll 0.07 0.30 ‐ 0.11 Nasholm and Danell (1996) Chios 0.18 0.19 0.12 ‐0.44 Ligda et al. (2000) Dorper 0.11 0.10 0.12 0.35 Neser et al. (2001) Karacabey Merinosu 0.23 ‐ ‐ ‐ Koyuncu et. al (2001) Anadolu Merinosu 0.18 ‐ ‐ ‐ Unal and Akcapınar (2001) Horro 0.31 0.23 ‐ ‐0.63 Abegaz et al. (2002) 2 2 2 h d: direct heritability, m : maternal heritability, c : permanent environmental variance as a proportion of phenotypic variance, ram: genetic correlation between direct and maternal effects Material and Methods The birth weight for this study was obtained from 1013 lambs (520 males and 493 females) held in Gaziosmanpasa University Agricultural Research Farm. The lambs weights were taken at birth with 50 g sensitivity scale. Data were collected on 1013 birth weights of Karayaka lambs during the period from 2005 to 2010. Information available for each animal in data set comprised of lamb, sire and dam identification, sex (male and female), year, birth type, and dam age. The characteristics of the data structure are summarized in Table 2. Table 2.Characteristics of the data structure. Description Number of records Animals in data Year (2005‐2010) Mean, kg Standard error, kg Coefficient of variation, % Birth Weight 1013 1013 6 4.01 0.021 16.88 Preliminary analyses were conducted for birth weight to identify the significant effects. The General Linear Model Procedure in Minitab‐Version 12 (1998) was used for analyses. The analysis of variance showed that fixed effects of year of birth, sex of lamb, birth type and age of dam on birth weight were significant. Estimates of genetic parameters and variance components were obtained by Restricted Maximum Likelihood fitting and animal model and utilising all pedigree information using the program ASREML (Gilmour et al. 1998).The model included the random effects animal, sire and dam. The effects taken into the model were birth year (fixed), birth type, sex of lamb (fixed) and age of dam (fixed). Six different animal models were used to estimate the parameters as presented in Table 2. Animal was a random factor in the applied models. Models also included the maternal permanent Estimates Of (Co)Variance Components For Direct And Maternal Effects On Birth Weight Of Karayaka Lambs 401 environmental effect, fitted as an additional random effect uncorrelated with all other effects in the model, a maternal common environment effect, an additive maternal effect fitted as a second random effect for each animal with the same covariance structure as the additive direct effect and a covariance between direct and maternal genetic effects (Ap Dewi et al. 2002). Maternal genetic effects or permanent environmental effects were taken into account by including the appropriate random effects in the model Following models used for the analysis Y = Xb + Zaa + e ……………………………………………Model 1 Y = Xb + Zaa + Zcc + e ……………………………………...Model 2 Y = Xb + Zaa + Zmm + e ……… Cov (a, m) = 0 ……………..Model 3 Y = Xb + Zaa + Zmm + e ……… Cov(a, m) = Aσ am …………Model 4 Y = Xb + Zaa + Zmm + Zcc + e ……… Cov (a, m) = 0 ………..Model 5 Y = Xb + Zaa + Zmm + Zcc + e ……… Cov(a, m) = Aσ am …....Model 6 Where; Y is the vector of observation values, b is the vector of fixed effects (birth year, sex of lamb, birth type and age of dam), a is the vector of direct additive genetic effects, m is the vector of maternal genetic effects, c is the vector of permanent environmental effect of dam, e is the vector of the random residual error, X is the incidence matrices of fixed effects, Z a is the incidence matrices of direct additive genetic effects, Z m is the incidence matrices of maternal genetic effects, Z c is the incidence matrices of permanent environmental effects of the dam, A is the numarator relationship matrix between animals, σ am is the covariance between direct and maternal genetic effects, V (a) = σ a2 A , V (m) = σ m2 A , V (c) = σ c2 I c , V (e) = σ e2 I n and Cov(a, m) = σ am A The covariance and variance structure of the model is as follows; a v m = c e σ a2 A σ am A σ am A σ m2 A 0 0 0 0 0 0 σ c2 I c 0 0 0 0 σ e2 I n I the identity matrix, ( I c : an identity matrix with order number of lambs and I n : an identity matrix with order number of records ), σ a the direct additive genetic variance, σ m the maternal 2 2 genetic variance, σ c the variance of the permanent environmental effect of the dam, σ e is the residual variance, 2 2 Total heritability (h2d) was calculated with the help of the following equation (Wilham 1972): hd2 = (σ a2 + 0.5σ m2 + 1.5σ am ) / σ p2 The best model for the used data was defined based on the likelihood ratio test, comparing differences between –2 Log L to a critical value from a chi square distribution (Saatcı et al. 1999). th 402 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Results and Discussion Data used in this study, 48.67% female, 51.33% male lambs. Twin, single and triplets lambs represented 27.44%, 72.26% and 0.30%. Six models used in the study are summarized in Table 3. The genetic parameters covariance, componenets and log likelihood values for each model for birth weight are summarized in Table 4. Table 3. Used animal models in the analyses 2 σ a σ 2 m Model 1 √ Model 2 √ Model 3 √ √ Model 4 √ √ Model 5 √ √ 6 √ √ Model σ 2 am σ2c √ √ √ σ2 e σ2p h2 m2 √ √ √ √ √ √ √ √ √ √ ram c2 cam √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ Table 4. Estimates of (co)variance component and genetic parameters of birth weight σ2 a σ 2 Model 1 Model 2 Model 3 Model 4 Model 5 Model 6 0.1436420 0.1246050 0.1083290 0.1671030 0.1203160 0.1524300 0.0592909 0.00603308 0.0260865 m σ2am ‐0.0460055 σ 2c σ 2 σ 2 2 0.0219925 0.0527442 ‐0.03706780 0.01765050 0.000531543 e 0.151609 0.1470510 0.1573570 0.12232700 0.14970400 0.131233000 p 0.295251 0.2936485 0.2917725 0.30271540 0.293703580 0.299870943 d 0.48 0.42 0.37 0.55 0.40 0.54 s.e 0.075 0.088 0.098 0.125 0.104 0.175 m2 0.089 0.1959 0.2050 0.1945 s.e 0.0481 0.0969 0.0851 0.1492 h ‐0.1520 cam ‐0.7720 s.e 0.1234 0.4805 ram ‐0.4622 ‐0.4592 s.e 0.2443 0.2417 2 0.0740 0.0601 0.0004 s.e 0.0413 0.0743 0.0824 c h 2 T ‐2 Log L 0.48 0.42 0.41 0.42 0.41 0.41 134.637 136.426 136.232 136.743 136.431 136.740 σ2a : direct additive genetic variance, σ2m :maternal additive genetic variance, σ2am: the covariance between direct and maternal genetic effects, σ2c : the variance of the permanent environmental effect of the dam σ2p: phenotypic variance, h2d: direct heritability, m2: maternal heritability, c2:the permanent environmental variance due to the dam as a proportion of phenotypic variance, cam: genetic covariance between direct and maternal effects of proportion, ram: direct ‐ maternal genetic correlation, ‐2 log L : log likelihood, s.e.: standard error. Estimates Of (Co)Variance Components For Direct And Maternal Effects On Birth Weight Of Karayaka Lambs 403 Models which were ignoring additive maternal effects (model 1 and model 2) had produced higher direct heritability than model 3 which was included additive maternal effects. In model 1, where maternal genetic effects were ignored, direct heritability was 0.48, while the inclusion of maternal genetic effects in model 3 and model 5 reduced the direct heritability. When the maternal genetic effects, genetic and/or environmental were included in the model, direct additive genetic variance 0.10 to 0.16. Depending on the model used, the maternal effects, divided into environmetal and genetic components. Also, model 5 removing the covariance between direct additive and maternal effects tended to generate gereater estimates of maternal heritability. Model 1 (maternal effect ignored) determined highest direct heritability (h2d) and direct additive genetic variance (σ2a ) than model 2. In model 2 (maternal genetic effect included) a decreasing has been observed in both σ2a and h2d according to model 1 but not with the other models. Model 4 (the variance of the permanent environmental effect of the dam ignored) produced highest direct heritability (h2d ) and direct additive genetic variance (σ2a). Including additive maternal effect with no maternal environmental effects in models 3 resulted smaller σ2a and h2d compared to those estimated in models 1 and 2. But, including additive maternal effect with no maternal environmental effects in models 4 resulted higher σ2a and h2d compared to those estimated in models 1 and 2. Including the covariance between the direct additive and direct maternal effect in model 4 gave rise highest σ2a and h2d. In model 5, additive maternal effects was included but σ2am was exluded. In this case model 5 produced lower σ2a and h2d than model 4. In model 6, in which both environmental and genetic maternal effects were taken into account, 19.4% of the total variance was attributed to the maternal genetic effects and 0.04% to the permanent environment of the dam. It is clear that, the relative values direct heritability and maternal heritability were greatly influenced by the model used in the analysis. When the permanent environment of the dam was ignored (model 4), the total variance was attributed to the maternal genetic variance, resulting in owerestimation of the maternal heritabilty than model 3. Ekiz et al. (2004) obtained estimates for direct heritability from 0.09 to 0.32, maternal heritability from 0.10 to 0.27, ram from ‐0.47 to ‐0.55, cam from ‐0.05 to ‐0.10, c2 from 0.18 to 0.19, respectively. The genetic correlation between direct and maternal genetic effects were ‐0.45 and the covariance between them was estimated ‐0.77. The estimates reported from Ligda et al. (2000) for Chios lambs using a similar model was ‐0.08 for genetic covariance between direct and maternal effects. Similarly, Rashidi et al. (2008) for Kermani lambs using a similar models were 0.23 ‐ 0.24, 0.11‐ 0.13, 2 ‐ 2.40 and 0.00‐0.17 for maternal heritability, ram , cam and c2 , respectively. The maternal heritability was ranged from 0.08 to 0.20. Tosh and Kemp (1994) obtained estimates for maternal heritability and c2 of 0.22 and 0.37 in Hampshire lambs, 0.31 and 0.27 in Polled Dorset and 0.13 and 0.32 in Romanov lambs, respectively. On the other hand Ligda et al. (2000) estimated higher maternal heritability (0.33) in Chios lambs and also a negative genetic correlation between direct and maternal genetic effects. Similarly, Maria et al. (1993) reported higher negative estimates which they attributed to the small number and the structure of the data. Estimates of the permanent environmental variance due to the dam as a proportion of phenotypic variance (c2) and the maternal heritability (m2), ram and cam were in the range reported by many researchers. The genetic correlations estimated by Maria et al. (1993), for Romanov, Tosh and Kemp (1994), for Hampshire, Polled Dorset and Romanov, Ligda et al. (2000) for Chios, Abegaz et al. (2002) for Horro lambs were negative and ranged from ‐0.13 to ‐0.99 while Nasholm and Danell (1994) Swedish Finewool, Neser et al. (2001) for Dorper lambs pozitive estimates. Cundiff (1972) stated that the negative covariance between maternal and direct genetic effects, explained from an evolutionary th 404 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) point of view, prevents species from becoming increasingly larger. The findings of Nasholm and Danell (1994) were not in agreement Nasholm and Danell (1994) were not in agreement with this assumption, but also several authors reported that a possible existence of a negative environmental covariance between offspring and dam could result in a biased estimation of genetic correlation between direct and maternal effects (Meyer, 1992; Ligda et al. 2000). Detected σ2a and h2d (0.54) in model 6 was same with Model 4 but it was higher than the other models. The likelihood values under six different model with the most appropriate model determined using log likelihood ratio tests are given in Table 4. The most appropriate model for birth weight was model 3, which included direct and maternal additive genetic effects. The smallest likelihood value, model 1 (134.637) have been identified. Model 2, 3, 4, 4 and 6 had the highest ‐2 log L value and did not differ significantly from the other models. But, Model 1 had the lowest ‐2 Log L value. According to the principles of ASREML program, ‐2log L smallest value of the model should be preferred as the best model. ‐2log L values are close to each other with the most complex structure in the model should be preferred (Van Vleck et al. 1995; Lee ad Taper 2002; Ulutaş et al. 2002). In this study model 1 was chosen as the best model for the analyzed data set because of the lowest ‐2 log L value from other models. References Abegaz, S., E. Negussie, G. Duguma and J.E.O. Rege, 2002. Genetic parameters estimates for growth triats in Horro sheep. J. Anim. Breed. Genet. (119): 35‐45. Ap Dewi, I., Saatci, M., Ulutas, Z., 2002. Genetic parameters of weights, ultrasonic muscle and fat depths, maternal effects and reproductive traits in Welsh Mountain sheep. Anim. Sci., 2002; 74: 399‐408. Cundiff, L.V., 1972. The role of maternal effects in animal breeding: VIII. Comparative aspects of maternal effects. J. Anim. Sci. 35, 1335‐1337. Ekiz B., Özcan M., Yılmaz A., 2004. Estimates of genetic parameters for direct and maternal effects with six different models on birth weight of Turkish merino lambs. Turk J Vet. Anim Sci., 383‐389. Gilmour A.R., Cullis B.R., Welham S.J., Thompson, R., 1998. “ASREML”. NSW Agriculture Orange Australia. Koyuncu, M., Tuncel E., Kara Uzun, Ş., 2001. Karacabey Merinosu koyunlarında doğum ağırlığı ve gebelik süresine bazı çevre faktörlerinin etkileri ve genetik parametreler. Atatürk Üniversitesi Ziraat Fakültesi Dergisi (32) 2: 163‐167. Lee, S., Taper, M.L., 2002. A composite likelihood approach to (co)variance compenet estimation. J Stat Plann Infer, 103, 117‐135. Ligda, Ch., Gavriilidis, G. Papodopoulos, Th, Georgoudis, A., 2000. Investigation of direct and maternal genetic effects on birth and weaning weight of Chios lambs. Livest. Prod. Sci. (67): 75‐80. Maria, G.A., Boldman, K.G., Van Vleck, L.D., 1993. Estimates of variances due to direct and maternal effects for growth traits of Romanov Sheep. J. Anim. Sci. (71): 845‐849. Minıtab, 1998. Minitab Reference Manuel For Windows. Release 12. Stage College, Pennsylvania, Minitab Inc. Meyer, K., 1992. Variance Components Due to Direct and Maternal Effects for Growth Traits of Australian Beef Cattle. Livest. Prod. Sci., 31: 179‐204. Nasholm, A., Danell, O., 1994. Maternal effects on lamb weights. In: Proceedings of the 5thWorld Congress on Genetics Applied to Livestock Production, University of Guelph, Canada, Vol. 18, pp. 163‐166. Nasholm, A. Danell, O., 1996. Genetic relationships of lamb weight, maternal ability and mature ewe weight in Swedish Finewool sheep. J. Anim. Sci. (74) 329‐339. Neser, F.W.C., Erasmus, G.J., Van Wyk, J.B., 2001. Genetic parameter estimates for pre‐weaning weight traits in Dorper sheep. Small Rumin. Res. (40) 197–202. Estimates Of (Co)Variance Components For Direct And Maternal Effects On Birth Weight Of Karayaka Lambs 405 Ozturk, A., Aktaş, A.H., Gürkan, M., 1996. Heritability of birth weight in Konya Merino sheep. Turk J Vet Anim Sci. (20) 6: 411‐414. Rashidi, A., Mokhtari, MS., Safi Jahanshahi, A., Mohammed Abadi, M.R., 2008. Genetic parameter estimates of pre‐weaning growth traits in Kermani sheep. Small Ruminant Research, 74: 165‐171. Saatcı, M., Ap Dewi, I., Ulutas, Z.: Variance components due to direct and maternal effects and estimation of breeding values for 12‐week weight of Welsh Mountain lambs. Anim. Sci., 1999; 69: 345‐352. (article in Turkish with an abstract in English). Tosh, J.J., Kemp, R.A., 1994. Estimation of variance components for lamb weights in three sheep populations. J. Anim. Sci. (72): 1184‐1190. Ulutas, Z., Saatcı, M., Dewi, IA., 2002. Six different models for for estimation of genetic parameters and breeding values for pre weanings and post‐weaning weights in sckler cattle. Turk J Anim Sci, 26, 215‐ 220. Unal, N., Akcapınar, H., 2001. Orta Anadolu Merinoslarında önemli verim özellikleri ve seleksiyonla geliştirilmesi imkânları. II. Fenotipik ve genetik parametreler ve seleksiyon indeksi. Lalahan Hayvancılık Araştırma Enstitüsü Dergisi. (41) 2: 35–50. Van Vleck, L.D., Kriese, L.A., Boldman, K.G., 1995. Alternative modals and shared Experiences with MTDFREML. In, Boldman, K.G., Kriese, L.A., Van Vleck, L.D., Van Tassel C.P., Kachman S.D., (Eds); A manual for use of MTDFREML, Departmen of Agriculture, Agricultural Research Service, 1sted. 45‐52, Nebraska Univ. Willham, RC., 1972. The role of maternal effects in animal breeding III. Biometrical aspects of maternal effects in animals. J.Anim. Sci., 35: 1288‐1293. ASSESSMENT OF GENETIC DIVERSITY IN LOCAL SHEEP BREEDS OF ALBANIA AND KOSOVO BY MICROSATELLITE MARKERS A. HODA1*, B. BIJO1, H. BYTYQI2, G. HYKAJ1 1. Agricultural University of Tirana, Albania 2 University of Prishtina, Kosovo * Corresponding author: hodanila@yahoo.com Abstract Sheep are considered as an important livestock species in Albania and Kosovo. A sample of 150 individuals, representing five local sheep breeds: “Bardhoka” of Albania, “Ruda”, “Shkodrane”, “Recka” and “Bardhoka” of Kosovo is genotyped for 6 microsatellite markers. A total of 101 alleles were found. Heterozygosity varied from 0.67 to 0.79. Mean alleles number per breed varied from 5.83 to 8.83. All breeds, except “Ruda” showed heterozygote deficit. There is a heterozygotes deficit of 3.4% for each of analyzed breeds. This deficit is of 16.8% for the whole population. Level of apparent breed differentiation is moderate and multilocus FST values indicate that around 9.7% of the total genetic variation could be explained by breed differences and the remaining 92.3% by differences among individuals. Inbreeding for all population is FIS = 0.036, ranging from ‐0.011 (Ruda) to 0.061 (Bardhoka of Albania). There is a small genetic distance between breeds. Assignment of individuals to their reference population were carried out. Most of the genetic variations were due to differences between individuals. Mean percentage of individuals was correctly assigned using the Bayesian approach at 58.67%. Principal component analysis (PCA) differentiate Recka and Bardhoka of Kosovo. Keywords: Genetic diversity, genetic distance, microsatellite.. Introduction Sheep are one of the most important livestock species in Albania and Kosovo. There exist several local breeds in both countries, and the classification of these local breeds is done basically on morphological traits and production performance. In the present study we intend to estimate the genetic diversity and structure of five local sheep breeds, four breeds from Albania and one breed from Kosovo, using six microsatellite markers. The breeds under study are Bardhoka of Albania, Ruda, Shkodrane Recka and Bardhoka of Kosovo. These breeds are well adapted to extensive and semi‐intensive farming systems. They graze mainly on natural pastures of Albania and Kosovo. Recently several studies are carried out, of local sheep breeds, using molecular markers like microsatellite (Peter et al., 2007, Cinkulov et al., 2008), AFLP (Hoda et al., 2010), SNP (Hoda et al., 20011). In the present study, for the first time these five local breeds are compared together, but the number of markers is limited to six. Materials and methods Sample collection and microsatellites markers Blood samples, from a total of 150 randomly selected individuals, representing three different Albanian sheep breeds were collected: Bardhoka of Albania (BarAl), Ruda (Rud), Shkodrane (Sko), Recka (Rck) and Bardhoka of Kosovo (BarKos). Sampling is carried out in a mountainous area, where it is supposed to have pure breed individuals still. For each breed, 25 ‐ 31 unrelated individuals were selected from 10 to 11 flocks based on the information provided th 408 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) by the farmers. All samples were genotyped for 6 microsatellite markers: BM8125, MAF65, OarCP34, OarFCB304, OarHH47 and OarVH72 Data analysis The allele frequencies, mean number of alleles per locus, and population mean observed (Ho) and expected (He) heterozygosities were calculated with the Genetix 4.0.4 software (Belkhir et al., 1996). Exact tests for deviation from Hardy–Weinberg equilibrium (HWE) were applied using the Markov Chain Monte Carlo simulation (200 batches, 5000 iterations per batch, and a dememorization number of 10000) as implemented in GENEPOP version 3.4 (Raymond and Rousset 2001). Allelic richness, Nei’s gene diversity, Wright's F‐statistics for each locus was calculated using Fstat 2.9.3 software (Goudet et al., 1995.) Nei genetic distance (Nei, 1972) was calculated and used for the construction of UPGMA consensus tree (Saitou and Nei, 1987) with Phylip package (http//evolution.genetics.washington.edu/phylip.html) (Felenstein 2000). Bootstrap (1000 replicates) resampling was performed to test the robustness of the dendrogram topology. Nei genetic distance calculated from the allele data was plotted as PCA using GenAlEx program (Peakall and Smouse, 2006). The program Geneclass2 (Piry et al., 2004) was used for individual assignment, by likelihood‐based methods, according to the criteria of Paetkau et al. (1995) by assuming a default allelic frequency of 0.001 and a threshold of 0.05. The assignment of individuals to the reference population was carried out using Bayesian approach (Rannala & Mountain, 1997). The ‘‘leave one out’’ procedure assignment was applied for the individuals. The confidence level was 99%. Result and discussions 3.1. Microsatellite markers All the markers were polymorphic. In total were identified 72 alleles (Table 1) for all loci. Total number of alleles ranged from 9 (BM8125, OARVH7) to 16 (OAFCB3). Observed heterosigosity (HO) varied from 0.627 (OAFCB3) to 0.844 (OarVH7), with an average of 0.738. There were 3 deviations from Hardy Weinberg equilibrium from 30 loci‐populations combination (p < 0.05). Table 1. Total number of alleles (TNA) allelic range, observed heterosigosity (HO), expected heterosigosity (HE), F‐statistic (FIS, FIT, FST) for each marker in each population. Allelic Deviations Loci range from HWE TNA HE FIS FIT FST (bp) HO BM8125 9 108‐126 0.75 0.753 ‐0.023 0.084* 0.104*** 0 MAF65 12 113‐138 0.742 0.688 0.005 0.067* 0.062*** 1 OARCP3 11 111‐135 0.785 0.805 0.012 0.11*** 0.099*** 0 OAFCB3 16 149‐189 0.627 0.572 0.107* 0.23*** 0.138*** 0 OARHH4 15 121‐155 0.681 0.538 0.103** 0.233*** 0.145*** 1 OARVH7 9 125‐141 0.844 0.823 0.009 0.042 0.034*** 1 mean 0.738 0.696 0.034* 0.129*** 0.097*** *p<0.001 Assessment Of Genetic Diversity İn Local Sheep Breeds Of Albania And Kosovo By Microsatellite Markers 409 3.2. Variation within breeds In table 2 is displayed the genetic variability of sheep breeds. Recka showed the highest number of alleles (50) and the lowest number was shown by Bardhoka of Kosovo (35). The highest value of mean number of alleles (MNA) was displayed by Ruda (4.1). The lowest value of expected heterosigosity is displayed by Bardhoka of Kosovo, (0.68) and the highest value by Recka (0.78). Allelic richness (AR) varied from 35 in Bardhoa of Kosovo to 50 for Shkodrane. The values of observed heterosigosity (Ho) ranged from 0.67 in Bardhoka of Kosovo to 0.80 in Ruda. Mean values of HE and HO, for all loci and breeds are 0.75 and 0.74 respectively. Values of observed heterosigosity are higher to other sheep breeds like 0.68 in French Merino (Diez‐Tasco´n et al., 200),; 0.70 in Muzzafaranagri (Arora and Bhatia 2004); 0.71 in Baltic breeds (Tapio et al., 2005); 0.67 in Nali and Chokla (Sodhi et al., 2006); 0.69 in Magra (Arora and Bhatia 2006), but are comparable with the sheep of West Balkan, 0.78 (Cinkulov et al., 2008). Mean number of alleles (MNA) varied from 5.83 in Bardhoka of Kosovo to 8.83 in Shkodrane. Positive values of FIS indicate inbreeding in all breeds except of Ruda. In table 2 is shown also, the number of loci deviating significantly from HWE (p < 0.05). Table 2. Genetic variability within breeds. Breed n TNA AR He Ho MNA FIS Deviations from HWE Bardhoka (Alb) 31 46 44.47 0.76 0.72 7.67 0.061 3 Ruda 31 47 45.09 0.77 0.80 7.83 ‐0.011 0 Shkodrane 31 53 50.42 0.77 0.71 8.83 0.087 1 Recka 32 50 47.33 0.78 0.79 8.33 0.009 0 Bardhoka (Kos) 25 35 35.00 0.68 0.67 5.83 0.033 2 Total 150 72 55.88 0.75 0.74 7.7 0.036 n: sample size; TNA: total number of alleles; AR: allelic richness; HE: expected heterosigosity; HO: observed heterosigosity; MNA: mean number of alleles. 3.3.Genetic differentiation Population differentiation examined F‐statistic FIT, FIS and FST for each of the 6 microsatellite markers is presented in table 1. The genetic differentiation among the analyzed breeds (FST) was 0.097, significantly different from zero (p < 0.001). Around 9.7% of total genetic variation can be explained by differences between populations and 90.3% corespond to differences among individuals wiiithin breeds. T he results obtained here show a moderate genetic differentiation. Genetic distances are rather low, ranging from 0.671 to 2.227. Matrix of Nei’s genetic distance (DS) (Table 3), uas used to build the dendrogram using UPGMA algoritmin (Figure 1). The number at nodes show the values for 1000 bootstrap resampling of loci. The values are higher than 50, indicating high robustness of the tree. In figure 2 is displayed the Factorial Component Analysis (FCA). FCA displayed clearly that Bardhoka of Kosovo and Recka form separate groups. Amova analysis (data non displayed) showed that 9.74% was percentage of variation between populations and 90.26% of variation was within populations. The assignment (Direct) and exclusion (Simulation) of individuals to their reference population (Table 4) is carried out by frequency, and Bayesian methods. The confidence level was 99%. The Bayes approach performed better for assigning animals to their breed. Bardhoka of Kosovo was the breed with the lowest rate of animals correctly assigned, and Recka, the breed with the higher rate of correctly assigned animals (78.13), being also this breed which showed the higher rate of excluded animals (40.63). th 410 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 3. Matrix of Nei’s genetic distance Nei (DS). Ruda Bardhoka (Alb) Shkodrane 0.118 Ruda Recka Bardhoka (Kos) 0.111 1.665 2.001 0.067 1.714 2.091 1.807 2.277 Shkodrane Recka 0.197 Table 4. Percentage of individuals from each goat breed correctly assigned to their population of origin by direct frequency and Bayesian assignment methods. Frequency Bayes Breed No Direct Simulim Direct Simulim Bardhoka (Alb) 31 51.61 9.68 54.84 12.90 Ruda 31 48.39 3.23 51.61 22.58 Shkodrane 31 35.48 0.00 35.48 6.45 Recka 32 71.88 53.13 78.13 40.63 Bardhoka (Alb) 25 21.16 0.00 14.44 0.00 Total 150 58.67 14.00 58.67 17.33 Figure 1. Dendrogram constructed from Ds using UPGMA algoritm. Assessment Of Genetic Diversity İn Local Sheep Breeds Of Albania And Kosovo By Microsatellite Markers 411 Principal Coordinates Bar (Kos) Bar (Alb) Coord. 2 Rud Sko Coord. 1 Rck Figure 2. Principal component analysis (PCA). The breeds considered in this study are of great importance to the farmer community in Albania and Kosovo, since they provide an important source of meat and milk mainly for family consumption. All the breeds revealed considerable genetic variation. They displayed a high mean number of alleles (7.7) and high values of observed and expected heterosigosity. There has been a very limited admixture with Bardhoka of Kosovo, because of long isolation between both countries. Therefore Bardhoka of Kosovo and Albania have greatly diverged, nevertheless they originally were the same breed. The breeds under the study are an important genetic reservour that have to be conserved. The results provided here may be useful in setting conservation priorities and breeding policy. The study must go further, especially increasing the number of markers. REFERENCES 1. 2. 3. 4. 5. 6. 7. Arora. R and Bhatia. S. (2004) Genetic structure of Muzzafarnagri sheep based on microsatellite analysis. Small Ruminant Research 54: 227‐230. Arora. R and Bhatia. S. (2006) Genetic diversity of Magra sheep from India using microsatellite analysis. Asian‐Australian Jornal of Animal Science 19: 938‐942. Belkhir, K., Borsa, P., Chikhi, L., Raufaste, N and Bonhomme, F. (2001). GENETIX: logiciel sous Windows TM pour la gé né tique des populations. [GENETIX: software on Win‐ dows TM for population genetics] 4.0, 2nd edition. Labor‐ atoire Genome Populations, [Laboratory of Populations Genome] Interactions CNRS,. Université de Montpellier II; 1996 2004. Montpellier (France). http://www.univmont p2.fr/~genetix/genetix/genetix.htm Cinkulov, M., Popovski. Z., Porcu. K., Tanaskovska. B., Hodzic. A., Bytyqi. H., Mehmeti. H., Margeta. V., Djedovic. R., Hoda. A., Trailovic. R., Brka. M., Markovic. B., Vazic. B., Vegara. M., Oslaker. I and Kantanen. J. (2008) Genetic diversity and structure of the West Balkan pramenka sheep types as revealed by microsatellite and mitochondrial DNA anaylsis, J. Anim. Breed. Genetic 125, 417‐426. Diez‐Tasco´n. C., Littlejohn. R.P., Almeida. P.A and Crawford. A.M. (2000) Genetic variation within the Merino sheep breeds analysis of closely related populations using microsatellites. Animal Genetics 31, 243–51. Felsenstein. J. (2000) PHYLIP Phylogeny Inference Package, Department of Genome Science, University of Washington, Seattle. Goudet. J. (1995) FSTAT V 2.9.3 a computer programme to calculate F‐statistics http//www.unil.ch/izea/software/fstat.html. J. Hered. 8, 485‐486. th 412 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. Hoda. A , Hykaj. G., Sena. L and Delia (Veizaj). E. (2011) Population structure in three Albanian sheep breeds using 36 single nucleotide polymorphisms, Acta Agriculturae Scandinavica, Section A ‐ Animal Science, 61: 1, 12 — 20. DOI: 10.1080/09064702.2010.542250 Hoda. A., Ajmone‐Marsan. P., Hyka. G and Econogene Consortium (2010) Genetic diversity in Albanian sheep breeds estimated by AFLP markers. Albanian Journal of Agricultural Sciences. 10 (2), 23‐29. Nei. M. (1972) Genetic distances between populations. American Naturalist., 106: 283‐92 Paetkau. D., Calvert. W., Stirling. I and Strobeck. C. (1995) Microsatellite analysis of population structure in Canadian polar bears. Mol. Ecol., 4: 347‐354. Peakall. R and Smouse. P.E. (2006) GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes., 6: 288‐295. Peter. C., Bruford. M,. Perez. T., Dalamitra, S., Hewitt. G., Erhardt. G and The Econogene Consortium. (2007) Genetic diversity and subdivision of 57 European and Middle Eastern sheep breeds. Anim, Genetics, 38, 37 – 44. Piry. S., Alapetite. A., Cornuet. J.M, Paetkau. D., Baudouin. L and Estoup. A. (2004) GeneClass2: a software for genetic assignment and first generation migrants detection. Journal of Heredity 95,536‐ 39. Prichard. J.K, Stephens.M and Donnelly. P. (2000) Inference of population structure using multilocus genotype data. Genetics, 155: 945–959. Rannala. B and Mountain. J.L. (1997) Detecting immigration by using multilocus genotypes. Proc. Natl Acad. Sci. USA, 98: 9197‐9201. Raymond. M And Rousset. F. (2001) GENEPOP a population genetic software for exact test and ecunemism. http//www.cefe.cnrs‐mop.fr. Stand 12.12.04. Saitou. N and Nei. M. (1987) The neighbor‐joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol.,. 4: 406–25. 19. Schneider. S., Roessli. D and Excoffier. L. (2000) Arlequin: a software for population genetics data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland. . 20. Sodhi. M., Mukesh. M and Bhatia. S. (2006) Characterizing Nali and Chokla sheep differentiation with microsatellite markers, Small Ruminant Research 65: 185‐192. Tapio. I., Tapio. M., Grislis. Z., Holm. L.E., Jeppsson. S., Kantanen. J., Miceikiene. I., Olsaker. I., Viinalass. H and Eythorsdottir. E. (2005) Unfolding of population structure in Baltic sheep breeds using microsatellite analysis. Heredity 94, 448‐456. 21. SUSTAINABLE SHEEP AND GOAT PRODUCTION BASED ON THE LOCAL BREEDS IN MONTENEGRO B. MARKOVIĆ*1, M. MARKOVIĆ1, D. RADONJIĆ1, M. VELJIĆ1 1. Department for Animal Science, Biotechnical Faculty, University of Montenegro, Mihaila Lalica 1, 81000 Podgorica, Montenegro * Corresponding author: bmarkovic@t‐com.me Abstract Sheep and goat production (taken together) is a very important sector of livestock production in Montenegro and economically is just behind cattle production. Its importance becomes even more evident since the small ruminant rearing allows utilization of less productive areas (natural meadows and pastures) that prevail in total agricultural land (88%). The sheep production is based on the 227.000 heads, mostly distributed in the northern‐ mountainous part of Montenegro, while the goat production with total population of about 35.000 productive heads located mostly in south parts of Montenegro. The production is mainly extensive and semi extensive. Major part of it is in distant rural areas, which face problem of abandonment of its vital workforce. Sheep production relies on rearing of the local Pramenka breeds: Pivska or Jezeropivska and Sjenicka breed are dominant, while Bardoka, Ljaba, Sora or Zetska Zuja have much smaller share in total population. All of these breeds are very well adapted to the local climate and geographic conditions of rearing and they are very valuable from the aspect of preservation of genome of autochthonous breeds, too. Annual volume of sheep production output is about 3,600 t of meat and 7,000 t of milk, what gives a total value of 18 millions euro approximately. Goat production is also an important sector especially for the karstic regions in Montenegro where natural conditions are not appropriate for raising the other ruminants. Annual volume of output is about 450 t of meat and 4.000 t of milk. Local Balkan goat breed, with different varieties well adapted to the scarce condition of rearing in karst ambient, dominates in total goat population. The importance of sheep and goat production for rural development, sustainable utilisation of natural resources and preservation of environment from one side and negative demographic and economic trends in distant rural areas from the other side force the government to implement different subsidies schemes in order to support this livestock sector. Keywords: Sheep, goats, local breed, extensive, semi‐extensive production Introduction Agriculture has a multifold importance for the Montenegrin economy, and it is one of the main priorities of its further economic development. An economic importance of this sector is, first of all, in its high relative contribution to the GDP (only primary production contributes to the GDP by 8%) as well as in its high contribution to the employment (Agriculture is a main or an additional source of income for more than 50.000 of families living out of urban areas). Livestock is a main branch of the agriculture, due to the fact that it gives, according to the estimation, about 50% of total agricultural output. In the past livestock was main activity, while in some regions it was the only activity of rural society. Rearing of ruminants (cattle, sheep and goats) has a special importance since it enables using of low productive land (meadows and pastures), which dominates in total agricultural land in Montenegro (about 88%). Due to that cattle production is leading sub sector of livestock, then sheep breeding follows. th 414 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The importance of livestock, and agriculture generally, should not be considered only as a contributor to the GDP. The other aspects have to be respected as well: maintaining of rural areas and the active work force in them, managing of the resources in sustainable way, agriculture is a prerequisite for development of the other economic activities (like tourism and services), it contributes to preserve cultural heritage etc. By adoption of new strategy ‘’Montenegrin agriculture and EU – Strategy of food production and rural development’’ in 2006, Montenegro opted for the concept of sustainable development of agriculture equally respecting economic, environmental and social aspects of sustainability. Sustainable development of sheep production, which was the main branch in the past, and goat production, emerging in the recent time, fit very well into the accepted model of development of Montenegrin agriculture. Sheep production Sheep production is a very important sector of livestock production and economically is just behind cattle production. Current sheep production is based on the 227,000 head, reared in the northern part of Montenegro (70%). This region has the main permanent grassland area (60% of total). During the sixties of 20th century Montenegro had about 600,000 head of sheep. Since that period intensive industrialization led to a drastic reduction of the total sheep population. Only during last 20 years sheep population has been decreased by 53%, from 480.000 heads in 1991 to 227.000 heads in 2010 (Graph 1). 600 500 000 heads 400 300 200 100 0 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2010 year Graph 1: Trend in sheep population, 1991 – 2010 According to the results of Agricultural census held in 2010 there were 6089 sheep farms, which are mostly privately owned. The highest share of farms was with size ranged from 20 to 50 heads per flock (1610 farms or 26% of the total), Graph 2. Average flock size in total population is 38 heads. Sustaınable Sheep And Goat Productıon Based On The Local Breeds In Montenegro 415 1800 1600 Number of flocks 1400 1200 1000 800 600 400 200 0 1-9 heads 10-19 heads 20-49 50-99 heads heads Size range 100-199 heads 200-499 heads 500 or > heads Graph 2: Structure of sheep breeding sector Sheep production is characterized by semi extensive system of rearing, oriented on utilisation of grassland and pasture areas. During summer season (May to mid October) the farmers with bigger flocks usually remove from the permanent settlements to mountain pastures; occasionally small‐ scale keepers transfer their breeding animals on temporary basis to bigger farmers for pasturing. Housing of sheep and feeding them mostly by hay is from November to beginning of May. The lambing season starts in late December and lasts up to the end of March. Sheep production is present in mountainous areas where the process of out‐migration continues, what is one of the main reasons why the number of sheep has been declined in the last years. However, data for last two years indicate that process of reduction of sheep population is slow down or even stopped. Sheep production is mainly based on rearing of local breeds which belong to the group of coarse wool breeds called Pramenka for triple‐purpose (milk, meat and wool production),. As wool has not been adequately paid for in the last 15 years, production is mainly concentrated on dual‐ purpose production: meat‐milk. The current value of these products is estimated as follows: meat 65‐ 70%, milk 30‐35%, what depends on the area, way of production and milking capacities of the sheep. As it was already mentioned, meat is the main product of sheep production. Annual meat production is estimated on 3660 tons (Table 1), where meat of suckling lambs (50%) dominates. Sheep milk, beside feeding of lambs during suckling period, usually is used for production of some traditional (autochthonous) milk products, like different types of cheese, cream product named ’’skorup’’ etc. Annual milk production, used for consumption and processing in households, is estimated on 7000 t. Table 1: Annual production of sheep meat Category No of heads slaughtered Live weight kg/head Carcass weight kg/head Meat production (t) Suckling lambs 100 000 60 18 1800 Older (weaning) lambs 50 000 42 21 1050 Old (culled) ewes and rams 30 000 33 27 810 Total 180 000 40 20.3 3660 th 416 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Breed structure of sheep population Regarding breed structure, group of Pramenka prevails with a number of local breeds, while the share of high productive breeds (Württemberg, Il de France, and others) is very low, almost negligible. Two breeds of Pramenka are dominant: Pivska or Jezeropivska (approx. 20%) and Sjenicka (approx. 30%). Breeds like Bardoka, Ljaba or Zetska Zuja are less important because of size of their populations (altogether about 10%). However, these last three breeds are invaluable from the aspect of preservation of native genetic resources. The share of crossbreds in the total population is a very high (about 40%). Pivska pramenka (synonym ‐ jezeropivska) is coarse wool local breed that belongs to a group of long tails sheep. It originates from Ovis vignei arkar. Region for rearing of typical animals of Pivska pramenka is North West part of Montenegro, large area around mountains Durmitor and Sinjajevina. In terms of body size, adult breeding female animals of Pivska pramenka breed weigh 51 – 54 kg; with average height to whithers about 66 cm. Face and fore legs are colored with spots. All males and 50% of females are horned (Picture 1.). The breed is characterized by white wool, although 5‐7% from the total population is black or gray. Average milk yield in lactation ranges from 100 kg to 110 kg, with average fat content of 5,5%. Level of production to the great extend depends on nutrition and way of housing. In good conditions, this breed reacts very quickly by increasing the performance of fertility, milk yield and growth of lambs. This breed is well adapted to the rearing in the cold mountain climate. Sjenicka breed is one of the most numerous sheep breed in Montenegro. The main breeding region is the North‐East part of Montenegro (area of municipalities Rozaje, Plav, Berane and Bijelo Polje). It is one of the largest sheep breed in Montenegro. Average body weight of adult breeding female animals is 55 kg, with height to withers of 65 cm, and for rams 65‐70 cm (Picture 2). Typical representatives of the breed have white wool, but black rings around eyes look like as eyeglasses, as well as dark muzzle and ears. All males are horned, but females are usually without horns. Average milk yield in lactation ranged from 80 kg to 95 kg, with average fat content of 6,5%. Fertility of ewes (130 newborn lambs per 100 ewes) and level of production to the great extend depend on nutrition and way of housing. This breed has been crossed during a long period in the past with more productive breeds (Wurtemberg ), so today we can say it is improved Sjenicka breed. Zetska zuja (Zeta’s yelow face sheep) is a unique breed, which can be easily determined by characteristic yellow – brown face and legs, and because of that it is named “yellowface”. Rearing area of this breed is very limited, only flat area around Podgorica (Zetsko – Bjelopavlicka plain and basin of Skadars' lake). Population of Zetska zuja is rapidly decreased, thus today there are only few tens of purebred heads. It is the most endangered breed of sheep in Montenegro with high risk of extinction. This breed is one with smallest body frame of all sheep breeds in Montenegro. Average body weight is about 35 kg, while withers height is 57cm (Picture 3). Average milk yield in 6 months of lactation is about 80 kg with 7.5% of fat content. This breed has a very good resistance and excellent adaptability to the very hot climate in the rearing area. Ljaba is a breed of Pramenka reared mainly in the South part of Montenegro close to border of Albania. Total number of animals is unknown, but it is assumed on few thousands. Ljaba is, according to body size, similar breed to Zetska zuja. Height to withers is practically the same as for Zuja (57.5 cm), and average body weight is close to 40 kg. It has white face and legs thus name of breed is based on those characteristics (Picture 4). There are animals with long pale yellow spots at face. Sustaınable Sheep And Goat Productıon Based On The Local Breeds In Montenegro 417 Ljaba has relatively good potential for milk production, with milk yield in the whole lactation of 90 kg. Like Zuja, Ljaba is well adapted to the Mediterranean climate and to scarce nutrition during dry summer and during winter when animals are fed by inappropriate quantities of hay. Bardoka is a breed reared mainly in the North East part of Montenegro, alongside of border with Kosovo and Albania, areas in municipalities Plav, Gusinje and partly Podgorica. Bardoka is white and very coarse‐wool sheep, with white face and legs. Average live weight of the ewes is approximately of 45 kg, with height to withers of 63.2 cm (Picture 5). The average lactations yield of milk is 110 kg, but sometimes it can go up to 200 kg per lactation. This strain is characterized by long duration of lactation, even more than seven months. The fleece is opened with pointed and long staples (25 – 30 cm) and with very coarse fibers. Goat production It is an important livestock sector, especially for the least favorable areas of Montenegro, characterized by karsts relief with steep slopes and poor forest or bushes (areas of Niksic, Cetinje, Danilovgrad, Podgorica municipalities as well as coastline), where natural conditions do not allow rearing of other kinds of ruminants (cattle or sheep). According to the results of Agricultural census held in 2010, there were 3580 agricultural holdings reared goats, with total population of 35140 heads. Flocks with 1‐10 heads dominate in total population with share about 80% of total number of flocks and approximately 30% of total goat population, flocks with 10‐50 heads participate with 16% and 40% of population. Bigger flocks with more than 50 heads participate only by 4% in total number of flocks, but 30% of total goat population is in these flocks. 1600 1400 number of flocks 1200 1000 800 600 400 200 0 1-2 3-9 10-19 20-49 50-99 100-199 200 i > number of goats per flocks Graph 4: Structure of goat breeding sector Montenegrin goat production is characterized by extensive or semi‐extensive farming system where milk and meat are main products. The approximate share of milk is 55% and meat 45% in total income The goat’s population in Montenegro can roughly be divided into three groups: a) modern breeds (mostly Alpine and sporadically Saanen) and animals in their type; b) domestic Balkan goat with a few varieties in coat color; and c) crossbreds developed through unplanned crossing of different varieties of domestic Balkan goats breed with other breeds,. Balkan breed is dominant, especially in bigger flocks, while its crosses with Alpine and Saanen breed prevail in smaller flocks. th 418 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Domestic Balkan breed of goat originated from Capra prisca (Adametz), which was spread out in South‐eastern Europe. Very similar breed is reared in the other Balkan countries. It is typical primitive breed with very good adaptation ability to scarce nutrition and rearing conditions and resistance to diseases. Its main characteristics are: rough constitution, and long, tick and shiny coat. According to coat color, there are several different strains of domestic Balkan breed: red‐brown, considered as authentic representative of domestic Balkan breed in Montenegro; reddish/bay; even black, white or spotted. Majority of heads are horned (Picture 6). Average live weight of breeding animals is about 45 kg, height to withers 65 cm, milk yield 140 kg with 3,4% butterfat content in lactation lasted 217 days in average. Fertility is 1.2 to 1.3 kids per partum. In good conditions, this breed reacts very quickly by increasing the performance of fertility and milk yield. Annual production of goat meat (young goats, and meat of the mature and culled animals) is estimated at about 450 tons (table 2), where kid’s meat is the most important Annual milk production is estimated at about 4000 tons. Milk is usually used for processing in different type of cheeses. Table 2: Annual production of goat meat Category No of heads slaughtered Average live weight, kg Average carcass weight, kg Meat production, t Old, culled heads 6,000 45 19 114 Suckling kids 15,000 19 9.5 142 Older ‐ fattened kids 8,000 25 12.5 100 Fattened bucks 4,000 45 22.5 90 Total 33,000 27.3 13.2 446 Concluding remarks The above mentioned data and comments give a base to conclude that rearing of ruminants has and will have a very important role for Montenegrin livestock and the agriculture in general. Having in mind availability of land, relief and other important preconditions for sustainable production from one side, and latest trends and economic indicators from the other side, small ruminants (sheep and goats) will continue to keep their position in Montenegrin livestock sector just after cattle. Latest trends in tourism development will enable better market position for traditional local products based on sheep and goat’s milk and meat, what will generate further development of this sector. Migration presser from distant rural areas in one hand and the intention to implement new rural development policy harmonized with EU model of support to rearing of ruminants from the other will force government to continue and to increase support to this sector. As a final consequence, it would mean better environment for development of sheep and goats production in Montenegro. Sustaınable Sheep And Goat Productıon Based On The Local Breeds In Montenegro Picture 1. Pivska pramenka Picture 2. Sjenicka breed Picture 3. Zetska zuja Picture 4. Ljaba Picture 5. Bardoka Picture 6. Domestic Balkan goat 419 th 420 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) REFERENCES ADZIC, N., LJUMOVIC, M., (1981): Morphological and production characteristics of autochthonous goat from the rocky soil in Montenegro. 32nd Annual Meeting of the EEAP, Zagreb. ADZIC, N., LJUMOVIC, M., (1987): Tjelesne mjere i masa tijela ekotipova ovaca u Crnoj Gori. Zbornik radova Poljoprivrednog instituta . ADZIC N. AND MARKOVIC, B. (2003). Osnovne morfološke i proizvodne karakteristike zetske zuje. Savremena poljoprivreda. , 3‐4, (373 – 376). MARKOVIC, B., (1997): Proizvodne i reproduktivne osobine vaznijih varijeteta domace balkanske koze u Crnoj Gori. Magistarska teza, Beograd. MARKOVIC, B., (2004). Osobine mliječnosti i polimorfizam alfa S1 kazeina domaće balkanske koze. Doktorska disertacija, Poljoprivredni fakultet Novi Sad. MARKOVIC, B., ADZIC, N. AND MARKOVIC, M., (2006): Catalog of west Balkan pramenka sheep breed type – Pramenka breed type of Montenegro. Zemljodelski fakultet, Skopje. MARKOVIC B., MARKOVIC M. AND ADZIC N. (2007): The farm animal genetic resources of Montenegro, Biotechnology in Animal Husbandry 23 (3‐4), p 1 ‐ 9 . BOŽIDARKA MARKOVIĆ, MARKOVIĆ, M., MIRJANA DAMJANOVIĆ (2008): The milk production traits of balkan goat breed estimated by using a mixed linear model. 59th Annual Meeting of EAAP, Vilnius. Book of abstracts No. 14, page 196., MINISTRY OF AGRICULTURE, FORESTRY AND WATER MANAGEMENT and GTZ (2010): Meat Sector Study for the IPARD Programme, Podgorica, AGRICULTURAL CENSUS 2010: Structure of agricultural holdings, Key variables – land and livestock resources, Book 1, MONSTAT, Podgorica. MONGOLIAN BACTRIAN CAMEL AND SOME ISSUES IN ITS BREEDING AND CONSERVATION OF GENETIC RESOURCES D.Jantankhorol1, N.Togtokhbayar2 Animal Gen Fund Of Mongolia1, Mongolian State University Of Agriculture2 1. INTRODUCTION Livestock husbandry is a traditional sector of the national economy, and an important source of employment and export income for Mongolia. As of 2010 the agriculture sector employs around 40.0 % of the total labor force and produces 15.9 % of all GDP, of which 85.0 % is from livestock production. Mongolia has practiced extensive livestock production since ancient times and under extensive livestock management system, five species of livestock: horse, camel, cattle, sheep and goats have been used. This system is practiced till today. As of the end of 2010, 269.6 thousand head of camels, 1.9 million head of horses, 2.2 million head of cattle, 14.5 million head of sheep, and 13.9 million head of goats were recorded throughout Mongolia. National program on Mongolian livestock was approved in order to ensure the sustainability of this sector. The purpose of the program was to develop a livestock sector that is adaptable to climate change and social development and create an environment, where the sector is economically viable and competitive in the market economy, to provide a safe and healthy food supply to the population, to deliver quality raw materials to processing industries, and to increase exports. 2% of all world camel population, 30% of Bactrian camels are in Mongolia. However the destinies of camels, are become uncertain as numbers are declined dramatically (Figure 1, 2, 3). Therefore special measurements are needed for conservation of camel genetic resources. 2. BACTRIAN CAMELS IN MONGOLIA Mongolian camel is formed by national and natural selection in the Central Asian continental climate and approved as a breed of camel in 1990 (Tseveenjav D, Indra R, Luvsan B, Biichee N). 1. Distribution of camel population in Mongolia, 2010 th 422 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) There are three strains of camels as Khaniin khetsiin brown, Galbiin goviin red, Thokhom tungalag in Mongolia, differed each other by ecological, morphological and genetic characteristics (Table 1). 1.Khaniin khetsiin brown 2. Galbiin goviin red 3. Tokhom tungalagiin brown 2. STATISTICS ON CAMELS IN MONGOLIA 1. Camel productivity level, kg Breed difference Mongol camel Tokhom tungalag breeding group Khaniin khetsiin brown Galbiin goviin red 3.5 Age 6 and above 3.5 6 and above 3.5 6 and above 3.5 6 and above Productivity 300 3.8 Body Wool weight,kg yield, kg 410 6.0 270 420 3.2 8.5 275 4.5 440 7.0 280 460 3.5 8.0 Mongolian Bactrian Camel And Some Issues In Its Breeding And Conservation Of Genetic Resources 423 1. PRODUCTS DERIVED FROM CAMEL HERDS 4. THE MATING BEHAVIOUR OF MONGOLIAN CAMELS The reproductive behaviour of bactrian bull camel (Camelus bactrainus) become more aggressive during the rutting season. The mating behaviour of bull camel has preparative stage, sexual activity and final phases during the rutting season. The preparative (zengerleh) stage before sexual activity is an interval action of mating season, which is different from other ruminant animals. During sexual activity, the mating behaviour of bull camel is demonstrated by appearance of saliva foam at the mouth blowing, teeth grunting sounds, emitting a gurgling or blubbering vocalisation, flipping urine up over the back, the accumulation of dirt in the urine soaked hair fibres a crust on the back of hump, snuff secretion of poll glands as the typical symptom. The mating behaviour of bull camel Mating process The behavior of female camel changed calmness, quietness to unstable and movable in pasture, reducing of grazing time, looking into the distance at time and again, tears rolled down, th 424 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) emitting a sound, standing to look far away and have a seclusion of parturient female camel just before its parturition. This seclusion female camel carrying out what are vulva swelling up, have these muscles fall in croup, increasing size of a udder and teats and become thread hair. A female camels are uneasiness and a tendency to seek solitude by wandering from the herd immediately, lying down and getting up short time, lateral recumbence in right and lift‐side, urinating many times in small amounts, whinnying and bellowing a sound at calving action. 5. SOME ISSUES IN ITS BREEDING AND CONSERVATION OF GENETIC RESOURCES In the last 40 years, the camel population has declined 3 fold. There are several factors influencing on the camel resources as following: ‐ Unfavorable weather condition during the last 10 years and lack of nutrition due to the pasture desertification process ‐ Tradition of every she camel milking and camels use for draught purpose have been disrupted. Camel meat is valued. Herders slaughtered their camels in lieu of smaller animals to fulfill the meat quotas, calculated by weight, which must supply to cooperative. ‐ Breeding, caring, pedigree selection work is not sufficient ‐ There are certain breeding features that enable camels to mate only in winter. Female camels have a gestation period of 405 days. Artificial insemination is not used for camels. ‐ Rare numbers of camel researchers and scarce financial resources focusing on the research of quality, and quantity of productivity and management. ‐ Implementation of short term and scarce financing projects from Science and technology foundation of Mongolia ‐ Lack of output results of International projects, that were covering only wool, milk productivity and pasture survey 6. FUTURE TRENDS ON PROTECTION OF CAMEL GENETIC RESOURCES ‐ Deep research on camel breeding and protection of genetic resources by implementing international and domestic projects ‐ Development of Improving of traditional methods of camel herding system with modern technology ‐ To establish small and middle scale factories producing goods using camel wool, milk and other products ‐ To add voice in the development of Policy on camel genetic conservation and protection at national and international levels, and to set up association of camel protection at FAO REFERENCES 1. Baldan Tuntegiin., 2005, Theory and practices of breeding on Mongolian camels., Ulaanbaatar., 228 2. Batsukh Ts.,2010., Camel, propping up the sky, Ulaanbaatar, p.,21 3. Buyankhishig D., 2008., Mongolian camel., Mongolian pastoral livestock husbandry serials, 6th volume, Ulaanbaatar., p., 330 4. Bynie Bataagiin, 2002., The country report on animal genetic resources, Ulaanbaatar, p., 49 5. Tsegmid M., 2008, Mongolian livestock population., Ulaanbaatar, p., 52‐63 6. National Mongolian Livestock Program, approved by State Great Khural of Mongolia 7. Strategic plan of livestock breeding (2009‐2021)., 2009, Ulaanbaatar., p., 29‐33 8. The Cradle of folk song&music., 2011, Ulaanbaatar., p., 29‐33 GENETIC RESOURCES AND MORPHOLOGICAL CHARACTERISTICS OF CATTLE BREEDS IN KOSOVO H. BYTYQI*, H. MEHMETI1, S. MUJI1, M. THAQI1, A. JAHJA1, B. MEHMEDI1 and N. MESTANI1 1 Department of Biotechnology in Zoo technique, Faculty of Agriculture and Veterinary. University of Prishtina. Str. Boulevard “Bill Clinton” nn. 10000 Prishtina, Kosovo. *Corresponding author: hysen.bytyqi@uni‐pr.edu Abstract Cattle provide main components of human nutrition as milk and meat. In Kosovo, most cattle are kept as dual purpose breed used for both type of production. Generally, cattle stock in Kosovo is structured mostly by: Native Ilirian breed‐Busha, Meleza crosses (defined as crosses between Ilirian Busha and high productive breeds), Commercial breeds (Simmental, Holstein, Brown Swiss and Tyrol Grey). With the aim of identifying the most appropriate breed to maximize the profit to farmers, this study describe the genetic and morphological characteristics of cattle breeds in Kosovo and compare traits of the three cattle groups: Ilirian Busha, Meleza crosses, and commercial breeds under farming systems in Kosovo. If comparing cattle breeds in Kosovo, there is a clear evidence of genetic performance variations between them. Normally, this variability lies among the Ilirian Busha, Busha crosses and commercial breeds. While commercial breeds produce more milk (> 20.0 kg/day), the Ilirian Busha and its crosses are better on longevity (< 10 years of age), better resistance to diseases, easy calving, good fertility, low feed requirements, higher product quality, and adaptive to mountain and pasture areas in Kosovo. Keywords: Cattle breed, farming system, crosses, performance, and commercial breeds. Introduction Cattle are the main sources of milk and meat production in Kosovo, including various breeds, crosses and categories. This industry consists of two sectors: small‐scale (about 95%), mainly producing for home consumption and commercial farmers (about 5%) producing solely for the market (Bytyqi et al. 2007). Small farming system is dominated by Ilirian Busha and its crosses, while commercial dairy farms mainly are found breeds as: Holstein (Black and Red), Brawn Swiss, Simmental, and some mountain areas in Kosovo Tyrol Gray can be found as well (Bytyqi et al. 2009). Until the year 1990 private farmers or private economy owned 90% and only 10% was under state management. Nowadays, all cattle in Kosovo are bred by private farmers. During the 1998‐99 war, farmers in Kosovo lost 200.000 cattle, or approximately half of the national cattle herd, (Kodderitzsch and Veillerette, 1999). As part of Emergency Operations and in order to improve the nutrition and food security of poor households‐ affected by the conflict, many international organizations were involved in cattle importation in Kosovo. Nowadays, the trend of importation and multiplication of high productive breeds is continuing by commercial farms. The objective of the study is twofold. Firstly, to describe genetic and morphological characteristics of cattle breed in Kosovo. Secondly, to compare traits of the three group breeds (Ilirian Busha, Ilirian Busha crosses and commercial breeds) under farming systems in Kosovo with the aim of identifying the most appropriate breed to maximize the profit to farmers. th 426 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Table 1. Presents numbers of cattle in Kosovo Species 1990 year / head (a) 1999 year /head (b) Loses (%) (b/a x 100) 2002 year / head (c) Increase (%)(c/b x 100) 2010 year / head (d) Increase (%)(d/c x 100) Cattle 421.000 163.000 61.28 189.563 16,29 264,000 39.27 Milking cow and pregnant heifers 300.000 119.000 60.33 155.000 30.25 180,000 16.13 ‐ Figures for the year 1990 and 1999 are taken from the report Damage and needs assessment in ‐ Agriculture, FAO/The World Bank, September 1999; ‐ Figures for the year 2010 are taken from the Kosovo Ministry of Agriculture. Ilirian cattle Busha ‐ Indigenous breed (Local name “Gjedhi Ilir Busha”) In lack of a wild ancestor, the local breeds represent a genetic resource (Medugorac et al. 2009). Therefore study of those breeds is with interest to animal genetic diversity and further development. Ilirian Busha cattle live in the Kosovo and the Balkans since Neolithic age. It is adapted to harsh environment, extensive grazing and low quality forage. Ilirian Busha is the only autochthonous Kosovo cattle breed which provides genetic bases for majority of crosses existing in two cattle management sectors. It has been bred for centuries in this area (Illyrian cattle) and belongs to a group of primitive short horned cattle (Bos Brachyceros Europaeus). After the cattle production commercialization, nowadays pure Ilirian Busha is very rare breed, generally found in mountainous and hilly areas and in the last few years has started to rise up the attention of the professional, farmer and other stake holder. It is characterized with compact body conformation, very resistant to disease, internal and external parasites. Main strength of this breed is that survives well under minimum levels of management and low feed requirements and thrives on natural grazing. This breed has excellent maternal traits and easy calving. Since that did not exist any improved breeding and management program carried on among Ilirian Busha cattle the expected success and real performances of this cattle are not explored, yet. This had been largely determined due to lack of consolidation of the breed, non‐existence of breeding programs and low concern of the general and professional public in Kosovo. In Kosovo are found two types of Ilirian Busha strains, Ilirian Sharri Bush and Ilirian Dukagjini Busha (Kugler, 2009). Ilirian Dukagjini Busha (Local name “Busha Ilire e Dukagjinit”): In generally the living areal of this cattle are the Western part of Kosovo (Gjakova, Deqani, Istog, Peja and Klina). Due to better climate conditions (semi‐continental), this strain is characterized by higher production and bigger size animal in comparison with Ilirian Sharri Busha strains. Nowadays, population size of this animal is considered less than 1000 head and risk status endangered. The coat colour is intensive red, sometimes dark red, head small and narrow, mug is often dark coloured with some white or black hair around. Horns lyre shaped horns. Live weight of matured animals ranges between 340‐380 kg/head, and height between100‐120 cm. Ilirian Dukagjini Busha is used for milk, yielding 1.200 – 1.800 kg/lactation (<3.6% fat and 3.1 – 3.5% protein), and meat, characterized with growth rate of calves about 600 – 700 g/day. The lactation period is short and ranges between 240 ‐ 280 days. Genetic Resources And Morphological Characteristics Of Cattle Breeds In Kosovo Figure 1. Ilirian Dukagjini Busha strain 427 Figure 2. Dukagjini Ilirian Busha strain in stable Ilirian Sharri Busha (Local name “Busha Ilire e Sharrit”): Characteristically it is of red skin color (sometimes yellowish, with a nuance of dark–red). Nowadays, population size of this strain is less than 1000 head and considered under the risk status endangered. Heifers get first insemination at approximately16‐18 months, mature cow’s average height at shoulder about 110 cm and live weight about 340 kg/head. Milk production per lactation averages 1.000 ‐ 1.400 kg/head (3.5‐5% fat and 3.1‐3.5% proteins) which make this breed very efficiency in milk production in comparison to its body mass. The lactation period is short and ranges between 240 ‐ 280 days. Body weight of calves at birth ranges from 15 ‐ 22 kg and daily growth rate about 500 g/day. For reason of non‐existing any breeding program and semen collection from AI centers in the country or elsewhere, there where pure Ilirian Busha cattle are found a natural mating is the only insemination used. Long winter period in the mountains area where Ilirian Busha lives makes cattle about six month inside the stables. Figure 3. Ilirian Sharri Busha cattle Figure 4. Just calved Sharri Ilirian Busha cow (triples) “Meleza” cross breeds Last thirty years with the importation of other breeds into Kosovo, Ilirian Busha breed has been often crossed with different breeds, mainly Simmental, Holstein and Brown cattle. There is no genetic information exists whether there is a significant phenotype difference between real Ilirian Busha and its crosses. Clearly, no program has existed to guide breeding system and crossbreeding has happened purely uncontrolled, mainly by local bulls as Artificial Insemination is used only less than 50% by the farmers. However, this crossbreed has improved influence to productive and reproductive treats of Ilirian Busha. Nowadays, the crosses between these breeds and the Ilirian Busha represent about 70% of cattle population and are known as “Meleza” where the influence of the different breeds is well recognized, in which the Simmental phenotype is dominant, followed by Holstein. th 428 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Figure 5. Meleza crosses and mixed breed herds Figure 6. Pastures resources in Kosovo Native Red and White (Motley) cattle as type Simmental (Local name “Gjedhi vendor Bardhe e Kuq”). Actually there are two types of Native Red and Weight “Meleza: crosses: Crosses between native Ilirian Busha X Simmental breed and Crosses between native Ilirian Busha X Red Holstein breed. The Ilirian Busha X Simmental crosses lives in plane area of Kosovo and is very spread cow all over Kosovo, as well. These cattle are very adaptive on natural conditions feeding and management. This cow population is characterized with a smaller and low production characteristics compare with original Simmental. Phenotypes characteristics of this cow are: original colour of the skin is white with big or small nuances white – red or intensive red colour. Horn and hoofs are blue colour. Average live mature cattle body weight is 300 ‐ 400 Kg. Average milk production per lactation of approximately 3.000 Kg. Calf body weight at birth of 35 – 40 Kg. Average growth rate of beef per day of 800 – 1.000 g (unpublished data). The second type of Red and White crosses is often described as “Simmental” but in fact is a cross between local breed and Red Holstein). This cattle population used to live in plane area and it is spread cow in Kosovo. General performances of this cow are: original colour of the skin is white with big or small nuances white – red or intensive red colour. Head is always white colour. Horn, and hoofs are blue. Average high‐body of this breed is 148 cm. Average live mature cattle body weight is 400 ‐ 500 Kg. Average milk production per lactation of approximately 4.000 Kg. Characteristic of short lactation period 280 – 305 days/lactation. Calf body weight at birth approximately 40 Kg. Average growth rate of calves per day of about 900 g (unpublished data). Figure 7. Ilirian Busha x Simmental crosses Figure 8. Ilirian Busha and Red Holstein crosses Genetic Resources And Morphological Characteristics Of Cattle Breeds In Kosovo 429 Local Brown Cattle ‐ (Local name “Gjedhi vendor i Murrem”) This cow is also locally known as “Montafon”, which is a breed originating in Slovenia as a cross between indigenous brown cattle with Brown Swiss. These animals were brought to Kosovo in the 50’s and crossed with local cattle. Since that time, Montafon breed was crossed with native Ilirian Busha breed and quite well adapted under the local management condition. General phenotype characteristics of this cow are: Is smaller and lower production characteristics compare with Original Simmental. Original colour of the skin is dark brown. Average live mature cattle body weight is 350 ‐ 450 Kg. Average milk production per lactation of approx. 2.300 Kg. Calf body weight at birth of 30 ‐ 35 Kg. Average growth rate of beef per 12 months old is 350 – 400 Kg live body weight (unpublished data). Figure 9. Ilirian Busha x Brown cattle crosses Kosovo Black and White cattle (Local name “Gjedhi vendor Bardhe e Zi”) There is a group of black and white animal cows population in Kosovo, showing a Holstein Friesian (HF) background but often they represent the characteristic Simmental white heads. This cattle population of Black and White cow lives in plane area of Kosovo and because of average milk production per lactation of approximately 4.500 Kg is hardly adapted under poor management condition. The lactating cows of this crossbred are characteristic of lactation period approximately 305 days. General performances of this cow are: Original colour of the skin is white with big or small nuances white – red or intensive red. Horn and hoofs are blue. Average high‐body of this breed is 130 cm. Average live mature cattle body weight is 500 ‐ 600 Kg. Calf body weight at birth approximately 40 Kg. Average growth rate of beef after 12 months is about 400 Kg live body weight (unpublished data). Figure 10. Ilirian Busha x Black and White cattle crosses th 430 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Imported Cattle breeds After the year 1999 has been imported in Kosovo about 20.000 of high productive cattle breeds (Holstein (Black and Red), Brawn Swiss, Simmental, and Tyrol Gray) from different countries (mainly from Austria, Germany Switzerland etc.). Today, together with their offspring make about 20% of total cattle population in Kosovo. Their performances and general production characteristics are well described in Bytyqi et al. (2005, 2009). Table 2: Comparison characteristics of Old type, Crossbreeds and Commercial breeds Ilirian Busha Breed Ilirian Busha Crosses Commercial Breeds Small size; small body weight Larger and heavier than old type breeds pure breed Large; high body weight Low milk production (about 8.0 kg/day) Average milk production (12.0 kg/day) High milk production (< 20.0 kg/day) Low feed requirements Average feed requirements High feed requirements High fertility Better fertility than commercial breeds Middle or bad fertility Easy calving Calving problems when crossed in breed is to large Sometimes present problems in calving Resistant against illnesses and parasites Higher resistance than commercial breeds Low resistance against illnesses and parasites Longevity < 10 years age Longevity about 7 years of age Longevity > 5 years of age Conclusions The study of deferent traits of Ilirian Busha cattle, including variety of strains and high productive cattle presented in this study, specific to the regions where these cattle breeds live, would be a contribution to the overall genetic diversification of cattle and economic growth in Kosovo. When comparing different breeds for genetic and morphological characteristics it shows that some cattle perform well under harsh environments and have goof fertility, others have higher production capacities presenting a clear evidence of genetic performance variations. Establishing a breed conservation programs for endangered breeds, determining breed or strain standards, design of breeding and management programs, supported by governments and other organizations specialized in this field is an emergency step in order to keep constant the breed diversification and development in future. LITERATURE Bytyqi. H., Klemetsdal, G., Ødegård, J., Mehmeti, H and Vegara, M. 2005: A comparison of the productive, reproductive and body condition score traits of the Simmental, Brown Swiss and Tyrol Grey breeds in smallholder herds in Kosovo. Anim. Genet. Res. Inf. 37:9‐20. Bytyqi, H., Rustemi, M., Mehmeti, H., Kryeziu, A., Gjinovci, V and Gjonbalaj M. (2009) Milk production in Commercial cattle dairy farms in Kosova. Professional Journal “ Stocarstvo “ Zagreb Coratia, Volume: 63: ( 4 ) 275 – 285. Bytyqi. H., Ødegård, J., Mehmeti, H., Vegara, M and Klemetsdal, G. (2007) Environmental Sensitivity of Milk Production in Extensive Environments: A comparison of Simmental, Brwen Swiss and Tyrol Grey using Random Regression Models. Journal of Dairy Science, 90: 3883 – 3888. Genetic Resources And Morphological Characteristics Of Cattle Breeds In Kosovo 431 Medugorac, I., Medugorac, A., Russ, I., Veit‐Kensch, C.E., Taberlet, P., Luntz, B., Mix, H.M and Förster, M. (2009) Genetic diversity of European cattle breeds highlights the conservation value of traditional unselected breeds with high effective population size. Molecular Ecology 18, 3394–410. Mehmedi. B.,, Lahu, F., Mehmeti, H., Bytyçi, H and Krasniqi, I. (2008) Age and Body Condition Scoring of Heifers on First Insemination under Kosova Managerial Conditions. Scientific Session, The University of Prishtina ‐ The Faculty of Agriculture. Ministry of Agrculture, Forestry and Rural Development (MAFRD)‐Livestock Division. (2010) A strategy for sustainable agriculture and rural development in Kosovo (personal communication). Kodderitzsch, S and Veillerette, B. (1999) Kosovo: Re‐launching the Rural Economy. A medium term reconstruction and recovery program. ECSSD Environmentally and Socially sustainable development. The World Bank working paper No. 19. Kugler, W. (2009) “Rare Breeds and Varieties of the Balkan Atlas 2009” Synonyms, Occurrence, Description of Rare Breeds in the Balkan Region. Monitoring Institute Heidehof Foundation,Stuttgart, Germany. pp, 97‐ 105. THE GOAT RESOURCES IN KOSOVO H. BYTYQI*, M. THAQI1 AND F. KRASNIQI1 1 Department of Biotechnology in Zoo technique, Faculty of Agriculture and Veterinary. University of Prishtina. Str. Boulevard “Bill Clinton” nn. 10000 Prishtina, Kosovo. * Corresponding author: hysen.bytyqi@uni‐pr.edu Abstract Kosovo has great natural potential for development of goat husbandry and providing high quality food products, currently for domestic needs and world market in future. Goat breeding and production, is of great importance especially for hilly mountainous regions of Kosovo. Goat husbandry system is of extensive (about 98%) and just about 2% are considered to have semi‐ intensive management conditions. From total number of goats bred in Kosovo, about 90% are of goats are of the local Balkan type, represented by few strains having almost the same production performances and characteristics. The remaining 10% of goats are mainly crosses of Balkan type with foreign breeds and pure high productive goat breeds, primarily, Alpine breed. The autochthon goat is kept for dual purposes (milk and meat). Last two years there is trend of increasing the number of goats for about 88.6% and this trend is accompanied with stimulation measures for intensifying small ruminant production undertaken by the Ministry of Agriculture, Forestry and Rural Development of Kosovo (MAFRD). Due to increased demand for goat products and the action carried out by the Ministry in the last two years the interest of breeders in improving and intensifying production has been increased. Keywords: Goat husbandry, autochthon goat, crosses, performance, and dual purpose. Introduction It is quite certain that the goat was one of the earliest domesticated animals in World. Goat breeding in Kosovo was developed under specific periods and conditions. It is important to mention that there were two periods affecting the number of goats in the Kosovo: Firstly, as in other countries of ex‐Yugoslavia, Kosovo goat industry faced with the Law of the year 1953, which has forbidden the goat keeping due to some unrealistic judgments (i.e., protect the forest, etc). Particularly, from 1953 to 1976, nothing was done for the improvement of the local Balkan goat in Kosovo. After this period the interest for the goat husbandry has increased, mostly in regard to economic interest in kid exports to some European and Arabian countries. Second period of goat number decrease was during the period 1990‐1997 when due to start of conflict in ex‐Yugoslavia the goat product market was lost (particularly during the economic embargo). During this period the number of boats decreased for about 32.5. And, war period 1998‐ 99, where the total goat found was decreased for about 63% (Kodderitzsch and Veillerette, 1999). Since the number of goats was not statistically recorded, it was based mostly on free approximate calculations in the past. In the year 2011, according to the national Identification and Registration (I&R) of goat project conducted, the number in Kosovo is 26.349 head including all categories (MAFRD, 2011). The most poor feedstuff and hilly mountains regions are areas where goats are usually raised in Kosovo. During the period 1990‐99, the export of goat products was almost closed therefore this has had negative influence and decreased the interest of farmers to raise goats. Since the year 2002, the trend in goat production in Kosovo is increasing slowly, due to increase of domestic consumption of the goat products. Nowadays, the goats are raised on private farms which usually have from 10‐50 heads per farm. Only a small number of farms, raise from 50‐ 200 goats. th 434 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The objective of the study was to describe genetic and morphological characteristics of Balkan local goat and trends of development in Kosovo. Table 1. Number of goat in different periods in Kosovo Specie Goats 1990 year / head (a) 1997 year /head (b) 40.000 27.000 Decrease (%) 1999 year /head (c) (b/a x 100) 32.5 10.000 Loses (%) (c/b x 100) 63.0 2002 year / head (d) Increase (%)(d/c x 100) 2010 year / head (e) Increase (%)(e/d x 100) 14.000 40,0 264,000 88.6 Figures for the year 1990, 1997 are taken from the statistical yearbook of Yugoslavia in the report of FAO/The World Bank; Figures for the year 1999 are taken from the report Damage and needs assessment in Agriculture, FAO/The World Bank; Figures for the year 2002, 2010 are taken from the Kosovo Ministry of Agriculture – Livestock Division. Balkan Goats breed characteristics The Balkan autochthon goat is very spread animal all over the Balkan region and Kosovo as well. This breed is generally found in mountainous and hilly areas and in the last 10 years has started to rise up the attention of the professional, farmer and consumers and other stake holder. It is characterized with compact body conformation, very resistant to disease, internal and external parasites. Main strength of this breed is that survives well under minimum levels of management and low feed requirements and adaptive on natural grazing (Memisi et al. 2004). This breed has excellent maternal traits and easy kidding. Table 2. Morphological characteristics of autochthon Balkan goat (Kugler et al. 2010) Traits Characteristics Milk yield (kg/lactation) 80‐130 Fat (%) 3.6 – 3.9 Protein (%) 3.0‐3.3 Lactation period (days) 180 Fertility (%) 120 Live weight males/females (kg) 50/ 35 Kids live weight at 6 months of age reach (kg) 30 Height (cm) 65 Horns males horned, ewes mostly polled Coat white with different nuances of black, red, yellowish‐red, black Use dual purpose (milk, meat), skins and hair were also used The Balkan local goat is characterized by low milk production varying from 80‐130 Kg per lactation (unpublished data). Since that did not exist any improved breeding and management program carried among the goat the expected success and real performances of this cattle are not explored, yet. However, there is Increasing interest of farmers to crossbreed with Alpine goat to increase production. The Goat Resources in Kosovo 435 . Figure 1. Autochthon Balkan goat (spotted type) Figure 2. Autochthon Balkan goat (white type) Figure 3. Autochthon Balkan goat (yellowish type) th 436 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Imported breed (Alpine goat) From the year 2000, through some international organization there were bought to Kosovo a few flocks of Alpine breed (mainly from France and Switzerland). Up to now the performance of this breed is more less the same as from their home country. However, the study of the Alpine breed performance including many traits and possible deviations from their homeland would be of interest for farmers in Kosovo. Conclusions Goats are domestic animals that produce very efficiently under low feedstuff requirements. By knowing this fact, the future efforts should be devoted to improvement of nutrition and husbandry, breed composition for the places where the intensive goat production can be organized, diversification and promotion of goat products and its qualities, and health care of goats. A better developed goat production could provide significant contribution to the Kosovo rural families managing goats and therefore developing goat production export opportunities. LITERATURE Kodderitzsch, S and Veillerette, B. (1999) Kosovo: Re‐launching the Rural Economy. A medium term reconstruction and recovery program. ECSSD Environmentally and Socially sustainable development. The World Bank working paper No. 19. Kugler, W. (2009) “Rare Breeds and Varieties of the Balkan Atlas 2009” Synonyms, Occurrence, Description of Rare Breeds in the Balkan Region. Monitoring Institute Heidehof Foundation,Stuttgart, Germany. pp, 97‐ 105. Memisi, N., Bauman, F., Stojanovic, S., Pavlov, B and Jovanovic, S. (2004). Production characteristics of domestic Balkan goats. Animal Genetic Resources Information, No. 35: 87‐94. Ministry of Agrculture, Forestry and Rural Development (MAFRD)‐Livestock Division. (2010) A strategy for sustainable agriculture and rural development in Kosovo (personal communication). CONVERSATION OF FARM ANIMAL GENETIC DIVERSITY IN PALESTINE Iyad Badran National Agriculture Research Center‐Ministry Of Agriculture And Eng. Muayad Salman‐Ministry Of Agriculture INTRODUCTION Animal genetic resources have been contributing to food and agriculture for more than 12.000 years, providing human population with wide range of food products, as well as fiber, fertilizer for crops, manure for fuel and draught power. Palestine (West Bank and Gaza Strip) locate in the Near East region, between 29o and 33o north latitude and 35o and 39o longitude, with an area of 6225 km2 as a total area (area of West Bank include East Jerusalem is 5572 km2). Palestine has a Mediterranean climate with a cold rainy winter and hot dry summer. Average rain fall between 150 mm in south east to 700mm in the north. West Bank consists of four agro‐ ecological zones: semi costal, central high lands, eastern slopes, and Jordan valley. (PMoa, 2000) Large number of Palestinian people depends on farm animal species for their livelihood; the following farm animal species are use in food and agriculture: Cattle, sheep, goat, avian, rabbits, Camels, Ass, and Hoarse. Main products of farm animals are meat, milk, and eggs. Intensive farm system is use in poultry and cow rising to meet the demand for animal products, such as milk, meat and eggs, semi extensive management as will as Bedouins is also use for sheep and goat. However harsh environmental conditions and high price of feed led to keep breeds will adapted to such conditions like fat tail sheep and local goats. LITERATURE REVIEW Maintenance of genetic diversity is an important issue in animal breeding (Oldenbroek 2007). Most of the regional breeds are kept in relatively small numbers, which can lead to rapid increase of inbreeding and thus to loss of genetic diversity The world relies on 40 animal species consisting of 4500 breeds for its food supply (Barker, 1999). However, nearly 800 farm animal genetic resources have been lost and about 30% of all those remaining are associated with some degree of risk according to FAO (Scherf, 2000). This means that rate of animal genetic resources declining in critical levels. The industrialized nations have responded with a trend towards fewer but larger farms with only a small number of breeds or populations of animals. These animals are bred and managed for the production of commercial stock with desirable morphological characteristics and outstanding production performance (Shrestha, 2004). large number of livestock and poultry populations have become endangered while many are extinct because of their failure to adapt to the changing environment (Shrestha, 2004) Genetic diversity of Livestock has a risk of being lost, keeping the existed genetic diversity of farm animals is necessary for increasing production efficiency with minimal environmental impact. In the analysis of global data bank for farm animal genetic resourches breeds are classified into one of seven categories of extinct, critical maintaned, endargered, endargered maintained not at risk, unknown. if anybreed has total number of breeding female is less than or equail to 100 and total number of breeding male is less than or equal to five is called critical breeds. If a breed has total number of breeding females and males are greater than 1000 and 20 respectively is called not at risk. Endangered breeds have theese figures as 100‐1000 breeding females and 5‐20 breeding males. (Soysal et al, 2003). th 438 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) ARE BREEDS AT RISK IN P ِ◌ALESTINE? According to Ministry of Agriculture, Sheep, goat, and commercial cattle breeds as will as commercial poultry breeds are not at risk, but unfortunately no information is available about local cattle’s and other farm animal breeds. Available information indicates that local cattle disappear rapidly since more than 20 years ago. Commercial cattle breeds such as Holstein Frisian become the dominant cattle breeds, as will as commercial poultry breeds which are use instead of local breed. Local poultry breeds still present in rural community, but no information if it’s confirmed at risk or not. Also other avian breeds (Turkey, Goose, Duck, etc.) which were used in the past by most rural community are rarely seen today. To conserve farm animal breeds in Palestine, efforts need to count these breeds first, then to put programs to reserve them. These efforts should be implemented by the government, NGOS, Universities, and research stations. PLANS AND POLICIES FOR CONSERVATION OF FARM ANIMAL GENETIC RESOURCES: Little information is available about cattle and avian breeds in Palestine, local cattle’s and birds replaced by commercial cows and poultry which take place by private sector. Only programs to maintaining sheep and goat were held by government and NGO, while no plans to reserve other farm animal species by any sector. Sheep is the major small ruminant in Palestine and contributes a larger source of meat and milk as compared to goats. According to PCBS the total number of sheep in West Bank during the year 2007/2008 reached 639,159. Awassi represents the major sheep breed (68%), while Assaf and other breeds and crosses ranked second (32%). The average size of sheep flock in the West Bank is relatively small and varies from location to another. The largest average flock size was found in Jericho followed by Ramallah, Nablus, Hebron, Bethlehem, and Jenin (average sizes were 59, 36.4, 32, 30, 22.6, and 21 for these districts, respectively; PCBS, 2007). This small flock size makes it difficult to improve productivity of sheep and increase inbreeding within the flock. In 1999, an intergovernmental agreement for a Regional Agricultural Program was signed by Egypt, Israel, Jordan, and the Palestinian Authority with Denmark as initiator and main funder. In 2005 phase two of Middle East regional program started in Palestine, the direct objective was to increase meat and milk production of sheep breeds, the indirect objective was to preserve and maintain genetic diversity of sheep breeds in Palestine. In this study we will analyze sheep breeds data collected from 2003 to 2010 and review the main results in case of genetic diversity of sheep breeds in west Bank. Conversation of Farm Animal Genetic Diversity in Palestine Figure 1. Map of the West Bank. 439 th 440 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) IMPORTANCE OF CONSERVATION OF SHEEP BREEDS GENETIC DIVERSITY: Conservation of sheep breeds genetic diversity in Palestine is essential for many reasons; mainly because they are the only breeds kept by farmers and small holders, other reason is to meet the increasing demand of meat and milk, as well as genetic diversity is very important when conducting selection program. More than one breed is required due to diversity among environment in Palestinian territories, a breed fit will in north don’t fit in south and so on. The following section will demonstrate sheep breeds participatation in the middle east regional program in West Bank MATERIALS AND METHODS: • Data were collected from the demonstration farms participating in the Small Ruminant Middle East Regional Program in the West Bank (2003‐2010). • Under this project, all records were validated and stored by technicians of the Ministry of Agriculture using ‘Ewe and Me’ software. In this study we undertook the analysis of the data collected from the demonstration farms under the Small Ruminant Middle East regional program in the West Bank Sheep breeds, lines, and crosses, in these farms were: Local Awassi, Improved Awassi, Assaf, crossbred between Assaf and local Awassi, and one farm had a flock with the Booroola fecundity gene (FecB+ Awassi). Information of sheep Breeds Genetic diversity in West Bank: 1. Awassi • Name of breed is Awassi, Local Name is Ballady. • Found in all over west bank but in great extend in south of west bank (Jerusalem and Hebron). • Origin is Palestine and most of the Middle Eastern countries. • White color with brown head and legs. Conversation of Farm Animal Genetic Diversity in Palestine 441 • Weight of adult male about 70‐80 kg and female from 45‐60 kg. • Birth weight from 2.8‐3.3 kg • Data collected between 2005 ‐ 2010 • Total number of ewes in the analyzed data was 448, population number in West Bank 435,169 (BCPS, 2008). Decreasing Population size. • Percentage of females bred to males of the same breed 90%, 10% respectively. • Milk production range from 108 to 177 kg per year. • Meat production from 1.01 to 1.12 lambs alive per year. • Adapt will in harsh condition and scarcity of feed. • Semi extensive management system. 2. Improved Awassi: It’s a local Awassi improved by heavy selection. • Name of this line is Improved Awassi. • Found mainly in BetQad Governmental station in Jenin. • White color with brown head. • Weight of adult male about 80‐100 kg and female from 50‐70 kg. • Birth weight from 4.5‐5 kg • Data collected between 2003 – 2010. • Total number of ewes in the analyzed data was 153, unknown population Size in West Bank . • Percentage of females bred to males of the same breed 80%, 20% respectively. • Milk production 170 kg per year. • Meat production 1.18 alive lambs per year. • There is no information about its adaptability in different environmental condition. • Intensive management system. th 442 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) 3. Afec‐Awassi line: Improved Awassi line carrying the Fec‐B+ gene. • Name of this line is Afec‐Awassi. • Found mainly in BetQad Governmental station in Jenin and some flocks in Nablus and Hebron. • White color with brown head. • Weight of adult male about 80‐100 kg and female from 50‐70 kg. • Birth weight from 4‐4.7 kg • Data collected between 2008 – 2010. • Total number of ewes in the analyzed data was 26, unknown population Size in West Bank. • Percentage of females bred to males of the same breed 80%, 20% respectively. • Milk production 185 kg per year. • Meat production 1.59 alive lambs per year. • There is no information about its adaptability in different environmental condition. • Intensive management system. 4. Assaf : crossbred between Awassi and East Frisian. • Name of the Breed is Assaf. • Found in all over west bank but in great extend in north of west bank (Jenin, Qalqeelia). • White color with white head and legs. • Weight of adult male about 90‐120 kg and female from 60‐80 kg. • Birth weight from 4.3‐4.7 kg • Data collected between 2004 – 2010. Conversation of Farm Animal Genetic Diversity in Palestine 443 • Total number of ewes in the analyzed data was 407, there is no exact number about population size in west Bank. • Percentage of females bred to males of the same breed 90%, 10% respectively. • Milk production range fro 185 ‐275 kg per year. • Meat production from 1.25 – 1.55 alive lambs per year. • Sensitive to harsh environment condition and scarcity of feed. • Intensive management system. 5. Awassi x Assaf crosses : crossbred between Awassi and Assaf • Name of the Breed is Crossbred, local name Machala’. • Found in all over west bank. • Mixed color. • Weight of adult male about 90‐120 kg and female from 60‐80 kg. • Birth weight from 4‐5 kg. • Data collected between 2004 – 2010. • Total number of ewes in the analyzed data was 803, there is no exact number about population size in west Bank. • Percentage of females bred to males of the same breed 90%, 10% respectively. • Milk production range from 175 ‐328 kg per year. • Meat production from 1.08 – 1.76 alive lambs per year. • Moderate sensitivity to harsh environment condition and scarcity of feed. • Intensive management system. th 444 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) CONCLUSIONS: From the survey and the data analysis of the previous studies we can conclude the followings: • there is no enough information about genetic diversity of farm animals in Palestine. • No plans to conserve genetic diversity of farm animals, the only species studied by ministry of Agriculture were sheep. • Three sheep breeds, and two lines only found in west Bank. • Preservation of farm animal genetic resources is responsibility of government and private sector. RECOMMINDATIONS: We recommend the flowing: • More efforts should be done to conserve farm animal breeds in Palestine. • National program to reserve farm animal genetic diversity must be established, and cooperation from all sectors related to agriculture are needed especially between universities and agricultural association. • Also we recommend that research center for animal genetics should be established. REFERENCES Barker, J.S.F., 1999. Conservation of livestock breed diversity.AGRI 25, 33–43. FAO / UNEP (1995). World Watch List for Domestic Animals Diversity. Second Edi. Rome, Italy Oldenbroek, K. (2007). Utilisation and conservation of farm animal genetic resources, Wageningen Academic publishers, Wageningen, TheNetherlands. PCBS (Palestinian Central Bureau of Statistics). (2007). Agricultural statistics 2006/2007. Ramallah, Palestine. PCBS (Palestinian Central Bureau of Statistics). (2008). Agricultural statistics 2007/2008. Ramallah, Palestine. Scherf, B.D. (Ed.), 2000. World Watch List of Domestic Animal Diversity, third ed. Food and Agriculture Organization of the United Nations, Rome, Italy, p. 726. Shrestha, J.N.B. 2004. Conserving domestic animal diversity among composite populations. Small Ruminant Research 56 (2005) 3–20. Soysal, M. İ. , E. Özkan, E. K. Gürcan. 2003. The status of native farm animal genetic diversity in Turkiya and in the world. Trakia Journal of Sciences, Vol.1, No 3, pp 1‐12, 2003. THE DIVERSITY OF GEORGIAN LOCAL CATTLE Prof. Levan Tortladze, Dr. Giorgi Khatiashvili According to UNO General Assembly resolution, food safety is defined, as “Provide of Constant and assured availability for all people throughout the world in such capacity of the world food resources, which is necessary for active and healthy life.” This interpretation is considered to be a definition of International Food Safety. Georgia was never provided by locally produced animal products. A cattle breeding is the ancient and traditional field of agriculture. It is confirmed by many archeological, historical, ethnographical and craniological investigations. All kinds of agricultural animals bred in Georgia are represented as aboriginal breeds. Endemic breeds are also met. Georgia could be considered as the oldest breeding ground of cattle. According to archeological data, Georgian tribes prepared butter in clay ware during Eneolith period, while Greek people did not even know the existence of butter. In the IV century B. C. Hippocrates described firstly the Scythian rule of butter preparation in the wooden ware. It was called “Buttiron”. Then this name spread through the whole West Europe. In Georgia the butter beater was used in earlier centuries, but it was made not of wood, but of burnt clay, which is more high quality material. The bones of domestic cattle are found as a result of archeological dig, which are dated back the 5‐th millennium B. C. It is more than 7000 years, since the cattle, formed from the domestication of wild animal ‐ aurochs, serve Georgian people. Except providing by food products, cattle were also used as a draught force by Georgian peasants, which ensured the development of agriculture in Georgia since the oldest times. In Georgia the indicators of average productivity of cattle were low even during the previous period of crisis, in 1989 the average milk yield of cow in all category farms of the country was only 1275 kg, their population was 588 000 and totally 714 000 tone of milk was produced. During Soviet period cattle‐breeding gave the republic more than half of total livestock production (currency). Nowadays the genetic resources of local cattle in Georgia are represented by three breeds: Georgian Mountain Cattle, Red Megruli and Caucasian Nut Brown. Georgian Mountain Cattle is an oldest breed, first of all, of milk direction. It is also used as beef cattle and draught force. The bones of the analogical cattle are found in Georgia in the result of archeological dig and it is dated back the III millennium B. C. During Soviet period the number of Georgian Mountain Cattle in the social sector composed 16.2% of the cattle total population. Presently it is preserved on the Southern slopes of Caucasus mountain range and in mountainous Ajara. The extension zones of this breed are rich of rivers and brooks heads, we rarely meet plains. The climate is stern – absolute minimum reaches to – 25‐300C. The amount of annual precipitations composes 900‐1500 mm. Stern and snowy winter continues for 5‐7 months. In the most zones of extension the bent of pastures reaches 30‐350 and other cattle could not use it, except Georgian Mountain Cattle. Peasants mow down and cultivate the land on these bent places half hung, with a rope on their waist, not to slip. The winter food of Georgian Mountain Cattle is very few, which is caused by the lack of arable lands and stern climate. In many mountain villages the arable lands compose 3‐5% of the total land area, unused rocky slopes, mountain ranges, forests and natural pasture‐arable lands occupy the great part of the territory. The pasturage period of Georgian Mountain Cattle lasts mainly from May till the end of October. If the pasture is in the high mountains, the pasturage period is small. These pastures are characterized by substantial grass and a good drinking water. The most part of milk production is received during pasturage period, but after taking the cow on stationary feeding, milk yield reduces quickly and stops. th 446 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Georgian Mountain Cattle is very small, the height in wither of the cow is averagely 98‐100cm. Its color is various: black ‐ 52%, red and straw‐colored ‐ 24%, black‐motley – 16%, red‐motley – 8%. It is characterized by low milk yield in the conditions of primitive feeding, but in the case of improved feeding and care‐keeping the milk yield increases averagely to 2000kg with 4.2% fatness. Milk is characterized by small diameter of fat bubbles, which indicates its dietary peculiarities. During the increase of milk yield, Georgian Mountain Cattle maintains fat percentage composition in milk. This peculiarity distinguishes it from other breeds. It has a hard constitution, endurance, milk butter‐fat and high culinary peculiarities of meat. Live mass, kg Lactation, kg Spring Autumn average maximum minimum average maximum minimum I 135 177 105 177 228 126 II 157 208 114 197 255 136 III and then 174 280 114 279 300 137 Milk yield, kg. average maximum minimum I – Lactation, kg. 530 822 243 II – Lactation, kg. 626 1050 339 III – Lactation, kg. 666 1189 329 Average fat, % 4.25 6.4 3.2 Milk yield in improved feeding conditions 1942 2850 918 Crossing results of Georgian Mountain Cattle to Swiss and Jersey bulls Indicators/ Georgian Mountain breed lactation Crossing of Swiss breed Crossing of Jersey breed I Lactation III Lactation I Lactation III Lactation I Lactation III Live. mass, kg 200 246 254 351 242 310 Milk yield, kg, 980 1345 1242 1760 1195 1652 Fat, % 4.14 4.15 3.85 3.88 4.7 4.69 Albumen, % ‐ 3.59 ‐ 3.33 ‐ 3.94 Fat + albumen ‐ 7.74 ‐ 7.21 ‐ 8.63 The crossing of Swiss breed was characterized by the highest live mass and reduced fat and albumen composition in milk. All indicators of Jersey breed crossing were higher, than of Georgian Mountain cows. According to the amount of fat and albumen of produced milk, this crossing took the lead over both breeds (Georgian Mountain cow and Swiss crossing). The breeding work on Georgian Mountain Cattle should be directed mainly on pure breeding way for its conservation, further completion and rational usage. Megruli Red Cattle represents the breed of universal usage. It is raised with the completion of local small‐body cattle by brothers Kvaratskhelia in one of the largest regions of West Georgia‐ Samegrelo in 60‐s of XIX century. They were choosing red cattle, because population gave the The Diversity Of Georgian Local Cattle 447 advantage to the one‐color red harness bulls. They mainly bred such cattle, which had up‐directed, wax‐color horns and harmonic, soft head. This herd is called everywhere “Kvaratskhelia breed”. It was extended through the whole West Georgia from Samegrelo. Megruli Red cattle spent summer in alpine zones of mountains, but in winter it pastured in Kolkheti bogs without stationary and supplementary food. In nomadsic conditions the milk yield of cows was increasing from 2‐3 to 7‐10 litter. This breed was permanently in the open air, so this factor conditioned its adaptability towards local conditions, health endurance, hard constitution and good working peculiarities. Megruli Red Cattle is characterized by peculiar exterior. It is bigger than aboriginal breeds of Georgia. The height in wither of adult cows is averagely 112.4 cm. In spite of the factor, that Megruli Red Cattle is considered to be a working direction breed, it has not rough constitution signs, which is peculiar for this herd. Live mass, kg Lactation, kg spring autumn average maximum minimum average maximum minimum I 210 280 152 230 300 180 II 232 320 140 255 335 182 III and then 250 348 180 277 355 220 The constitution of this breed is mostly like to milk direction herd; In addition, it is characterized by hard working peculiarities, endurance, strength and quick movement. The average live mass of adult cows in spring is 250 kg, but in autumn – 277 kg (more than 8.7%), which exceeds by 25‐40% the live mass of Georgian Mountain Cattle bred in the same zone. Milk yield, kg. average maximum minimum I – Lactation, kg. 765 1115 251 II – Lactation, kg. 797 1589 175 III– Lactation, kg. 875 1904 184 Average fat, % 4.45 6.17 3.29 Caucasian nut brown breed. One of the most significant achievements of zoo technical science in XX century could be considered the establishment of Caucasian nut brown breed on the base of joint work of Caucasian countries scientists. This breed is raised by crossing of Georgian, Armenia, Azerbaijan and Dagestan local cattle mainly to Swiss breed. In 1863 the Swiss breed was brought in Georgia by the farmer Al. Kuchenbakh from West Europe. He received a credit (2100 ruble) at even from the government for the arrangement of Swiss type farm and chose 2400 ha land for this activity 115 km far from Tbilisi, near Dmanisi, on the height of 1300‐1600 m from sea level. Kuchenbakh bought small Caucasian and Georgian cattle breeds, brought 13 Swiss cows and 3 bull‐producers from Switzerland. This was the first brought of cultural European breeds in Caucasus, which caused a great interest. Together with pure breeding of Swiss breed, Kuchenbakh started to cross locally bought cows to the bulls of this breed. Inadaptability to environment and low resistance towards diseases (by the result of anthrax and cattle‐plague) caused the full extinction of Swiss pure blood animals, but their crossings extinct partly. Since 1863 Kuchenbakh did not breed Swiss cattle by pure th 448 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) breeding, but he continued crossing and brought Swiss bulls for this. By this way, the herd of 600 livestock crossed calves was established. During Soviet period Bashkicheti breeding farm was created on the base of cattle livestock raised by Kuchenbakh and the establishment of a new breed was started, which was confirmed in 1960.s In the Southern districts of Georgia, where most of all was spread Caucasian nut brown breed, there are wide grounds, which are necessary for creation of stable food base. The peculiarities of initial breeds are successfully combined in this breed: from Swiss Brown breed – big live mass and productivity, but from aboriginal ones – high fatness of milk and high adaptation towards local conditions. Lactation min average max min average max min Fat composition max Milk yield in 305 days, kg. average Live mass, kg I–Lactation, kg. 402 500 350 2600 4208 1944 3,93 4,36 3,61 II–Lactation, kg. 453 580 370 3184 5135 2351 3,90 4,90 3,60 III–Lactation, kg. 469 600 400 3556 6049 2648 3,90 4,68 3,60 Consequently to the level of feed and care‐keeping intensification achieved in Georgia, it was practically impossible to raise more productive breed. Caucasian nut brown breed composed more than 90% of the total cattle livestock in Georgia during the existence of social farms, which was economically justified. For example: there was 1.1 million livestock according to 1990 data, between them – 330 000 cows. Annual milk yield composed 2400‐2800 kg in the conditions of average feeding with 3.8‐4% fatness. In the improved conditions of feed and care‐keeping milk yield reached 3500‐ 4500 kg, but record milk yield was 8789 kg, which indicates high genetic abilities of this breed. Nowadays the amount of Caucasian nut brown breed exceeds 95% from the total livestock of cattle in Georgia, but their productive indicators do not correspond to breed standards. This is caused by the factor that breeding farms do not function, zoo technical registration is out of order and artificial insemination does not exist. There are none breeding farms in the country, which could grow improver bull‐producers and that’s why cows are inseminated by free insemination to unknown origination young bulls, which finally will cause the degradation of Caucasian nut brown breed. According to our data, in view of Caucasian nut brown state, analogical situation is in the countries of Southern Caucasus (Armenia, Azerbaijan). On the historical example of Scientist Union of Caucasian countries the National Coordinators of Genetic Resources of these countries received a decision about the joint work on revival and further completion of Caucasian nut brown breed. This project is in the working process. It is impossible to overcome the crisis created in animal breeding of these countries without scientific support. Our common effort will simplify the decision of the problem. Georgian buffalo. Buffalo breeding has a long history in Georgia. According to Vakhushti Batonishvili historical sources Qizikhi was called “Kambechovani”(buffalo land), because here were many buffalos. In Caucasus, in 1960 buffalo population was more than 500 000, but then it reduced and in 1980 was fixed as 48 000 in Georgia. It’s bred as in lowlands (in the river gorges of Alazani, Iori, Mtkvari, Rioni and others) so in mountainous regions at 1700‐2000 meters from sea level. It’s The Diversity Of Georgian Local Cattle 449 characterized by the great endurance towards the following diseases: brucellosis and foot‐and‐ mouth disease. Buffalos use well the grass of marshes, cane, low quality hay, on which the cattle can’t make production. Buffalo breeding has the work‐dairy‐meat direction. Georgian buffalo are bigger than Azerbaijan, Armenia and India ones, but it’s small than Hungary buffalo. Female buffalos weigh nearly 470‐550 kg. By the dairy it’s nearly the same as the cattle local breeds. It gives 1300‐1500 kg milk with nearly 7, 8% fatness. Buffalo dairy productivity has the potential of 3000 kg. The best quality sour milk and cheese is made from buffalo milk. Meat of full buffalo is rough fibrous and is not compared to cattle meat by culinary peculiarities, but the meat of young buffalo does not differ from cattle meat. The king of Kakheti, Giorgi XII was called “Eater of young buffalos”, because he liked its meat very much. In the past years buffalo meat was considered to be a very useful food and antianemic means. Buffalo fattens out well on the poor pastures, where cattle can not grow in weight. Georgian buffalo is like to Armenia and Azerbaijan ones in size and constitution, which is caused by the closeness of their extension area, common origination and similarity of care‐keeping conditions. Live mass and sizes of Georgia, Armenia and Azerbaijan female buffalos Live mass Height in wither Georgia 450 132 140.7 Azerbaijan 446 130.8 Armenia 448 131.8 Buffalo groups Body skew Breast circle length Breast depth Breast width Pelvis width 183.4 72.1 36.7 55.1 139.8 184.5 70.6 38.0 55.7 138.3 183.9 73.0 39.8 55.6 Milk chemical composition of cattle and buffalo Milk composition (100 kg milk) Animal kinds Fat, kg Albumen, kg Milk Sugar, kg Ash, kg Dry substance, kg Cow 3.8 3.4 4.8 0.7 12.7 Buffalo 7.6 4.3 5.2 0.8 17.9 100 26.5 8.3 14.3 40.9 Difference (for buffalo milk) th 450 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) The results of Azerbaijan buffalo crossing to Murakhi breed Azerbaijan Murakhi Azerbaijan Difference from Azerbaijan buffalo (+,‐) X Murakhi Murakhi Crossing Live mass, kg 452.8 493.8 467.7 +41.0 +14.9 Milk yield, kg 1399.6 1787.8 1623.3 +382.2 +223.7 Fatness, % 8.0 7.88 7.91 _0.12 _0.09 Milk fat, kg 112 140.3 128.4 +28.9 +16.4 Milk albumen composition, % 4.41 4.34 4.37 _0.07 _0.04 Milk albumen, kg 61.7 77.6 70.9 +15.9 +9.2 Live mass, kg 351.6 439.6 425.0 +88.0 +73.4 Daily weight increment , g 653.3 982.2 969.0 +326.9 +315.7 Slaughter yield, % 50.5 55.5 54.7 +5.0 +4.2 (19,5 months) Comparing to local female buffalo, the live mass of crossing increased by – 3.3%, milk fatness reduced by – 0.09%, milk albumen composition by – 0.04%, but the fat quantity in milk increased by – 14.6%, milk albumen composition by – 14.4%. Such crossing, which will significantly increase the productivity of buffalo, had not been carried out in Georgia. Together with pure breeding, it is worthwhile to carry out the crossing of Georgian buffalo to more productive breeds, for example, to Indian breed Murakhi, which spread in Europe. This breed is well adapted to Azerbaijan territory. Comparing to local buffalo, it has more live mass and milk yield. First generation animals received by crossing of Azerbaijan buffalo to Murakhi breed are mostly characterized by inclination to the improver breed having productive peculiarities. The extinction of local breeds will seriously damage the country and World Gene pool, because these breeds have peculiarities characteristic exclusively to them and have no analogues anywhere. These are: high endurance towards diseases (absolute resistance to leucosis and pyroplazmosis); adaptability to the temperature fluctuations and low oxygen consistence in mountainous area; good usage of steep pastures (300‐350), which is practically impossible for other breeds; also specific tasty peculiarities of milk and milk products; specific culinary peculiarities of meat. These characteristics of the local Gene Pool herd are established by national selections carried out for a long time, representing a source for genetic completion. AnGR are still preserved in small amount in Georgia. It is necessary to implement integrated intensification in the cattle breeding field as a whole. Wealthy genetic resources of the local breeds represent invaluable material for completion of cultural breeds within animal selection. MORPHOLOGICAL AND MANAGERIAL CHARACTERISTICS OF THE BUSHA CATTLE REARED IN MACEDONIA AND ITS IMPORTANCE AS A GENETIC RESOURCE M. ADAMOV1, G. BUNEVSKI2 and N. ADAMOV1* 1 2 Department of Animal Science, Faculty of Veterinary Medicine‐Skopje Department of Animal Biotechnology, Faculty of Agricultural Sciences and Food‐Skople * Corresponding author: adamovn@fvm. ukim. edu. mk Abstract Busha cattle is indigenous breed of the Balkan Peninsula where lt has been bredfor centuries. lt belongs to a group of primitive shorthorn cattle (Bos brachyceroseuropaeus). These cattle used to be dominant and most important breed in Macedonia,Croatia, Bosnia and Hercegovina, Montenegro, Serbia, Albania, Bulgaria and Greeceuntil 50s and 60s of the XX century but today in lowland areas with intensive farmingthey are already replaced with more productive and specialized cattle breeds. InMacedonia this breed has officially been classified as triple purpose breed (for meat,milk and work) but considering it's low productive capabilities it is more similar to someprimitive working breeds. Today these cattle are no longer used for work but because ofabsence of systematic cattle improvement program these animals have retained theirpoor milk and meat production capability. lt could be said that the Busha's genome isvery elastic since this breed in favorable conditions easily achieves better milkproduction and bigger body weight. Having in mind that this breed is well adapted to thevery harsh feeding and housing conditions that exist in the rural areas of theMacedonian mountains and is resistant to diseases, it is still the most significant milkand meat resource for this areas where the more productive cattle breeds can not thrivesuccessfully. In the past several decades, as a result of uncontrolled crossing of thiscattle with some more productive breeds, the number of purebred Busha animals ispermanently being reduced which imposes an urgent need for setting up in situ and exsifu conservation program for this breed. Key words: Busha, adapted, resistant, in situ, ex sity, conservation. Introduction Cattle are a main source of milk in Macedonia including various breeds, strainsand crosses. This industry consists of three sectors: small‐scale farmers (around g0%)keeping 1‐3 cow and mainly producing for home consumption; medium‐scale farmers(5%) keeping 10‐15 cows with annual production of 4000‐5000 kg milk/head andspecialized commercial farms (around 5%) with more than 50 heads that produceannually over 7.000 kg milk intended solely for the market. In the mountain rural regionsof Macedonia the dominant type of cattle are the crosses of the Busha breed. Thisbreed of cattle, also known as lllyrian cattle, is autochthonous breed of the Balkan Peninsula. lt has been bred for centuries in this area and belongs to a group of primitiveshort horned cattle (Bos brachyceros europaeus). In Macedonia this breed is officiallyclassified as triple purpose breed (for meat, milk and work) but considering it's lowproductive capabilities it is more similar to some primitive working breeds. The mainstrength of this breed is that survives well under minimum levels of management, haslow feeding requirements and thrives on natural grazing. These shorthorn cattle used tobe dominant and most important breed for marginalized rural areas of Macedonia,Croatia, Bosnia and Hercegovina, Montenegro, Serbia, Albania, Bulgaria and Greeceuntil the middle of the XXth century and is still a crucial breed in some mountainousrural parts of the Balkans. ln the past, several imports of more productive dual‐purposebreeds have been made in Macedonia with th 452 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) intention to improve the productioncapabilities of the native Busha cattle. But this improvement has been carried outwithout adequate control and record keeping which in turn resulted in drastic reductionof the number of indigenous Busha animals, Morphological characteristics When compared to the higher productive European dairy and meat breedsBusha animals are of much smaller size. Carried by a short neck their head is small andlight with short horns pointing upward and forward. The fully grown Busha animal is 90‐115 cm tall at the withers. The length of the body is 116‐132 cm or 104‐118% of thewithers height. There are great variations in the length of the body which is a result ofthe extensive way of rearing, lack of any breeding program and the poor zootechnicalmeasures. Some of these animals have 1‐3% higher pins than withers and some arewith horizontal back line. They have narrow chest whose width is approximately 27o/oand depth 50‐55% of the withers height. The fore limbs are straight but the hind limbsare usually hocked in. The rear part is narrow and the legs are sturdy with strong jointsand ligaments. The hooves are hard and strong which enables these animals to move easily on steep and rocky terrains. The udder is small and shallow but with regularshape. Those animals that are better fed usually have bigger and deeper udders withmore glandular tissue. The body weight of the fully grown animals is 150‐300 kg butwith better nutrition the cows can grow up to 280‐320 kg and the bulls up to 430 kg. Thesmall body weight of these animals is not completely genetically dependent but also is aresult of generations of underfeeding and neglecting. The coat of this breed is one‐colored and on basis of the color there are several strains: grey, black, brown, red andso called "tiger" which is much rarer, The skin is elastic and hard. Those animals thatare reared well have short and shiny coat hair while in those that are neglected the coatis long and dense. Those that are raised on high mountain pastures always have longerhair. They usually have a stripe over the back and the muzzle, the horns and thehooves are darkly pigmentated. ln Macedonia these animals occur in black, red, yellow, grey and in so called"tiger" color. The weight of adult males is between 250 and 300 kg, females between150‐250 kg. Their average wither height is 105‐115 cm. The head is characterized withshort and curved horns pointing upward and fonryard and light pigmentation around theeyes and the muzzle. lt is very robust and resistant with very modest feeding andhousing demands. They are well adapted to the very harsh feeding and housingconditions, resistant to diseases and have long production life ‐ 10 and more lactations.It could be said that the Busha's genome is very elastic, since this breed in morefavorable conditions easily achieves bigger body weight and much better production.ln Macedonia the following varieties on the basis of their coat color can be found:black Busha which is reared in Debar, Tetovo and Gostivar region (poloski strain), redBusha (metohiski strain), grey Busha (povardarski and polimski strain), brown strain andthe so called "tigar" strain. Managerial characteristics Being reared extensively in rural areas with underdeveloped agriculturalpractices this breed of cattle represents typical reflection of those poor raisingconditions. During the spring and summer months when the vegetation is mostabundant these animals usually gain most of their weight which in turn is drasticallyreduced in the winter period. The winter feeding is insufficient and consists of hay, cornstraw and small quantities of grain concentrate. The small, low and dark barns orcottages with poor hygiene are the housing facilities during the winter months and onlymake worse the negative impact of the unbalanced and obscure nutrition. Thestarvation of the new born calves begins early in their life since the milk is consumed bythe owners. Because there isn't adequate milk replacement fed to the young calves,since the beginning of their life they grow slowly and are underdeveloped, a drawbackwhich cannot be latter compensated for and which in turn results in raising animals with low production capabilities. The zootechnical practices at this raising facilities Morphological And Managerial Characteristics Of The Busha Cattle Reared in Macedonia And its Importance As A Genetic Resource 453 are atvery low level and most of these breeders lack any scheduled and systematic measuresfor production improvement. lt has been shown that those households that implementsome kind of zootechnical measures usually achieve better production results with thisbreed. Production and reproductive characteristics In general these animals have low production which is in accordance with thepoor body conformation. On the basis of the production capabilities this breed can beclassified as triple purpose breed (for milk, meat and work). The low milk production is aresult of the poor nutrition and the underdeveloped udders. Because of the small bodyweight it is a poor working animal and because of it's poor body conformation andunderdeveloped meat portions it is a weak fattening animal. The milk production of thisbreed is around 700‐1500 kg with 3,7‐4,0% milk fat but there are also animals withhigher milk production with around 2400 kg or with 4,8o/o milk fat. The lactation periodlasts around 240 days. This low production can not compete with the specialized dairybreeds and the European countries with highly developed cattle breeding practicesabandoned or rearing this breed long time ago. The fattening capabilities of Busha cattle are relatively poor. The birth weight ofthe calves is 15 ‐ 22kg and the daily weight gain around 500 gr. The meat is also ofpoor quality. The fattening capabilities are low because of the under nutrition anddelayed maturity. Well fed male castrated young bulls have dressing percentage ofaround 55%. The fattened castrated males reach weight of 280‐500 kg. The meat is oflow quality. The health and the conformation of these animals is generally satisfactoryhaving in mind that in such a bad conditions no other specialized cattle breed cansurvive. This breed is classified as late‐maturity breed because it reaches puberty at 13‐15 months of age, breeding maturity when 2 years old and full growth at 4 years of age.The first service of the heifers is usually when they are 22‐24 old. Under good raising and feeding conditions the fertility of this breed is generallygood but in poor conditions when underfed they easily develop anovulation due tohunger. The bulls reach breeding maturity at 2,5 to 3 years of age while the cows aftercalving usually have short period of days open from 4 to 6 weeks and can give birth 10‐13 times in their life. These cattle show high disease resistance and adaptation todeficient nutritional and other environmental conditions. Today animals of native Busha breed are very rare because in the past severaldecades efforts have been made for improving this breed's productivity by crossing itwith some more productive breeds such as Tyrolean Grey, Brownvieh and evenSimmental and Hereford. Past experiences and future perspectives Cattle of the Busha type can be found in mountainous rural areas where it is bredextensively on natural pastures with little man care. Today animals of purebred Bushaare very rare. The uncontrolled crossing with Simmental, Brownvieh, Tyrolien Grey andeven Holstein‐Friesian is still a practice. Our experiences show that best results can beachieved when this breed is crossed with the Tyrolien Grey cattle. Our results indicatethat the F1 cfosses of this two breeds produce 2010‐2320 kg milk and Rr crosses 2662‐2824 kg milk. This crosses are well adapted to our mountainous regions, exhibit goodhealth and disease resistance and are able to find food during the entire grazing seasonbeginning from April until falling of the first snow. They live long and give birth toapproximately 8 calves. The calves survive well on pastures with their mothers with littleor no assistance from the owners. Our experiences show that this crosses are betteradapted than purebred tyrolean grey or hereford cattle because of the poor quality ofour mountainous pastures especially during the summer months when the grass getsdry. Today in Macedonia thate is no exact data about the number of purebred Bushacattle. Although the status of this breed is defined as stable/undetermined (Action planfor conserving the animal biodiversity 2011‐2017) our opinion is th 454 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) that the actual numberof the autochthonous purebred Busha animals is very low. In order to improve theproductivity of this population as a first choice they should be crossed with alpine dualpurpose breeds of meat‐milk type or with the smaller beef breeds intended to be raisedon pastures. This crossing should be supported with adequate record keeping andshould be done to Fr generation to utilize the heterosis effect or to Rr in order topreserve the positive characteristics for survival and disease resistance. These crosseswould exhibit bigger body weight, better milk production and better carcass quality. lnorder to conduct successfully this kind of breeding program it is necessary to raiseanimals in pure breed which calls for an urgent measures for conserving the purebredBusha in its original genome. According to the official data of the State Institute for Statistics, animals of theBusha type are dominant in the Macedonian cattle population but this number includesall of the genotypes that are morphologically similar to Busha including its crosses withother breeds. In order to conserve this valuable genetic resource the Action plan 2011‐2017 defines the measures for in sifu and ex situ conservation of this breed as well ascreation of a Gen bank as a system for monitoring and sustainable utilization of ourautochthonous breeds. LITERATURE Antov G., T. Cobic (2001): Govedarstvo, Novi Sad. Bunevski G. (199a): lmprovement of the native Busha cattle breed. Unpublished. Bunevski G., T. Trajkovski, G. Trifunovic, M. Adamov (2009: Selection program ofcattle in the R. of Macedonia. 16th Symposium on innovation in animal science andproduction, Biotechnology in animal science. Belgrade, Serbia. llkovski R., B. Djinleski, K. Petkov, S. smilevski, M. Dimovski, S. Grpovski (1g80):Comparative analysis of the growth traits and carcasse quality of young Busha cattleand Busha x Tyrolean Grey crosses. Macedonian Veterinary Review 1. llkovski R., K. Petkov, B. Djinleski, S. Grpovski (1983): Utilization of the cow‐calf systemfor beef production. Book of papers, Agricultural faculty, Belgrade. llkovski R. G, Bunevski (2000): Cattle raising in Republic of Macedonia. Unpublished. Karabaliev l. (1996): Govedovodstvo. Sofija. Lazarevic R. (1995): Cattle farm raising. Belgrade. Smilevski S., R. llkovski, M. Dimovski, l. Lozance, S. Grpovski (1977): Productive andreproductive traits of several cattle breeds raised in Macedonia. Socialistic Agriculture 7(9). Skopje. Trajkovski T. (1993): Analysis of morphological, productive and reproductive traits ofTirolean Grey cows raised in intensive conditions (PhD dissertation). Faculty ofAgriculture ‐ Skopje. MODEL THE PRESERVATION OF INDIGENOUS BREEDS M. BRKA*, H. OMANOVIĆ1, E. ZEČEVIĆ1 and A. DOKSO1 1 Faculty of Agriculture and Food Sciences, University Saraejvo, Zmaja od Bosne 8, 71000 Sarajevo, Bosnia and Herzegovina *Corresponding autor: muhamed.brka@gmail.com Abstracts Plant and animal genetic resources used in food and agriculture not only serve as material for breeding and scientific research, they have a biological basis for food supplment security in the world. Because of the overall importance of plant and animal genetic resources for human existence should be mentioned that the state has responsibility for conservation (preservation) and utilization of genetic resources. In this context, a large number of states developed national programs for the conservation and utilization of animal genetic resources with different models. All models are based on a program of support of the EU in accordance with the provisions of 1257/99. Bosnia and Herzegovina is one of the countries that have indigenous breeds which should finally recognize the importance of these breeds, which are a national treasure, sadly currently without any protection. The aim of this paper is to present one possible model of protection and conservation of indigenous breeds in Bosnia and Herzegovina. Keywords: Indigenous breeds, morphological and physiological characteristics Introduction Activity FAO speaks of the importance of indigenous breeds. According to available FAO information in the past 100 years 1000 domestic breeds, from 6400 recognized breeds in the world, have disappeared. FAO warns on 2000 other breeds that are endangered. Since the beginning of the 20th century, 50% of the total numbers of breeds in Europe have disappeared. Indigenous breeds in Bosnia and Herzegovina could be considered endangered, while Busa is very endangered. There are different endangerment categories. These are defined by the effective population size (Ne) Endangerment categories: Ne<200 Highly endangered population for which immediate conservation measures are needed to maintain the breed. 200<Ne<1000 Endangered population which should be monitored and for which a semen cryoconservation programme should begin. Ne>1000 Nonendangered population, which is in the process of routine calculations and recording of the effective population size. th 456 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) If the effective population size is Ne ≤ 50 it is considered that the population as a genetic resource has little chance. In these situations, the breed tends to remain as part of the cultural and historical heritage. Cryoconservation (semen and ET) should be used to avoid total loss of breed. It is very important to regularly perform determination of the effective population size for endangered breeds. The importance of indigenous breeds Indigenous breeds have economic, ecological and cultural importance within a society. Economics can be seen through the economic importance of genetic resources. Ecological significance is seen through the property of easy adjusment to the conditions of keeping and exploitation of the areas that are neglected and difficult to access. The cultural significance is associated with the fact that in the traditional animal breeding, animals can be seen as man's cultural heritage as part of the tradition. Indigenous breeds in FB&H (B&H) There is a real question whether the current state and the number of indigenous breeds in Bosnia and Herzegovina is known? Indigenous breeds are usually referred to:
• Cattle (Buša and Gatačko) • Pramenka sheep
• Bosnianherzegovinian mountain horse
• etc. What is certain indigenous breeds in Bosina and Herzegovina are national treasure, but there are compleately neglected. It is importante to mention, there are some partial scientificresearch work in this field concerning Busa, pramenke, Bosnianmountain horse. Proposal for further work National coordinating body within the Federal Ministry of Agriculture Water and Forestry should be established. The tasks of this coordinating body would be:
• Preserva on of endangered breeds of ca le
• Preserva on of endangered horse breeds
• Preserva on of endangered breeds of sheep and goats
• Preserva on of endangered breeds of poultry
• Preservation of endangered aquaculture species
• Preserva on of endangered breeds of dogs
• I step determining the popula on size, produc on and phenotypic characteris cs
• Step II making sustainable breeding or meliora on plan
• Step III planning breeding programs according to breeding plan
• Step IV execution and control of breeding programs In order to make the functioning of the National Coordination Body (NCB) financially acceptable and effective throughout the FB&H (B&H) it is necessary to establish two organisations parts:
• An expert advisory board for animal genetic resources as advisory and cooridnation body for conservation of endangered breeds. The board would be composed of experts in the field of breeding domestic animals (Science), representatives of the Model The Preservation Of Indigenous Breeds 457 breeding companies and representatives of ministries of agriculture (federal and cantonal).
• IT sector ‐ a place for collecting and processing data (database). The work would be done under the guidance of the expert advice advisory board for animal resources. IT sector would conducte technical monitoring of the implementation of the live and cryoconservation program. There must be a clear division of responsibilities. Faculty of agriculture and food sciences, University of Srajevo will cooperate in the field of farming technology and control of breed characteristics of indigenous breeds, as well as the education of farmers. Veterinary Faculty in Sarajevo will be working in the field of implementation of disease control, tracking health conditions within breeds and artificial insemination. It will provide education of farmers in mentioned fields. Other faculties of agriculture in FBiH will be included in the program, within their capabilities. At this moment, the most important is to provide subsidies for owners of indigenous animals, in order to stimulate their work. A prerequisite for the subsidies are:
• endangered breed must be knowen;
• farmers must make registra on in conserva on program;
• farmers must follow sequences of the conservation program;
• male animals must have a known pedigree and license use in breeding;
• farmers must have confirmation of breeding organization of herding breeds. th 458 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Conclusion Indigenous breeds in Bosnia and Herzegovina belongs to the category of endangered breeds. The Buša belongs to very endangered breeds. Establishing of a National Coordination Body within the Federal Ministry of Agriculture Water and Forestry which would be financed from the federal budget would help to improve the situation in the field. In frame of the national coordinating body to organisation parts must be established: an expert advisory board for animal genetic resources and IT sector. It is of vital importance to provide the financial support. Subsidies will be availabel for farmers involved in the protection program indigenous breeds. REFERENCES 1. Adilović, S., M. Andrijanić (2005) Bosanskohercegovačke autohtone pasmine domaćih životinja.Veterinarski fakultet Sarajevo. 2. Brka, M., A. Hodžić, N. Reinsch, E. Zečević, A. Dokso, R. Đedović, D. Rukavina, L. Kapur, M. Vegara, M. Šabanović and I. Ravić (2010) Polymorphism of the kappacasein gene in two Bosnian autochthonous cattle breeds. Archiv Tierzucht 53 (2010) 3, 277282. 3. Porcu, K., B. Tanaskovska, A. Hodžić, H. Bytyqi, H. Mehmeti, V. Margeta, R. Djedović, A. Hoda, R. Trailović, M. Brka, B. Marković, B. Važić, M. Vegara, I. Olsaker, J. Kantanen (2008) Genetic diversity and structure of the West Balkan Pramenka sheep types as revealed by microsatellite and mitochondrial DNA analysis. M. Ćinkulov , Z. Popovski,. Journal of Animal Breeding and Genetics, Volume 125 Issue 6, Pages 417 – 426 4. Zacher, P., Sölkner, J., Druml, T., Baumung, R., Achmann, R., Bodo, I., Marti, E., Habe, F., Brem, G. (2002) livestock production Science, 77 5. Weitzmann, M.L. (1993) What to preserve? An application of diversity theory to crane conservation. Quart J. Economics, CVIII, 157183. PHENOTYPIC DIVERSITY OF SOME DOMESTIC FARM ANIMALS IN SUDAN Y.A. HASSAN Animal Resources Research Corporation, Atbara, Sudan, P.Box: 165 Correspondence: aboranno4@yahoo.com Abstract Sudan is one of the Sub‐Saharan countries, which is endowed with rich biodiversity in Africa. There are 30 indigenous breeds or strains known. They show specific adaptation to climate or disease and the local low input – low output production system. Despite their importance, their population trends are either unknown or critical. The dilution and erosion of local breeds by indiscriminate crossbreeding and wars could be linked with the loss of unique characteristics. Moreover, identification of the breeds is perquisite based mainly on: their original areas, names given by local people and phenotypic characteristics. According to definition for breed of FAO, there might be more breeds to be discovered in the near future. Thus, identification of domestic farm animal population to conserve under sustainable utilization need to be a priority. Keys: Sudan, farm animals, cattle, sheep, goat, chicken 1‐Cattle subtypes: It includes 17 subtypes: Aliab Dinka, Anuak, Aweil Dinka, Baggara, Butana, Kenana, Lugware, Murle, Nuba Mountains Zebu, Nuer, Red Fulani, Shiluk, Toposa, Turkana and White Fulani. For the Butana, Kenana and Baggara see the appendix. Below are some suggested ecotypes: Subtype Butana Kenana Local Name Red Desert cattle, Dar El Reih, Dongola, Shendi Breed Group Large East African Zebu Ruffai ElHoi, Ruffai El Sherik, Fung, Gezira Large East African Zebu Location Morphological Characteristics Butana Plain in Central Sudan and Desert area lying between Blue Nile and Atbara River and in Northern part of Darfur & Kordofan Predominately, red coat color, typical dairy subtype with established history of active selection for milk production demonstrated On – Station at Atbara (Osman, 1983) The east confluence of the Blue Nile at Khartoum & South to the Ethiopian Boarder, on the Western Bank of the Blue Nile in the Fung area Nomadic cattle. Coat color typically is blue grey to white with black shadings on the head, neck, hump, hind quarters and legs. Horns are black; hump is predominant in males and in most cases cervico‐thoracic in position, large dewlap & sheath, and udder is well developed. (Osman, 1983) Risk Status Not known Not known Utilization Milk, Meat & Traction Meat & Milk th 460 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Subtype Local Name Western Baggara Breed Group Large East African Zebu Nuba Mountain Zebu Koalib Small East African Zebu Mongolla Didigna, Latuka, Bari Small East African Zebu Baggara Location Morphological Characteristics West, Central & Southern Darfur, Southern & Central Kordofan & Nuba Mountains , & Saliem Baggara West of White Nile Southern Kordofan Medium Size, varied coat color, horn shape & conformation for Darfur cattle is the largest. Hump & dewlap are well developed (Osman, 1983). Around Mongolla and Torit of the Eastern Equatoria State. Thrive in tsetse – infested areas, and thus thought to have some level of trypanotolerance, extremely small and often referred to as dwarf or pigmy cattle, phenotypically resemble Mongalla, Ndama and the West African short horn cattle (http://.dagris.ilri.cgair.org) Smallest of all East African Zebu type, coat colors range from dun, grey and cream to red and black.Bari strain has extremely long horns. Mongalla cattle are well fleshed (http://.dagris.ilri.cgair.org). Risk Status Not known Utilization Meat, Milk & Work Not known Meat (For ceremonies) Not known Milk & Meat 2‐ Sheep ecotypes: Six sheep breeds with many ecotypes are known, as follows: 2‐1: Sudan Desert Sheep. Local Name: Arab, Ashugor, Butana, Beja, Drashianin, Dubasi, Gassh, Kababish, Watish, Baggara, Shukaria, Hammari, Zaghawa, Sudanese Maned & Umbororo. It constitutes about 65% of total sheep population in the country. See the appendix. Breed Group: Thin‐Tailed hair sheep. Morphological Characteristics: Large body size with convex profile face, Medium and pendulous ears, variable coat color, hemoglobin type B in this sheep could potentially lead to high reproductive performance (Wilson,1991). Location: North to 10 degree north, extending eastwards into Eriteria and Westward into Chad, mainly pastoral and grading to agro pastoral and urban(Wilson, 1991). Utilization: Meat & Milk Risk Status: Unknown. 2‐2: Dongola ecotype: Local Name: North Riverine wooled. Breed group: Thin tailed coarse wool sheep. Morphological Characteristics: It is similar to the Macina and other thin tailed wool sheep of the Sahara, use of coarse wool to make coarse cloth and carpet wool has been declining (http://.dagris.ilri.cgair.org). Location: Maintained by Dongola Arabs in the northernmost riverine areas of the Sudan between Merowe and EL Khandaq. Utilization: Meat. Risk status: Not known. Phenotypic Diversity Of Some Domestic Farm Animals In Sudan 461 2‐3: Southern Sudan ecotype: Breed Group Name: Thin – tailed hair sheep. Subgroup information: Tropical dwarf. Local Name: Nilotic, Sudanese Maned, Mongalla. Morphological Characteristics: Small and short legged, the basic color is white, usually with black or tan patches, the hair is very smooth and there is usually a longitudinal ruff under the neck of the adult ram. The presence of throat mane has led to the name Nuba Maned for the local variety of Nuba Mountains(Wilson. 1991). Location: Southern Sudan, in some districts local varieties are known. The Nilotic variety is reared by the Dinka, Nuer and Shiluk tribes. The other varieties inhabit Nuba Mountains and Ingessana hills. I t is not known how much of this diversity is still maintained in Southern Sudan after long years of instability(Wilson, 1991). Utilization: Meat. Risk status: Not known. 3‐Sudanese goat 3‐1: Sudanese Nubian Goat Local Name: Sudanese Nubian, Shukaria, Beldi See the appendix. Breed Group Name: Lop‐eared goats. Morphological Characteristics: Markedly has convex facial profile, broad and pendent ears that may turn upwards, udder well developed, coat color is generally black except for ears which are grey or speckled. Coat is long haired (ElNaim, 1997). Location: Nubian goat belongs to similar goat common throughout the middle, extending as far eastwards as India. In Sudan, it is found in riverine and urban areas of Northern Sudan, the low lands of Western Eretria (Gash and Setit) according to (http://.dagris.ilri.cgair.org). Utilization: Milk, Meat Risk status: Critical 3‐2: Sudanese Desert goat: These goats may be associated with the groups of Sahel goats, which include many Saharan types from Egypt, Libya, Tunisia, Algeria and Morocco. Local Name: Sudanese Desert Location: Inhabits dry areas of Sudan, generally Northern Darfur and Western Kordofan. Morphological characteristics: Fairly large and long legged animal with short coat of light grey color, often splashed with brown or black. Both sexes have homonymous twisted horns commonly projecting horizontally. Males usually have well bifid bears, (http://.dagris.ilri.cgair.org). Utilization: Meat. Risk status: Critical. 3‐3: Sudanese Hill Goat Breed Group Name: Short‐eared small horned. Local Name: Nuba Mountain, Ingessana, Latuka‐Bari, Nilotic. Location: Inhabit a wide area from the Red Sea hills of North‐East Sudan to those of Jebel Marra area of Darfur (Central and West), the Toposa and Dinka of Southern Sudan. th 462 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Morphological characteristics: According to ElNaim (1979), Sudanese Hill goats have small and slender body, head is small with concave facial profile. Both sexes carry twisted horns, the back is of moderate length and the rump is very short and drooping. Coat color varies with local variety. Utilization: Meat, skin. Risk status: critical. 4‐ Chicken ecotypes: Sudanese indigenous chicken can be grouped into 3 ecotypes, which are: Large Sudanese Baladi, Small Baladi (Betwil) and Bare Neck Baladi.Their diversity is not identified fully identified. They are utilized for egg, meat and household pest control. See the appendix for the three ecotypes according to (http://.dagris.ilri.cgair.org) . REFERENCES DAGRIS. (1991).http://.dagris.ilri.cgair.org. ELNAIM, Y.A. (1979). Some productive and reproductive traits of Sudan Nubian goat. PhD.Thesis.University of Khartoum, Sudan. OSMAN, A.H. 1983.Sudanese indigenous Cattle Breeds and the Strategy for their Conservation and Improvement, FAO series’: 58‐66. WILSON, R.T. (1991) Small Ruminants Production and the small ruminant genetic resources in tropical Africa. FAO series. No(3). Phenotypic Diversity Of Some Domestic Farm Animals In Sudan Appendix : Sudanese local cattle, sheep, goat and poultry subtypes and/ or ecotypes Butana cattle of Northern Sudan Baggara cattle herd at Western Sudan The black Sudanese Nubian buck Kenana cattle of Central Sudan Sudanese desert sheep Large and Neck‐Bare Beladi Chicken 463 OVERVIEW ON AGRI‐ENVIRONMENTAL MEASURES Yasemin ÖNER1, A. Oya AKIN2, Mehmet ERTUĞRUL3 1 Uludag University Faculty of Agriculture Department of Animal Science 16059 Bursa, Turkiye 2 3 General Directorates of Agricultural Research and Policy 06171 Ankara, Turkiye Ankara University Faculty of Agriculture Department of Animal Science 06100 Ankara, Turkiye Abstract As every economical activity, agriculture, one of the strategic sector of all, is mainly based on utilization of natural sources. Because of exceed utilization of natural sources and existing risks on decrease of natural sources in overall the world, arrangement researches have been promoted. Agri‐ environmental measures as a policy instrument to cope with future challenges caused by new scarcities in the field of resources and environment. Better understanding of agri‐environmental measures will contribute to construct legal framework about conservation of animal genetic resources. In this study general characteristics and some applications of agri‐environment measures, which are mainly related animal genetic resources, were shortly reviewed. Keywords: Agri‐environment measures, biodiversity, animal genetic resources 1. Introduction 1.1 Description of agri‐environmental measures (AEM) In general term agri‐environment measures (AEM) aims agricultural sustainability by supplying equilibrium between agriculture and environment (Dişbudak, 2008). AEM are designed to encourage farmers to conserve and enhance the environment on their farmland. AEM measures may be designed at national, regional or local level so that they can be adapted to the particular farming systems and environmental conditions, which vary greatly throughout the EU and the other countries. This makes agri‐environment a potentially precise tool for achieving environmental goals (Anonymous, 2005). AEM began in a few Member States in the 1980s on their own initiative, and were taken up by the European Community in 1985, but remained optional for the Member States. In 1992 they were introduced for all Member States as an “accompanying measure” to the Common Agricultural Policy (CAP) reform. After this farmers have been included to activities for protecting of environment by reforms done in 1999 and 2003. (Dişbudak, 2008). In recent years in most of EU countries appear to have made a serious effort to go through the evaluation questions, and to show which of their AEM can be expected to have an impact on the various environmental items listed (soil quality, water quality, water quantity, biodiversity ‐ including species diversity, habitats and genetic diversity ‐ and landscape). 2.1. Current practices in Turkey In Turkey, there are some differences from the EU countries in this area for applications because of different structure of agricultural sector, physical and social conditions. Agricultural politics are designed according to Agriculture Law (5488) and Strategy of Agriculture 2006‐2010 Certificate and Environment Law (2872) which intent adaptation to EU condition and the last one prepared based on this law is EU Integrated Environment Adaptation Strategy that covers years between 2007‐ 2023. Development plans prepared by Ministry of Development every five years also direct agricultural legal frames. Effects of agricultural activities on environment have been mentioned first time in 8th Development Plan (2001‐2005). In this plan this interactions evaluate so th 466 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) widely that sustainability and conservation of genetic resources have been emphasized. The last Development Plan (2007‐2013) contains present needs of standardization of GMO (Genetically Modified Organisms) to conservation and sustainability of plant genetic resources and emphasized on importance of equilibrium between conservation and sustainable utilization. Another law that contributes to design agri‐ environmental policy is National Development Strategy was prepared for years 2007‐2013, this aims to extent of application of usual good farming and avoids pollutions cause agricultural activities. Besides these framework arrangements for water resources is under responsibilities of TR Ministry of Environment and Forestry. Legal frameworks of water management directed by Environment Law (2872), Law 6200 of General Directorate of State Hydraulic Works and Ground Water Law. There are agreements to direct soil resources as Regulation on Controlling of Soil Pollution (Official Gazette date: 08/06/2010, number: 27605), Grassland Law (4342), and Regulation on Preservation and Utilization of Landscape (Official Gazette date: 13/06/2003, number:25137), There are several laws and directions to management and conservation of genetic resources organized by Ministry Food, Agriculture and Livestock: Regulation on Obtain, Conservation and Utilization of Plant Genetic Resources (Official Gazette date: 15/08/1992 and number: 21316), Agriculture Law (5488) that promotes researches on biotechnology and breeding, Sowing Seed Law (5553), National Strategy of Biodiversty and Work Plan, and Regulation on Recording Plant Varieties (Official Gazette date: 13/01/2008 and number: 26755). There are also several laws, regulations and directions to contribute and maintain plant genetic diversity (Anonymous, 2011). Avoid from the possible risks of GMO obtained by using biotechnological tools on biodiversity, also have been aimed in the Biosafety Law (5977). Farm Animal Genetic Resources is coordinated and supported financially and technically by the General Directorates of Agricultural Research and Policy (GDAR) on behalf of the Ministry of Food, Agriculture and Livestock. Efforts on construction of legal frameworks and reorganize of the institutions to manage better agri‐ environmental relationships to protect natural resources besides obtaining productive agricultural activities are continued in Turkey. The last legal arrangement to provide it and adaptation to EU legal frame in this field is Decree Law 648 has been prepared to adaptation of working organization of Ministry of Environment and Forestry to EU condition. In the new organization its’ works and responsibilities have been separated into two Ministries as Ministry of Environment and Urban Development and Ministry of Forest and Hydraulic Works. It is clear that legal agreement and organization of institution on conservation of animal genetic diversity should be developed. For example although in the Ministry of Environment and Urban Development and there is a departments to arrange these measures named General Directorates of Conservation of Natural Riches and in the Ministry of Forest Hydraulic Works there are also several departments, in Ministry of Food, Agriculture and Livestock there are no especial department or structure to conservation of soil, water, landscape or biodiversity. In the Ministry of Food, Agriculture and Livestock all of responsibilities and work are separated among various departments. As a conclusion it should be said that conservation of natural resources further development and arrangements are needed to improve efficiency of legal frame work to better applications. Better understanding of agri‐environmental measures will contribute to construct legal framework about conservation of animal genetic resources. On the other hand the public interest is increasing. REFERENCES Anonymous, 2011. http://www.tagem.gov.tr Anonymous, 2005. Agri‐environment Measures. Overview on General Principles, Types of Measures, and Application. European Commission. Directorate General for Agriculture and Rural Development. Dişbudak, K. 2008. Agriculture and environment interaction in EU and Turkey’s harmonization. EU Expertise Thesis. Ministry of Agriculture and Rural Affairs Department of External Affairs and EU Coordination. Ankara BREEDING VALUES OF INTRODUCED COWS’ POPULATION OF SIMMENTAL BREED CATTLE AUSTRIAN SELECTION Vladimir Radionov1, Tatiana Railean2 ABSTRACT The study aims to estimate the breeding value of Simmental breed cattle Austrian selection. Population genetic parameters for milk production traits of Simmental breed cattle Austrian selection: variation (Cv,%), correlation (rxy), heritability (h2). The heritability of different traits for milk production varies depending on the method of calculation from 0,19 to 0,78. Positive and reliable values of the correlation coefficients were obtained by a complex «yield, kg ‐ fat, kg», «yield, kg ‐ protein kg», «yield, kg ‐ fat + protein, kg», « fat, % ‐ protein, %». Positive and reliable values of the correlation coefficients were obtained by a complex «yield, kg ‐ fat, kg» (0,76‐0,89), «yield, kg ‐ protein, kg» (0,73‐0,95) «yield, kg ‐ fat + protein» (0,86‐0,93), «the fat% ‐ protein,%» (0,34‐0,39), except for "fat, % ‐ protein, %' mothers fathers. Conclusion: the productivity of the parents is an important source of information for preliminary assessment of the breeding value of offspring. Key words: Simmental breed, introduction, variability, correlation, heritability. INTRODUCTION Providing the population with milk and dairy products is one of the important problems of agriculture in Moldova. At the minimum requirements of the country's 1.2 million tons, over the past 8 years (2002 ‐ 2009) was produce 659 ‐ 543 thousand tons of milk, respectively, or demand is satisfied by only 54,9‐45,2%. In this case, the negative trend fall in milk production continues. During the period 2005 ‐2009 it decreased by 116 tones or 17.6%. This is due, mainly, the number of cows decreased from 279 thousand units in 2003 to 161 thousand ‐ in 2010 or 57.7%, as well as the stabilization of their productivity at an extremely low level, which for the period 2002‐2009 amounting to 2710‐3098 kg of milk. As international experience shows, in a complex of measures to address the shortfall of milk and milk products from own production, an important role for measures aimed at improving the genetic potential of animal productivity. However, the implementation of this measure to local conditions is difficult because of the unsatisfactory state of dairy cattle breeding base. During the reporting period (2002 ‐ 2009) completely lost the genetic resources of specialized dairy breeds ‐ Simmental, Holstein. Because of the reduction in the number of breeding animals, in the critical area of risk are the genetic resources of the Red Steppe and Black and White breed of Moldavian zone type. Their number does not exceed 2.5 thousand cows, which is less than the minimum requirements (75‐80 thousand) in the 30‐32 times. This means that in the long run it is impossible to solve a number of fundamentally important problems of breeding dairy cattle, such as: the creation of structural elements of the species (commercial herds, lines, families) and then use these elements for the improvement of local breeds, for custom pairings to produce bulls manufacturers and packaging companies on artificial insemination. Hence, the restoration of genetic resources planning breeds of dairy cattle, their wide use for a complete set of commercial herds, as well as in artificial insemination is an urgent task. Given the situation, the Government began to subsidize the purchase of overseas breeding animal’s world‐class rock and Austrian Simmental Holstein Dutch selection. The main purpose of their introduction: the restoration of their own breeding base at a qualitatively new level, the use of these breeds as improving the productive and to improve the quality of the local breeding of th 468 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Simmental and Black and White cattle, creating new types of intensive, in accordance with market demand. In this regard, there is a need for scientific support of the introduction of imported breeds, given that this process is associated with a preliminary evaluation of their breeding value, acclimatization to new environmental conditions, the formation of new structures and inbreeding, etc. Existing studies to assess the acclimatization ability of Austrian Simmental breeding are not numerous, were carried out on small samples and in environmental conditions that differ from those in the Republic of Moldova. Of course, these findings can not be extrapolated. Virtually no work carried out at the population level. As a basic evolutionary unit, the possibility of acclimation populations is much wider than that of a small sample of animals taken randomly from the population. All it says about the benefits of the introduction of population and, simultaneously, the need for accurate assessment of breeding value. Such an assessment of imported animal reproduction as compared to the local will continue to further evaluate the micro evolutionary processes occurring in the population during a period of acclimatization, to identify ways to improve the locale environment. The purpose of this study was to evaluate the breeding value of Simmental cows’ Austrian breeding. MATERIALS AND METHODS The object of research are the cows of Simmental breed, Austrian selection (n = 94). Animals were selected from 74 herds located in different regions of Austria and were introduce heifers aged 18‐19 months in the economy LLC "Strapit", Calarashi district. Their breeding value estimated by the phenotypic manifestation of the milk productivity of female ancestors (n = 282) 1‐10 highest lactation in Austria. Statistical processing of the data was performed by standard methods using the computer program Microsoft Excel. RESULTS AND DISCUSSION Been established which animals Simmental Austrian selection has a high potential for milk yield (Table 1). Table 1. The mean and variability of milk production traits of female ancestors introduced heifers at 1‐10 highest lactation (n = 282) Indicators Genetic and statistical parameters Yield for 305 days, kg 8848 136 2299 25,9 The fat content in milk,% 4,24 0,02 0,43 10,2 The protein content in milk,% 3,45 0,01 0,22 6,33 The number of milk fat, kg 374 6,1 102 27,4 The number of milk protein, kg 305 80 26,2 The number of milk fat + protein kg 680 179 26,4 10 Breeding Values of İntroduced Cows’ Population of Simmental Breed Cattle Austrian Selection 469 The average yield of 1‐10 highest lactation was 8848 kg with a fat content 4.24% and 3.45% protein. This yield and chemical composition of milk yielded up to 680 kg milk fat + protein. In this case, the phenotypic diversity of these traits, except for fat content (6.33%) and protein in milk (10.25%), relatively high ‐ 25.9 ‐ 27.4% and indicates the possibility of their further improvement. Dynamics of the milk production of heifers introduced female ancestors; according to lactation is presented in Table 2. It implies that the phenotypic expression of traits milk yield, fat and protein in milk is almost the same (P <0.05) in mothers (M) and the mother's mother (MM) heifers. In this case, the mother (M) is advantageous (different from the mother's mother (MM) from the difference between the = 6912 – 8369) against 2270 kg ( = limit of variation of milk yield ‐ 1448 kg ( 8509), respectively, due to the narrowing of the limit to a greater extent by minimum 6239 – level of the trait and indicates a more rigid selection of mothers (M). This is important given the greater contribution of maternal inheritance in the daughters than the mothers of mothers (MM). Consider next the evaluation of quality breeding heifers introduced, using sources of information about the mothers of the fathers (MF). The data presented in Table 2 clearly indicate a relatively high breeding quality than mothers (M) and the mother's mother (MM) on a range of symptoms, with the exception of the fat content in milk. Difference highly significant (P> 0.001) and amounted respectively to 63.9 ‐56.6% yield; of milk protein 39,0 46,1%; of fat + protein 52,5‐43,7%. Table 2. The dynamics of milk production female ancestors introduced heifers, depending on the lactation (n = 282) Lactation Yield, kg Fat,% 1‐7 Protein,% Fat, kg Protein, kg Fat + protein, kg Mothers (M) в т.ч. 7471±107 4,21±0,05 3,41±0,02 314±5 254±3 569±8, 1 6921±77 4,14±0,05 3,34±0,02 287±5 230±3 517±7 2 7547±139 4,20±0,06 3,39±0,03 316±6 256±5 576±11 3 7441±99 4,38±0,04 3,49±0,02 325±4 259±3 584±7 4 8369±84 3,85±0,03 3,39±0,01 322±4 284±2 606±6 5 7198±162 4,06±0,04 3,46±0,02 295±8 246±5 541±14 6 8197±95 4,13±0,03 3,31±0,01 341±5 271±3 613±8 7 7438±22 4,41±0,06 3,39±0,02 328±4 252±2 581±6 1‐8 в т.ч. Mothers’ mothers (MM) 4,29±0,05 3,45±0,02 1 7824±171 6239±112 4,39±0,04 3,59±0,02 335±7 272±4 269±6 223±4 604±13 496±8 2 7782±193 4,20±0,03 3,47±0,02 326±8 269±6 596±14 3 8509±180 4,34±0,05 3,37±0,03 368±8 287±7 658±15 4 8061±199 4,17±0,05 3,39±0,02 339±10 274±7 613±17 5 7607±207 4,53±0,07 3,46±0,03 345±11 263±8 609±19 6 7862±206 4,14±0,05 3,47±0,02 325±9 272±7 598±15 7 8156±151 4,32±0,06 3,47±0,03 351±7 280±4 632±11 8 7521±188 4,19±0,06 3,26±0,02 316±4 245±4 561±8 th 470 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) Lactation Yield, kg Fat,% Protein,% 1‐10 Fat, kg Protein, kg Fat + protein, kg Mothers’ Fathers (MF) в т.ч. 11249±187 4,22±0,04 3,51±0,01 474±9 393±5 868±14 1 9244±155 4,42±0,04 3,69±0,03 406±4 339±3 745±7 2 10332±137 4,08±0,03 3,63±0,01 423±7 375±4 798±12 3 11065±246 4,15±0,05 3,46±0,02 456±9 381±7 838±16 4 12049±208 4,19±0,02 3,47±0,02 506±10 416±5 923±15 5 12061±189 4,22±0,05 3,45±0,01 511±11 416±7 928±17 6 12885±180 4,28±0,01 3,53±0,01 551±5 454±5 1005±11 7 11367±148 4,95±0,09 3,57±0,01 568±17 405±4 973±20 8 10435±000 3,91±0,00 3,16±0,00 408±0 738±0 330±0 9 10577±000 4,14±0,00 3,68±0,00 438±0 827±0 389±0 10 12573±000 4,63±0,00 3,36±0,00 583±00 422±0 1005±0 It is fundamentally important to stress that the animals of this species exhibit a high milk yield up to 7‐10 lactations. Repeatability of milk yield record 1‐4 of lactation at the highest 80.8%; and 1 ‐6 ‐ in 92.5% of cows. This demonstrates the strength of the constitution and the ability of animals to prolonged use. Last quality is also important because the longer the animals are used the more conditions for the formation of families. Of course, these biological properties should be considered in a comparative assessment of adaptive features of the local animal genetic‐environmental generations. No less important is that female ancestors introduced heifers on first lactation have shown the highest productivity, although it increases with age. At the same time, mothers (M) between 1 ‐ 4 highest lactation milk yield was increased in 1276 kg, the mothers’ mothers (MM) between 1‐3 ‐ 2270 kg, and the mothers’ fathers (MF) ‐ Between 1 ‐ 6 ‐3641 kg. From this it follows that the cows Austrian Simmental breeding are reasonably high precocity and since 3‐4 and 6 are able to exercise maximum lactation milk production. Noteworthy is the fact that with increasing milk yields while increasing the tendency of fat and protein in milk, which should explain the direction of selection. Evaluation of phenotypic correlations between pairs of different characteristics confirms this assumption (Table 3). Table 3. The correlations between different features of milk production in female ancestors introduced heifers for the highest lactation (n = 94 for couples) Correlated attributes Mothers (M) Mothers’ mothers (MM) Mothers’ Fathers (MF) rxy±sr tr rxy±sr tr rxy±sr tr Yield, kg ‐ fat,% 0,06±0,10 0,6 0,07±0,10 0,6 0,02±0,10 0,2 Yield, kg ‐protein,% 0,07±0,10 0,7 0,11±0,10 1,1 0,57±0,08 7,1*** Yield, kg ‐ fat, kg 0,76±0,06 12,7*** 0,89±0,04 22,2*** 0,87±0,05 17,4*** Yield, kg ‐ protein, kg 0,73±0,07 10,4*** 0,95±0,03 31,7*** 0,95±0,03 31,7*** Yield, kg ‐ fat + protein kg 0,86±0,05 17,2*** 0,94±0,03 31,3*** 0,93±0,03 31,0*** Fat,% ‐ protein% 0,34±0,09 3,8*** 0,39±0,09 4,3*** 0,07±0,10 0,7 Breeding Values of İntroduced Cows’ Population of Simmental Breed Cattle Austrian Selection 471 As can be seen from Table 2 the values of the correlation coefficients between separate groups of symptoms ranging from low to high, as well as among different groups of mothers. Thus, the conjugation between the features of "yield, kg ‐ fat,%" "yield, kg ‐ protein% 'mothers (M) and the mother's mother (MM) is practically zero, except" yield, kg ‐ protein,% "mothers’ fathers (0.57). Positive and reliable values of the correlation coefficients are obtained by complex characters "yield, kg ‐ fat, (0,76‐0,89 kg)," yield, kg ‐ protein, (0,73‐0,95 kg), "yield fat + protein (0,86‐0,94 kg ), "the fat% ‐ protein% '(0,34‐0,39), except for" fat% ‐ protein%' (0.07) mothers’ fathers (MF). Within the previously obtained estimates of the frequency of record high milk yield onlactation should expect that this feature, as well as others ‐ genetically determined. In this regard, revealed that part of the phenotypic variability of traits caused by the genotype of parents (Table 4). Table 4. The heritability of milk production traits in female ancestors introduced heifers for the highest lactation (n = 94 pairs) Indicators Yield for 305 days, kg The fat content in milk,% The protein content in milk,% The number of milk fat, kg The number of milk protein, kg The number of milk fat + protein kg Correlation of mother‐ daughter rxy±sr 0,21±0,10 tr 2,1** heritability h2=2rM/Д 0,43 4,33 *** 0,78 0,38±0,09 4,22 *** 0,76 0,31±0,10 ** 0,62 * 0,34 * 0,51 0,39±0,09 0,19±0,10 0,26±0,10 3,1 1,9 2,6 Regardless of the method of calculation of statistically significant contribution of genotype and environment in the parental phenotypic variability of symptoms. In this case, the maximum genotypic diversity found in fat content (h2 = 0,78) and protein in milk (h2 = 0,76). At the same time found that the higher heritability (h2 = 0,78) feature (for example, the fat content in milk, %), the higher the correlation coefficient (rxy = 0,39) between the breeding value and phenotype of the proband parent and vice versa. Consequently, the productivity of the parents is an important source of information for preliminary assessment of the breeding value of introduced heifers. CONCLUSION Negative trends in dairy farming country, the stabilization of the productivity of animals at extremely low levels, reducing the number of cows, decreased milk production, largely due to poor development of the tribal base of the industry. Introduction of genetic resources of specialized dairy breeds and combined is one of the measures to accelerate the restoration of tribal base to a new level, which requires, in turn, scientific and methodological support. It is established that the cow Austrian Simmental breeding are characterized by high genetic potential milk yield (8848 kg average, lim. 6921‐ 12885 kg), precocity (3 ‐4 and 6 of lactation), repeatability and stability of its appearance for many (7 ‐10) lactations, which indicates the strength of the constitution and the ability of animals to long‐term economic use. A significant positive correlation between breeding value and phenotype of the proband and parents, between the majority of milk production traits, as well as very high reliability in terms of their genotypic diversity, especially in fat content (h2 = 0,78) and protein in milk (h2 = 0,76 .) th 472 RBI 8 Global Conference on the Conservation of Animal Genetic Resources Tekirdag, TURKIYE (4 ‐ 8 October 2011) These features selection and genetic parameters of milk productivity of cows Austrian Simmental breeding pedigree give grounds to use as a source of information on breeding values of introduction population, to assess their acclimation ability. REFERENCES 1. Altuhov JP Genetic processes in populations. ‐M., 1989. ‐328 Sec. 2. Darvin C. Changing Pets and crops .‐ Leningrad, 1951 ‐ 357 sec. 3. Dubinin NP Genetika.‐Chisinau., 1985.‐536 with. 4. Mashurov A. Genetic markers in animal breeding. ‐M., 1980. ‐315 Sec. 5. Merkureva EK Biometrics in plant breeding and genetics of farm animals. ‐M., 1970.‐423 Sec. 6. Plohinsky NA Guide to Biometrics for livestock. ‐M., 1969. ‐ 256. 7. Ctatisticheskie data. Livestock. / / Electronic resource. ‐Mode of access: http://www.statistica.md